ID: 906209925

View in Genome Browser
Species Human (GRCh38)
Location 1:44007084-44007106
Sequence GCAGGTGAGCAGAGGCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 6, 3: 74, 4: 649}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906209925_906209931 22 Left 906209925 1:44007084-44007106 CCTTCTGGCCTCTGCTCACCTGC 0: 1
1: 0
2: 6
3: 74
4: 649
Right 906209931 1:44007129-44007151 ACTTTCCTCTCTCCCTTCTCTGG 0: 1
1: 0
2: 5
3: 80
4: 579
906209925_906209932 23 Left 906209925 1:44007084-44007106 CCTTCTGGCCTCTGCTCACCTGC 0: 1
1: 0
2: 6
3: 74
4: 649
Right 906209932 1:44007130-44007152 CTTTCCTCTCTCCCTTCTCTGGG 0: 1
1: 0
2: 13
3: 113
4: 1120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906209925 Original CRISPR GCAGGTGAGCAGAGGCCAGA AGG (reversed) Intronic
900122156 1:1053415-1053437 GCGGGTGAGCAGGGGACAGGCGG - Intronic
900205927 1:1431921-1431943 GCAGGCCAGCACAGGCCGGAGGG - Intergenic
900607665 1:3531076-3531098 GCCGGTGACCAGAGGCCAGGTGG - Intronic
900620791 1:3586772-3586794 CCAGGTGGGCAGAGGCCACAGGG + Intronic
900647603 1:3716000-3716022 ACAGGTGAGCAGGAGCCACACGG - Intronic
900747125 1:4368035-4368057 GCAGGTGCACAGAGGTCAGTGGG + Intergenic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
900900910 1:5515247-5515269 CCAGGTGTGCAGAGGCCACAAGG + Intergenic
901225232 1:7609459-7609481 GCAGCAGAGCAGCAGCCAGAAGG + Intronic
901322014 1:8345783-8345805 GAAGATGGTCAGAGGCCAGATGG - Intergenic
902221323 1:14967649-14967671 CCGGAGGAGCAGAGGCCAGAGGG + Intronic
902326910 1:15706913-15706935 TCAGTTCAGCAGTGGCCAGAAGG - Intronic
902694838 1:18133276-18133298 GCTGCTCAGCAGAGGCGAGATGG - Intronic
902886011 1:19405298-19405320 GCAGGTGCTCGGAAGCCAGAGGG + Intronic
903005092 1:20293173-20293195 CCAGGTGAGTAGGGGCCACAGGG - Intronic
903056783 1:20641662-20641684 CCAGGAGAGCAGAGGCTAGGAGG - Intronic
903353203 1:22730592-22730614 ACGTTTGAGCAGAGGCCAGAAGG + Intronic
903380444 1:22893043-22893065 GAAGGTGAGCAGAGTCCAGCGGG + Exonic
903478649 1:23637675-23637697 ACAGTTGAGAAGAGGGCAGAAGG - Intronic
903953958 1:27012388-27012410 GCAGGTGAGAGGACGCCAGGCGG - Exonic
904200841 1:28818144-28818166 GCAGGTGGGCAGAGTGCAGGTGG + Intronic
904277698 1:29394978-29395000 GCAGGTGGACAGAGGCAGGAAGG + Intergenic
904369572 1:30040032-30040054 GCAGGTGAGCAGACACCCCAGGG + Intergenic
904484994 1:30818821-30818843 AAAGGTTAGAAGAGGCCAGAGGG + Intergenic
905402468 1:37713709-37713731 GCAGATCTGCAGAAGCCAGATGG - Intergenic
905478831 1:38247488-38247510 GCTGGTGACCGGAGGCCAGAGGG - Intergenic
905483069 1:38275039-38275061 GCTGTTGGGCAGAGGCCAGGAGG - Intergenic
905942562 1:41875422-41875444 GCAGATGAAGAGGGGCCAGAAGG - Intronic
906148028 1:43571372-43571394 GCAGGTGAGGAGATGGCAGTTGG - Intronic
906148143 1:43572068-43572090 GAAGGTGAGCAGAGGGCCGGAGG - Intronic
906193189 1:43912126-43912148 CTAGGTGAGCAGGGGACAGATGG + Intronic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906511131 1:46411042-46411064 GCTGGAGAGCAAAGGCCTGAGGG + Intronic
906670592 1:47651439-47651461 CAAGGAAAGCAGAGGCCAGAGGG + Intergenic
906684582 1:47755376-47755398 GCCAGTGTGCTGAGGCCAGAAGG + Intergenic
906744619 1:48213051-48213073 GGAGGTGGGGAGAGGTCAGATGG + Intergenic
906747245 1:48230702-48230724 GCAGGTAGGCAGAGGGAAGAGGG + Exonic
906836092 1:49084719-49084741 GCAGGAGGGAAGAGGCCAAAAGG - Intronic
907251363 1:53141874-53141896 GCCGGAGCGCAGAGGCCAGCAGG - Intronic
907296136 1:53456093-53456115 GCAGGTAACCTGAGCCCAGAAGG + Intergenic
907299325 1:53476742-53476764 GCAAGAGAGCAGAGGGCAGGAGG - Intergenic
907477312 1:54714401-54714423 GCAAGTGGGTAGGGGCCAGAAGG - Intronic
907525272 1:55050264-55050286 CAAGGTGGGCAGAGGCCAGATGG - Intronic
908415465 1:63909145-63909167 GCAGGTGCGCAGGGGGCAGGAGG - Intronic
908480223 1:64532455-64532477 GCATTTGAGCAGAGGCCTGGAGG + Intronic
908614447 1:65903257-65903279 GCAGGAAATGAGAGGCCAGAAGG - Intronic
908774869 1:67630033-67630055 GAAGGTGTGCAGAAGCCACAGGG - Intergenic
909023098 1:70453402-70453424 GCAGGTGAAAAGAGGGAAGAAGG + Intergenic
909023181 1:70454510-70454532 GCAGGTGAGAAGAGAGAAGAAGG + Intergenic
909339713 1:74518079-74518101 GCAGGTTACTAGAGGACAGATGG + Intronic
910647150 1:89525650-89525672 GCAGGTGCTGAGAGGTCAGAAGG + Intronic
910903642 1:92149950-92149972 GCAGATGAGAAGAGGAAAGATGG - Intergenic
911586112 1:99692791-99692813 GAAGGTGAACAGAAGGCAGAAGG - Intronic
912454612 1:109789180-109789202 GCCGGGGAGCAGAGGCCTCATGG - Intergenic
912517549 1:110225808-110225830 GCCGGGGAGCAGAGGGCAAAAGG - Intronic
913083573 1:115413028-115413050 CCAGGAGAGCAGAGCCCAAATGG + Intergenic
913721861 1:121604170-121604192 GAAAGTGGGCAGAGGACAGAGGG - Intergenic
913741645 1:121851752-121851774 GAAAGTGGGCAGAGGACAGAGGG - Intergenic
913986544 1:143570818-143570840 GCAGATGAGCAGTGACCAGGGGG + Intergenic
914582297 1:149029989-149030011 GCAGATGAGCAGTGACCAGGGGG + Intronic
914859804 1:151376521-151376543 GGAGGTGAGAAGAGGCCATCTGG - Intergenic
914932542 1:151948048-151948070 GCAGGTGAGCACAGTACGGAGGG + Intergenic
915225658 1:154409351-154409373 GGAGGAGAGCAGAAGGCAGAGGG - Intronic
915300202 1:154947398-154947420 GCAGGTGGGCACAGGCAGGAGGG - Exonic
915491068 1:156250313-156250335 GCAGGGGAGCTGAGGCAGGAAGG + Exonic
915553631 1:156649073-156649095 GCAGATAAGGAGAGGCCAAAAGG - Intronic
915564943 1:156707938-156707960 GCAGGGGAGCACAGGCTGGATGG + Intergenic
915594773 1:156890221-156890243 GCAGACTATCAGAGGCCAGAGGG - Intergenic
915740711 1:158116453-158116475 GAGGGTGAGCAGAAGCCAAATGG + Intergenic
916674520 1:167054469-167054491 GCAGGGCAGCAGGGGACAGAGGG + Intronic
917291715 1:173477642-173477664 GACGCTGAGCAGAGGCCACACGG - Intronic
917968638 1:180193865-180193887 AGAGGTCAGCAGGGGCCAGAGGG - Intronic
918082823 1:181220844-181220866 GCTGGTAGGCAGGGGCCAGAGGG - Intergenic
918157463 1:181863179-181863201 GCAGCTGGGGAGAGGCAAGAAGG + Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
919942778 1:202299774-202299796 AGAGGTGAGCAGAGTCCAGGGGG + Intronic
920011785 1:202873420-202873442 GATGGTGGGCATAGGCCAGAAGG + Intergenic
920137034 1:203778302-203778324 GAAGGAGAACAGATGCCAGAGGG - Intergenic
920211791 1:204333753-204333775 GCTGGAGAGCAGGGGCCAGGAGG - Intronic
920388753 1:205585933-205585955 GCAGGTGTGGGGAGGGCAGAGGG - Intronic
920712204 1:208306086-208306108 ACAGGTAAGCAGAGACCTGAAGG + Intergenic
920808937 1:209264223-209264245 GCAGGTGAGAGGAGGACAGGAGG - Intergenic
921252412 1:213310315-213310337 AGAGGTGAGCAGGAGCCAGATGG - Intergenic
921315665 1:213888068-213888090 CTAGCTGAGCAGAGGCCAGAAGG + Intergenic
921889766 1:220342085-220342107 GTAGGTGAGCAGAGACCACATGG - Intergenic
922160969 1:223078980-223079002 GCTGGGGAGAAGAGGCCAGAGGG + Intergenic
922182508 1:223246432-223246454 GCAGTAAAGCAGAGGCCGGAGGG + Intronic
922581164 1:226699047-226699069 GGGGGTGAGGGGAGGCCAGAGGG - Intronic
922748642 1:228060632-228060654 GCAGCTGAGCAGAGCAGAGACGG - Exonic
923031109 1:230249629-230249651 GCAGGAGAGCAAAGGCCTGCTGG - Intronic
1062979347 10:1708886-1708908 GTATGTGAGCAGAGGGCTGAGGG + Intronic
1064096384 10:12427419-12427441 TCAGGAGAGCAGAGGGCAAAAGG - Intronic
1064249201 10:13693879-13693901 TCAGGTAGGCAGAGGCCAGCTGG - Exonic
1064348897 10:14558562-14558584 TCAGGTGAGCAGTAGCCAGATGG - Intronic
1064493281 10:15883000-15883022 CCAGGAAAGCAGAGGCCAGGAGG + Intergenic
1065179131 10:23107311-23107333 GCAGGTGAGACCAGGCCAGATGG - Intronic
1067188980 10:44054062-44054084 GCAGGTGGGCAGGGGCAAGCAGG - Intergenic
1067462395 10:46467337-46467359 GATGGTGAGCAGAGGCCTGGGGG - Intergenic
1067523642 10:47026010-47026032 GCAGGGAGGCAGAGGGCAGATGG - Intergenic
1067624802 10:47917300-47917322 GATGGTGAGCAGAGGCCTGGGGG + Intergenic
1068924146 10:62517393-62517415 ACAAGAGAGCACAGGCCAGAGGG - Intronic
1069631478 10:69899707-69899729 TCTGAAGAGCAGAGGCCAGATGG - Intronic
1069782508 10:70965680-70965702 GAAGGTCAGAAGAGGTCAGATGG - Intergenic
1069875640 10:71561375-71561397 GCAAGGGAGAAAAGGCCAGAGGG - Intronic
1069891593 10:71655774-71655796 GAAGGTTAGCAGAGGCCTCATGG + Intronic
1069898174 10:71691780-71691802 GCAGGTGGTCAGTGGCCAGCAGG + Intronic
1069932133 10:71890029-71890051 GGAGGGGAGCAGAGGGCAGAGGG - Intergenic
1070285437 10:75080062-75080084 GCAGGAGAGCAGAGGAGTGAAGG + Intergenic
1070727770 10:78803806-78803828 GGAGATGAGCAAAGGCCAGGAGG - Intergenic
1070815033 10:79317532-79317554 GCAGCTGAGCAGTGGCCGGTGGG - Intergenic
1070828502 10:79404808-79404830 GAAGGTCAGCTGGGGCCAGAAGG - Intronic
1071506729 10:86236876-86236898 GCAGGAGAGCAGAGAGCAGGAGG + Intronic
1071524226 10:86348945-86348967 CCTGGTGAGCAGGGGCTAGAAGG - Intronic
1071556054 10:86602311-86602333 GCAAGAGAGCAGAGGGCAGGAGG - Intergenic
1071995799 10:91148014-91148036 GCAGAGGAGCAAAGGCCAAATGG - Intergenic
1072211233 10:93248832-93248854 CCAGGTTAGCAGAGGCCGGATGG + Intergenic
1072416087 10:95248152-95248174 GGAGGTGAGAAGGGGTCAGATGG - Intronic
1072421298 10:95292002-95292024 GCAGGTGAGGAAAGGGCAGGAGG - Intergenic
1072546451 10:96443116-96443138 GCTGGGGAGCAGAGGCAAGGGGG + Intronic
1072805705 10:98422995-98423017 GCAGGTGAAAGGATGCCAGAGGG - Intronic
1073148873 10:101298313-101298335 GCAGGGGAGGAGAGGTGAGAAGG + Intergenic
1073176915 10:101562288-101562310 GCAGGGCAGCTGAGGCCACAAGG + Intergenic
1074121894 10:110499039-110499061 GGAGGGGAGAAGAGGCCGGAGGG - Intronic
1074450275 10:113553757-113553779 GAAGGTGAGCAGGGGCCCAAGGG + Intronic
1075153424 10:119955355-119955377 ACATTTGAGCAGAGACCAGAGGG + Intergenic
1076013088 10:127006255-127006277 GCAGGAGAGCAGAAGGCAGGAGG - Intronic
1076133411 10:128028887-128028909 GGAGGACAGCTGAGGCCAGAGGG - Intronic
1076260007 10:129057922-129057944 CCAGCCAAGCAGAGGCCAGATGG + Intergenic
1076426928 10:130373610-130373632 CCAGGAGAGCAGTGGCCAGCAGG - Intergenic
1076594485 10:131617444-131617466 GAAGGTGGGCAGAGGGCAGAAGG + Intergenic
1076605778 10:131689126-131689148 GCAGGTGGGCAGAGCCCTGCTGG - Intergenic
1076836859 10:133025548-133025570 GCAGGTGCACAGCGGCCAGTGGG + Intergenic
1077009962 11:375325-375347 GCAGGAGAGGAGATGGCAGAGGG - Intronic
1077020363 11:414440-414462 GCAGGTGCACATGGGCCAGAGGG - Intronic
1077032749 11:477058-477080 GAAGGTGGGCAGAGCCCACAGGG - Intronic
1077165211 11:1131701-1131723 GCTGGTGAGCAGCCGCCAGGGGG - Intergenic
1077286632 11:1768959-1768981 ACAGGAGAGCAGAGGCCATGAGG + Intergenic
1077378886 11:2218774-2218796 GCCGGTGTGCAGAGACCACATGG + Intergenic
1077445036 11:2586896-2586918 GCAGTTGTGCAGCGTCCAGATGG - Intronic
1077551386 11:3201939-3201961 GCAGCTGAGCAGATGCAACATGG + Intergenic
1078672109 11:13374883-13374905 GGAGGTGGGCTGGGGCCAGAAGG - Intronic
1078801187 11:14644803-14644825 GCCGGAGAGCAGCGGCCTGAGGG - Exonic
1078846720 11:15125146-15125168 GCATTTAAGCAGAGGCCAGGAGG + Intronic
1078962648 11:16296424-16296446 GCAGCTGAGCAGAAGGAAGATGG + Intronic
1079120453 11:17680394-17680416 CCAGGTGAGCAGAAGCCATATGG - Intergenic
1079249775 11:18778999-18779021 GGAGCGGAGCAGATGCCAGAAGG - Intronic
1080064001 11:27988404-27988426 AGAGGTGACCAGAGGCCAGGTGG + Intergenic
1081079230 11:38718851-38718873 GCAGGTCAGCAGAGGGGAGCAGG - Intergenic
1081205777 11:40273967-40273989 GCAGGTGGGCAGTGGCTATAGGG + Intronic
1081436037 11:43028336-43028358 ACAGGAGATCAGAGGCCAGCAGG + Intergenic
1081701966 11:45157976-45157998 GGAGGTGAGCAGTGGGCAGCAGG + Intronic
1081793856 11:45806301-45806323 GCAGGTGAGCAGGGCATAGAAGG - Exonic
1082796597 11:57382388-57382410 TCTGGTGAGTAGAGACCAGAGGG - Intergenic
1083160893 11:60853470-60853492 GCAGGGAAGCAGAGGCCAACAGG + Exonic
1083460393 11:62807202-62807224 GGAAGGGAGCAGAGGCCAGCTGG - Exonic
1084287755 11:68142782-68142804 GCAGGTTGGCAGAGGCCTGGAGG + Intergenic
1084491188 11:69479526-69479548 GCAGGTGAGGAGAAGACAAAGGG + Intergenic
1084675234 11:70630224-70630246 GCAGGTGCCCTGAGGCCAGACGG + Intronic
1085531107 11:77192446-77192468 GCTCGTGAGGAGAGGCGAGATGG + Intronic
1085690925 11:78663095-78663117 GGAGGTGAACTGGGGCCAGAGGG + Intronic
1085738539 11:79060223-79060245 GCAGGGGAGGAGAGGCCTGAGGG + Intronic
1085794024 11:79520363-79520385 CCAGGTGAGCAGGGGCCAGGAGG - Intergenic
1086882661 11:92167587-92167609 GCATGTTAGCAGAAGCCATAAGG + Intergenic
1087130848 11:94668288-94668310 GCAAGGGGGCAGAGGCCAGGGGG - Intergenic
1090011092 11:123046602-123046624 GCACGGAAGCAAAGGCCAGATGG - Intergenic
1090066752 11:123510250-123510272 GCATGTGGGAAGAGGCCAGCTGG - Intergenic
1090458030 11:126866544-126866566 GCCCGTGGGCACAGGCCAGAGGG - Intronic
1091004799 11:131943115-131943137 GGAGGTGAGAAGAGGCCAGAAGG - Intronic
1091571635 12:1691496-1691518 GAAGGTGAGCAGAGGGCAGCAGG - Intronic
1091700142 12:2653782-2653804 GCTGGAGTGCAGAGGCCAGCTGG - Intronic
1091878813 12:3960087-3960109 GCAGGTCAGCGGGGGCCACAGGG - Intergenic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1092237944 12:6821640-6821662 GCCAGTGAGCCCAGGCCAGAGGG - Exonic
1092380268 12:7990454-7990476 AGGGGTGAGAAGAGGCCAGAAGG + Intergenic
1092621530 12:10276422-10276444 GGAAGTGAGCAAAGGCCAAAAGG - Intergenic
1092624163 12:10307746-10307768 GAAGGTGAGAGGAGGTCAGAGGG - Intergenic
1092878361 12:12868072-12868094 GCAGGTGAGCTGAGGCTTGGGGG - Intergenic
1092878368 12:12868094-12868116 GCAGGTGAGCTGAGCCTGGAGGG - Intergenic
1094000412 12:25688322-25688344 GCAAATGAGAAGAGGCAAGAGGG + Intergenic
1094096704 12:26713141-26713163 GCATGTGAGCAGAGGCCTGCAGG + Intronic
1094742233 12:33303172-33303194 GCAGGTGAAAGGAGGGCAGAAGG - Intergenic
1096490993 12:52012945-52012967 GCAGGTGAGCAGCACCCAGCTGG - Intronic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1097380739 12:58893084-58893106 GCAGGTGAGAGGAGGCCCCAGGG + Intronic
1099413461 12:82359391-82359413 GGAGGCAAGCAGAGGCCAGATGG + Intronic
1099586877 12:84529834-84529856 GCAGGTTAGCAGTGAGCAGAGGG - Intergenic
1099904822 12:88759999-88760021 GCACGTGAGCTCAGGCAAGAAGG + Intergenic
1100893946 12:99158751-99158773 GCAGGGAAGGAGGGGCCAGAGGG - Intronic
1101736643 12:107468246-107468268 GCAGGTGAGCTGGAGCCAGCCGG + Intronic
1102024086 12:109703636-109703658 GCAGGCGGGGAGAGGGCAGATGG - Intergenic
1103834665 12:123809221-123809243 ACAGGAGAGAAGAGGACAGATGG - Intronic
1104695743 12:130862384-130862406 GCAGGTGAGCACAGGAGAGAAGG - Intergenic
1105285074 13:18996752-18996774 GCAGAAGGCCAGAGGCCAGAAGG + Intergenic
1105545716 13:21349217-21349239 GCAGATGTGCAGAGGGCAGTAGG - Intergenic
1106017010 13:25879070-25879092 GCAGGAGAGCAGAGGGCATTTGG + Intronic
1106140169 13:27005406-27005428 GAGGGTGGGCAGAGGCCAGTGGG - Intergenic
1106436703 13:29729660-29729682 GGAGAAGAACAGAGGCCAGAGGG - Intergenic
1106524809 13:30530955-30530977 GAAGGTCACCTGAGGCCAGAAGG + Intronic
1106692008 13:32128183-32128205 ACAGGTGAGCAGAGGACATTCGG - Intronic
1106865418 13:33959203-33959225 GAAGGAGAGCAGAGACCACAGGG - Intronic
1107690404 13:42947873-42947895 GAAGGTGAGCAGAGCCCTGACGG - Intronic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1108360910 13:49667174-49667196 GCAGTAGAGGAGATGCCAGAGGG - Intronic
1108806088 13:54158368-54158390 ACAGGTGAGGTGAGGCCAGGTGG - Intergenic
1110640702 13:77820498-77820520 GCAGGAGATCAAAGGACAGAAGG + Intergenic
1110709691 13:78636617-78636639 GCAGGTGCCTAGAGCCCAGAGGG - Intronic
1111170090 13:84515699-84515721 AAAGGTAAGCAGAGACCAGAGGG - Intergenic
1112588187 13:100738340-100738362 GCAGGAGATCAATGGCCAGAAGG + Intergenic
1112895057 13:104288662-104288684 GCCGGTGTGAAGAGGACAGAAGG + Intergenic
1113432367 13:110261937-110261959 GCAGGTGGGCACAGGGCAGGTGG + Intronic
1113790951 13:113027868-113027890 CCAGGTGTGCTGTGGCCAGAGGG + Intronic
1113941607 13:114021187-114021209 GCAGGTGAGGAGAGGCAGCAGGG - Intronic
1115803164 14:37019217-37019239 GCAACTGAGAAGAGGCCACATGG - Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1116901218 14:50363826-50363848 AGAGGTAAGCAGAGGCCAAATGG - Intronic
1117288974 14:54314458-54314480 TCAGGTGAGCAGAAGCGGGAAGG - Intergenic
1118630409 14:67697317-67697339 ACATTTGAGCGGAGGCCAGAGGG + Intergenic
1119171330 14:72538430-72538452 GTAGGTGAGCTGAGTCCTGAGGG + Intronic
1119192010 14:72689324-72689346 GCATGTGAGCGGAGGCCTAATGG - Intronic
1119423983 14:74524216-74524238 CCTGCTGAGCAGAGGCCAGAAGG + Intronic
1119616240 14:76100834-76100856 GCAGGTGTGCAGAGCACAGTGGG - Intergenic
1119730597 14:76948588-76948610 GCAGGTGACTGGAGGGCAGAAGG + Intergenic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1121321695 14:92995266-92995288 GTGGGTGAGCAGAGGGCAGGGGG - Intronic
1121333071 14:93060044-93060066 GCAGGAGACCAGAGGGCAGGAGG + Intronic
1121660672 14:95632773-95632795 GCTGTAGAGCAGAGGGCAGAAGG + Intergenic
1121668445 14:95690544-95690566 GCAGGTCAGAGGGGGCCAGAAGG + Intronic
1122309434 14:100785244-100785266 GCAGGGGAGCAGAAGGCAGGGGG - Intergenic
1122461013 14:101895484-101895506 ACAGGTCAGCAGGGGCCAGAGGG - Intronic
1122723464 14:103735312-103735334 GCAGCTGAGCGTAGGCCTGAGGG - Intronic
1122742700 14:103881279-103881301 GAAGATGGGGAGAGGCCAGAGGG - Intergenic
1122857464 14:104566745-104566767 GCAGGTGAGCACTGACCAGGTGG + Intronic
1122942203 14:104986399-104986421 CCAGGCCAGCAGAGGCCCGATGG - Exonic
1123068004 14:105627880-105627902 GCAGGTGAGCAGGGGCAGGTGGG - Intergenic
1123068093 14:105628194-105628216 GCAGGTGAGCAGGGGCAGGTGGG - Intergenic
1123091659 14:105744803-105744825 GCAGGTGAGCAGGGGCAGGTGGG - Intergenic
1123091684 14:105744882-105744904 GCAGGTGAGCAGGGGCAGGTGGG - Intergenic
1123091709 14:105744961-105744983 GCAGGTGAGCAGGGGCAGGTGGG - Intergenic
1123091800 14:105745277-105745299 GCAGGTGAGCAGGGGCAGGTGGG - Intergenic
1123091882 14:105745582-105745604 GCAGGTGAGCAGGGGCTGGTGGG - Intergenic
1123091949 14:105745870-105745892 GCAGGTGAGCAGGGGCAGGTGGG - Intergenic
1123092047 14:105746262-105746284 GAAGGTGAACAGGGGCCAGTGGG - Intergenic
1123097409 14:105773074-105773096 GCAGGTGAGCAGGGGCAGGTGGG - Intergenic
1123097610 14:105773859-105773881 GCAGGTGAGCAGGGGCTGGTGGG - Intergenic
1125198671 15:37078290-37078312 GCCGGTGAGAAGTGGCAAGAAGG + Intronic
1125490599 15:40145817-40145839 GAAGGTGAGCAGTGCCCAAAGGG + Intergenic
1125611841 15:40976640-40976662 GCAGGAGAGCAGAGGCCTTGTGG + Intergenic
1125653274 15:41334661-41334683 GAAGGTGATCTGAGGCTAGAGGG - Intronic
1125766073 15:42137418-42137440 GCAGAAGCGCTGAGGCCAGAGGG + Intergenic
1125999565 15:44195762-44195784 GCTGGAGCACAGAGGCCAGACGG - Intergenic
1126843653 15:52740238-52740260 GGAGGTGGGGAGAGGTCAGATGG - Intergenic
1127768320 15:62209481-62209503 ACAGGTGAGAAGAAGCCATAGGG + Intergenic
1127910229 15:63410699-63410721 GCAGGTGAGCAGGAGCCAGGTGG - Intergenic
1128034701 15:64514593-64514615 GAAAGTGAGAAGAGGCTAGAAGG - Intronic
1128348256 15:66869084-66869106 GCAGGAGAACAGAAGGCAGAGGG - Intergenic
1129094745 15:73193884-73193906 GCATGTGAGCCGAGCCTAGAAGG + Intronic
1129198520 15:73984987-73985009 GAAGTTGAACAGAGGCCTGAAGG - Intronic
1129298299 15:74611661-74611683 GCAGGTGAGCATAGGAAAGTTGG - Intronic
1129906602 15:79192023-79192045 GGAGAGGAGCAGAGGCCAGCAGG - Intergenic
1130657100 15:85799290-85799312 ACATGTGAGCAGAAACCAGAAGG - Intergenic
1131051720 15:89352609-89352631 GCAGCTGAGCAGAGGCCGTGGGG - Intergenic
1131391056 15:92049210-92049232 GGAGGGTAGCAGAGGCCAGGAGG - Intronic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1132353193 15:101153230-101153252 GCAGGTCAGCAGAGGCAGGCAGG - Intergenic
1132668660 16:1093953-1093975 GCAGGGCCGCAGAGGCCAGAAGG - Exonic
1132772529 16:1572164-1572186 CCAGGTGGGCAGAGGCCACAGGG + Intronic
1133241133 16:4415334-4415356 GCATTTTAGCTGAGGCCAGAAGG - Intronic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1134220920 16:12353288-12353310 GTAGGTGTCCAGGGGCCAGATGG - Intronic
1135207866 16:20498564-20498586 GCAGCTGAGAAGAGACAAGAGGG + Intergenic
1135211033 16:20525136-20525158 GCAGCTGAGAAGAGACAAGAGGG - Intergenic
1135991408 16:27220953-27220975 GAAGGTGGGGAGAGCCCAGAAGG + Intronic
1136177422 16:28527185-28527207 GCATTTAAGCAAAGGCCAGAAGG - Intergenic
1136275564 16:29177455-29177477 TCGGGGGAGCAGAGGCCCGAAGG - Intergenic
1136417570 16:30113157-30113179 GCTGGGGAGGTGAGGCCAGAGGG - Intronic
1136516089 16:30769158-30769180 GCAAGTGGGCAGAGACAAGATGG - Intronic
1138135486 16:54517653-54517675 ACATGTAAGCAGAGGCCTGAAGG - Intergenic
1138228972 16:55324176-55324198 GGAGGAGAGCAGAGGCCCGGGGG - Exonic
1138531009 16:57634368-57634390 GCAGAGGAGCAGTGGGCAGAGGG - Intronic
1138542878 16:57699065-57699087 GCTGGAGAGCAGAGGGCACAGGG + Intronic
1139144590 16:64308335-64308357 GGAGGTGAGCAGAGGGCAGCAGG + Intergenic
1140350634 16:74258831-74258853 GCAGGTGTTCAGAAGCCAAACGG - Intergenic
1140988890 16:80188806-80188828 ACATCTGAGCAGAGGCCTGAAGG - Intergenic
1141066175 16:80915864-80915886 GCAGGTGACCACAGGGTAGAAGG + Intergenic
1141168730 16:81677798-81677820 GCAGGAGAGCAGAGTCCTGGAGG + Intronic
1141649083 16:85383696-85383718 GGAGGGGAGCAGAGGCCAAGAGG + Intergenic
1141948043 16:87323678-87323700 GCAGGTCTGCAGAGGACAGACGG - Intronic
1142132890 16:88438856-88438878 GCTGGTGAGCAGGGGCCCCACGG + Exonic
1142431200 16:90028719-90028741 CCATGAGGGCAGAGGCCAGAGGG - Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143331672 17:6141386-6141408 GCCAGGGAGCAGAGGTCAGAAGG + Intergenic
1143386887 17:6536266-6536288 GCAGGTGAGCAGGGCCCGAAGGG + Intronic
1143879813 17:10021469-10021491 GCAGCTACGCAGAGGGCAGAAGG - Intronic
1143967497 17:10767346-10767368 GCTGGGGAGCACAGGCAAGAAGG - Intergenic
1144329281 17:14209929-14209951 GGAGGTTAGCAGTGGTCAGATGG - Intergenic
1144675409 17:17158547-17158569 GCACGGGAGCGGAGGCGAGAGGG + Exonic
1144734348 17:17546623-17546645 GCCTGTGAGCAGAGGCCTGGGGG - Intronic
1145007382 17:19345218-19345240 GCAAGTGGGCAGAGGCCATGAGG + Intronic
1145112015 17:20172207-20172229 GCAGGAGCCCTGAGGCCAGAAGG - Intronic
1145234742 17:21200595-21200617 GCAGGGGAGCAGTGACCAGCAGG - Intronic
1146271968 17:31490458-31490480 GCAGGTGAGCAGTTCCCAGAAGG + Intronic
1146471412 17:33127932-33127954 GCAGGAGAGAAGAGGCTAGAAGG - Intronic
1147689330 17:42305817-42305839 AGAGGTGAGGTGAGGCCAGAAGG + Intronic
1147878158 17:43636361-43636383 GCAGGTGAGCAGATTTCTGAAGG + Intergenic
1147888115 17:43698230-43698252 AAAGGTGAGCTGAGACCAGACGG + Intergenic
1148043967 17:44731012-44731034 CCAGGTGAGCTGGGGCAAGATGG + Exonic
1148653748 17:49268099-49268121 GCAGGAGAGCAGGGGACAGCAGG - Intergenic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1148864084 17:50619627-50619649 GCAGGGGAGCAGGGGTCAGAGGG - Intronic
1148903340 17:50895087-50895109 GTAGATGTGCAGAGGCCACAAGG - Intergenic
1149597387 17:57872396-57872418 GCAGGTGTGCAAAGGGAAGAAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151365015 17:73611546-73611568 CCATGTGAGCAGAGGCCACAGGG - Intronic
1151599966 17:75100121-75100143 GCGGGAGAGCAGCGGCCAGAGGG - Exonic
1151713895 17:75821800-75821822 GCGAGTGAGCAGAGGGCAGCTGG + Intronic
1152161143 17:78669437-78669459 AGAGGTCAGCAGGGGCCAGATGG - Intergenic
1152398489 17:80049654-80049676 GATGGTGAGCTGGGGCCAGAGGG - Intronic
1152705434 17:81841223-81841245 GGATGTGGGCAGAGGCCCGAGGG - Intergenic
1152759348 17:82099808-82099830 GCTGGTGATCAGCGGCCAGCGGG + Intergenic
1155840051 18:30632552-30632574 GCAGGTGCACAGTGGACAGATGG - Intergenic
1156828137 18:41457921-41457943 GCAGGTGCACGGAAGCCAGAGGG + Intergenic
1158872265 18:61699474-61699496 GCAAGAGAGCAGAGAACAGATGG + Intergenic
1159022587 18:63155654-63155676 GCAGGTGAGAAGAGGCTGGGAGG + Intronic
1159030740 18:63228347-63228369 ACACTTGAGCAGAGGCCTGAAGG - Intronic
1160036205 18:75304034-75304056 GAAGGTGAGCAAAGCCTAGATGG + Intergenic
1160036463 18:75305832-75305854 GCACGTGGGCAGTGGTCAGAGGG - Intergenic
1160169761 18:76543463-76543485 GCTGGTGAGGAGGTGCCAGAAGG + Intergenic
1160227964 18:77025905-77025927 GCAGGGGAGCAGTGGGCAGCGGG + Intronic
1160320854 18:77893523-77893545 GAAGGAGAGCAGAAGCCAGGAGG - Intergenic
1160378101 18:78429375-78429397 GGAGGAGGGCAGAGGCCAGTGGG - Intergenic
1160586537 18:79916396-79916418 GCAGGTGAACAGAGGGCAAAAGG - Intronic
1160738124 19:674056-674078 GGGGGTGAGCAGAGGCCACGAGG + Intergenic
1160996379 19:1883983-1884005 GCAGAGGAGCAGAGGCAGGAAGG - Intronic
1161026427 19:2039350-2039372 GAAGGTGAGCAGAGGGTAGGTGG - Exonic
1161241263 19:3225078-3225100 GGAGGTGAGCAGAGGAGGGATGG - Intronic
1161389713 19:4014775-4014797 GCAGGGGAGCGGGGGCCAGCTGG - Intronic
1162014861 19:7839940-7839962 CCTGGAGAGCAGAGGCCAGTTGG + Intronic
1162360876 19:10219796-10219818 GCATTTGAGCAGAGTCCTGAAGG + Intronic
1162400645 19:10444570-10444592 ACATTTGAGCAGAGGCCTGAAGG + Intronic
1162604378 19:11695315-11695337 GGAGGAGAGCCGAGGCCATACGG + Intergenic
1163466685 19:17471907-17471929 GCAGGTGGGCAGGGAACAGATGG - Intronic
1163710880 19:18846116-18846138 GCAGGTGAGCTGAGCTCAGCTGG + Exonic
1163755078 19:19101748-19101770 ACATGTGATCAGAGGTCAGAGGG - Intronic
1164720312 19:30427114-30427136 ATAGGTAAACAGAGGCCAGATGG - Intronic
1164794892 19:31017913-31017935 GCAGGTGAGCAAAGGAAGGAGGG + Intergenic
1164833574 19:31341373-31341395 GTAGGTGCACAGAGGCCTGATGG + Intronic
1165324079 19:35104136-35104158 GCAGAGGAGCAGAGGCTGGAAGG + Intergenic
1165364734 19:35358646-35358668 GCAGGTGAGCCTGGGCCCGAGGG + Exonic
1165366552 19:35371115-35371137 GCAGGTGAGCCTGGGCCCGAGGG + Intronic
1165428323 19:35757542-35757564 TCTGGTGCGCAGAGGCCAGGGGG + Intronic
1165490924 19:36122170-36122192 GCAGGTGAGCAGAGCGCAGGAGG + Intronic
1166614825 19:44233981-44234003 ACATGTGAGCAGAGACCTGAAGG + Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1166917687 19:46206808-46206830 TCAGGAGAGGGGAGGCCAGAAGG + Intergenic
1167142462 19:47661444-47661466 GGGGAGGAGCAGAGGCCAGAGGG + Intronic
1167221663 19:48203212-48203234 GCATTTGAGCAGGGGCCCGAGGG - Intronic
1167391414 19:49197442-49197464 GCAGAGGGGCAGAGGACAGAGGG - Intronic
1167593719 19:50417110-50417132 GGAGGTGAGGAGGGGCCAGGTGG + Intronic
1168103643 19:54153908-54153930 GCAAGGGAGCAGAGGCCAGCAGG - Intronic
1168260018 19:55188059-55188081 CCAGGTGGGGAGAGGACAGAGGG - Exonic
924976209 2:178021-178043 GCTGGAGAGCAGAGTGCAGAAGG + Intergenic
925122820 2:1432517-1432539 GCAGGTGAGGGGAGGCCTGCAGG + Intronic
925122824 2:1432535-1432557 GCAGGTGAGGAGAGGCCTGCAGG + Intronic
925122834 2:1432571-1432593 GCAGGTGAGGAGAGGCCTGCAGG + Intronic
925122846 2:1432607-1432629 GCAGGTGAGGGGAGGCCTGCAGG + Intronic
925122852 2:1432625-1432647 GCAGGTGAGGGGAGGCCTGCAGG + Intronic
925122856 2:1432643-1432665 GCAGGTGAGGAGAGGCCTGCAGG + Intronic
925122884 2:1432732-1432754 GCAGGTGAGGGGAGGCCTGCAGG + Intronic
925122888 2:1432750-1432772 GCAGGTGAGGAGAGGCCTGCAGG + Intronic
925122903 2:1432804-1432826 GCAGGTGAGGAGAGGCCTGCAGG + Intronic
925122907 2:1432822-1432844 GCAGGTGAGGAGAGGCCTGCAGG + Intronic
925888669 2:8415154-8415176 GTAGGTGTGCTGAGCCCAGAGGG - Intergenic
926054865 2:9768561-9768583 GCAGGTGAGCAGAGCGCTGGAGG + Intergenic
926119502 2:10234545-10234567 GCAGGTGGCCAGATGCCTGAAGG + Intergenic
926145324 2:10393724-10393746 GCAGGTGAGCACAAGCCTGCTGG - Intronic
926389042 2:12368597-12368619 GTTGGAGAACAGAGGCCAGATGG + Intergenic
926724621 2:15987601-15987623 GCAGGCAAGCAGAGGCCTGGAGG - Intergenic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927288971 2:21386119-21386141 GAAGCTGAGCAGATGCCAGAAGG + Intergenic
927517259 2:23679764-23679786 GGAGGAGGGCAGAGGGCAGAGGG + Intronic
927708450 2:25311148-25311170 GGCGGTGGGCAGAGGCTAGAGGG + Intronic
927850825 2:26498257-26498279 GAAGGTGGGCAGAGGCTTGAAGG + Intronic
927963651 2:27256392-27256414 CCAGGTGTGCAGAGGCAACATGG + Exonic
928947631 2:36786078-36786100 GGTGGGGAGCAGCGGCCAGACGG - Intronic
929074297 2:38065605-38065627 GCCCGTGAGCACTGGCCAGAGGG - Intronic
929076769 2:38084814-38084836 GGAGGTGGGGAGAGGTCAGATGG + Intronic
929174557 2:38963085-38963107 GCAGGTGGGCAGAGACCATGTGG + Intronic
930171100 2:48252567-48252589 GCATCTGAGCAGAGGACAAAAGG + Intergenic
931193023 2:60023875-60023897 GGAGGTGAGGAGAGGCAGGAGGG - Intergenic
931418353 2:62102582-62102604 ACAGGAGAGCAGGGGGCAGAAGG - Intronic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
932092999 2:68823467-68823489 GCAGGTAAGTAAAGGCCTGAAGG + Intronic
932567172 2:72917473-72917495 GCAGGTGAGCGGCGGCCAATGGG + Exonic
932706857 2:74032647-74032669 GCCGGTGGACAGAGGCCAGCCGG - Intronic
932818452 2:74879948-74879970 GCAAGGGAGCAGTGGCCAGGGGG + Intronic
933688052 2:85158814-85158836 GTAGGTGAGCTGTGGCCACAGGG - Intronic
933730504 2:85452608-85452630 ACATCTGAGCAGAGACCAGAAGG - Intergenic
933784846 2:85830417-85830439 GCAGCTAAGGAGAGGTCAGAGGG - Intergenic
934066382 2:88345791-88345813 TGAGGTGAGGAGAGGTCAGAAGG - Intergenic
935466670 2:103406371-103406393 GCTGGGGAGCAGAGGCATGAGGG - Intergenic
935873573 2:107479738-107479760 GCAGAGGAGCAAAGGACAGAAGG - Intergenic
936152630 2:110030045-110030067 CCGGGGGAGCAGGGGCCAGAGGG + Intergenic
936192050 2:110341367-110341389 CCGGGGGAGCAGGGGCCAGAGGG - Intergenic
936278445 2:111119641-111119663 GCAGGTGAGGTCAGGCTAGATGG - Intronic
937002921 2:118484605-118484627 GCAGGTGAGCAGAGGTTCCAAGG - Intergenic
937123222 2:119455173-119455195 GGAGGTGGGCAGAGGGTAGAGGG - Intronic
937369133 2:121285462-121285484 AGTGGGGAGCAGAGGCCAGAGGG - Intergenic
937547916 2:123047312-123047334 GCAGGATAGCAGAGGCTACAAGG + Intergenic
937863978 2:126734088-126734110 GCAGGTTAGGTTAGGCCAGAAGG - Intergenic
937902672 2:127033771-127033793 GCAGGTGAGCAGATTGCAGGAGG - Intergenic
938074987 2:128327213-128327235 GCAGGTGGGCAGGGCCCACACGG - Intergenic
938245741 2:129776495-129776517 GCAGGAGACTGGAGGCCAGATGG - Intergenic
938576059 2:132605808-132605830 GCAGGGTAGCAGAGGCCAAAGGG + Intronic
938761699 2:134431832-134431854 GCAGTTGAGCAGTCGCCAGCAGG + Intronic
939855873 2:147357896-147357918 TCAGGTGATCAGTGGCTAGAAGG + Intergenic
944203739 2:197135746-197135768 GCAGGGGAGCAGGGGCCGGGAGG - Intronic
944530393 2:200662271-200662293 GCAGGGCAGCAGAGGAGAGAGGG + Intronic
944855301 2:203761532-203761554 GCAGGTGAGCAGCATTCAGAGGG - Intergenic
946145574 2:217728135-217728157 GCACGTGAGCAGAGGAGATAAGG + Intronic
946231150 2:218292045-218292067 GCTGGTGAGAAGAGGGAAGAGGG - Intronic
946353035 2:219168156-219168178 GCAGGGCAGTAGAGGTCAGAAGG - Intronic
947365877 2:229394473-229394495 GCAGGTTTGCAGAGGCCTGCAGG + Intronic
947501742 2:230675879-230675901 ACAGGTGGGCAGAGGAAAGAGGG - Intergenic
947544603 2:231001926-231001948 GCATGTGAGCCGAGTCCAGAAGG + Intronic
947670653 2:231933600-231933622 GCAGCAGAGCAGTGGGCAGACGG + Intergenic
948052396 2:234988513-234988535 CCAGGGGAGCAGAGCCCAAAGGG + Intronic
948560192 2:238847181-238847203 GCGGGTCAGCAGAGGACGGAGGG - Intergenic
948688162 2:239684525-239684547 GCTGGTGAGCAGAGCTCATATGG + Intergenic
948741830 2:240053441-240053463 TCAGGTAAGCAGTGGGCAGACGG - Intergenic
948750854 2:240132086-240132108 GCAGCAGAGCAGAGGTCGGAAGG - Intronic
948762946 2:240203948-240203970 GCAGGGAAGCAGAGGGCTGAGGG + Intergenic
948788486 2:240365273-240365295 GGAGGTGGGCAGAGGCGAGGTGG - Intergenic
1168983445 20:2027041-2027063 GCAGCTCAGCACAGGCCTGAGGG - Intergenic
1169533195 20:6507321-6507343 GCAGGTGTCCTGAGGCCATATGG + Intergenic
1169767485 20:9163109-9163131 GAAGGGGAGCAGTGGCTAGAAGG + Intronic
1171238153 20:23544635-23544657 GTGGGTCAACAGAGGCCAGATGG - Intergenic
1171370854 20:24661277-24661299 GCAAGTGAGCAGAAGAAAGAAGG + Intronic
1171480296 20:25450179-25450201 GCAGGTGAAAGGAGGGCAGAAGG + Intronic
1172069555 20:32246557-32246579 ACATTTGAGCAGAGGCCTGAAGG + Intergenic
1172211017 20:33198613-33198635 GCATTTGAGCAGAGACCTGAAGG - Intergenic
1172435245 20:34924436-34924458 ACATTTGAGCAGAGGCCTGAAGG + Intronic
1172460756 20:35116577-35116599 GCATTTGAGCAGAGACCTGAAGG - Intronic
1172772463 20:37389546-37389568 CCAGGTGGGCAGTGGCCAGGAGG - Intronic
1172780101 20:37431490-37431512 GCAGGAGCTCAGAGTCCAGAGGG + Intergenic
1172798131 20:37557344-37557366 GCAGGTGAGCAGAGGAGTGCAGG + Intergenic
1172871234 20:38136700-38136722 GCAGGTGTGAGGAGGGCAGAGGG - Intronic
1173315163 20:41936617-41936639 TCAGCTGAGCAGAGCCCAGTGGG + Intergenic
1173364647 20:42373939-42373961 GAACCTGAGCTGAGGCCAGAGGG + Intronic
1173633214 20:44531975-44531997 GCAGGTGAGCAGGAGCCGGGCGG + Exonic
1173812277 20:45963409-45963431 GAAGGCAAGCAGAGGCCAGCTGG - Intronic
1173922330 20:46755650-46755672 ACATTTGAGCAGAGGTCAGAAGG - Intergenic
1174297653 20:49560628-49560650 CCACGTGAGCAAAGACCAGAAGG + Intronic
1175165953 20:57045027-57045049 GCAGGTGGGCAGGGTCCAGATGG - Intergenic
1175357711 20:58382006-58382028 GAAGATGAGCATAGGGCAGAGGG - Intergenic
1175921778 20:62453542-62453564 GCAGGTGGGCAGAGCCTCGAGGG + Intergenic
1176342628 21:5713005-5713027 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
1176474882 21:7145156-7145178 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
1176502199 21:7611451-7611473 GCAGATGAGCAGAGGGTAGGAGG + Intergenic
1176536949 21:8111074-8111096 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
1177623173 21:23623669-23623691 GCAGGTGTGCATAGGCCTGTAGG + Intergenic
1178517901 21:33264265-33264287 CCAGGTGAGCAGTGGAGAGAAGG + Exonic
1178635459 21:34298397-34298419 GCAACTGAGGAGAGGACAGATGG - Intergenic
1179099773 21:38346422-38346444 TCAGGGGAGCAGAGAGCAGAAGG + Intergenic
1179368288 21:40779863-40779885 GAAGGTGTGCAGAGACCAGATGG + Intronic
1179478754 21:41664777-41664799 GGAGGTGACAAGAGGCCGGAAGG + Intergenic
1179682024 21:43029282-43029304 GATGGAGAGCAGAGGCCACAGGG - Intronic
1179826113 21:43967344-43967366 GCAGGTGGCCAGAGGCCTGCGGG - Intronic
1179840000 21:44066076-44066098 ACAGTTGAGCAGAGGCCAGGGGG + Intronic
1180979588 22:19872335-19872357 GCAGGTGGGCAGAGGCCAGCAGG + Intergenic
1181150897 22:20882530-20882552 GCAGCTGAGGAGAGCCCAGATGG + Intronic
1181327404 22:22060698-22060720 GCCTGTGACCAGAGGCCAGGTGG - Intergenic
1181533567 22:23530532-23530554 TCAGGTGGGCTGAGGGCAGAGGG + Intergenic
1181533918 22:23532131-23532153 TCAGGAAAGCAGAGGCCTGAGGG + Intergenic
1181585207 22:23849362-23849384 GCAGGCGGGCCGAGGCCGGATGG + Intergenic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1182030721 22:27157374-27157396 GCAGGTGAGCAGGGCCCCCATGG + Intergenic
1182044392 22:27262877-27262899 ACAGGTGAGCAGAGGGCCTAGGG - Intergenic
1182395141 22:30030099-30030121 GCAGGTGTTCAGAGGCATGAAGG + Intronic
1183292200 22:37009793-37009815 GAAGGTGAGCAGAGTCTTGAAGG - Intergenic
1183386217 22:37516280-37516302 GCAGATGAGGAGGGGCCTGAGGG - Exonic
1184153394 22:42651174-42651196 ACAGGTGAACAGAGGCCTGATGG + Intergenic
1184258587 22:43301545-43301567 GCACGTGAGCTGAGGTCTGAAGG - Intronic
1184334338 22:43844612-43844634 CCAGGTGTGCAGAGCTCAGAGGG - Intronic
1184366373 22:44054166-44054188 GCAGGTGAAAGGAGGGCAGAAGG + Intronic
1184508264 22:44917157-44917179 GAAGGTGTGCAGAGGGCAGCCGG + Intronic
1184564028 22:45280646-45280668 GCAGTTTATCAGAGGCCAGCAGG - Intergenic
1184585331 22:45444106-45444128 TCAGGTGGGCAGAGGCCTGATGG + Intergenic
1184600108 22:45538426-45538448 TCAAGGGAGCAGAGCCCAGAAGG - Intronic
1184690483 22:46115135-46115157 GGAGGTGAGCACAGGCATGAGGG - Intergenic
1184724132 22:46333280-46333302 TCAGGTGAGCAGAGGACTGATGG - Intronic
1185076843 22:48687732-48687754 GGAGGTGACCTGAGGCCAGCAGG - Intronic
1185332754 22:50258999-50259021 GGGGCTGAGGAGAGGCCAGAGGG + Intronic
1203241899 22_KI270733v1_random:27478-27500 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
950239995 3:11360682-11360704 GGAGGTCAGCAGATGCCACAGGG - Exonic
950264140 3:11562218-11562240 GCCAGTGAGGAGAGGCAAGATGG - Intronic
950535339 3:13575060-13575082 GCGGGTGGGCTGAGGACAGACGG + Intronic
950543630 3:13626576-13626598 GAAGGTGAGAAGGGCCCAGAAGG + Exonic
950662935 3:14477819-14477841 GAGGGTGAGCAGGGGCCAGGAGG + Intronic
950702821 3:14761806-14761828 GCAGGTGGGCAGGGGAGAGATGG + Intronic
952039852 3:29248982-29249004 GCAGGTGAGAAATGGCCAGAAGG - Intergenic
952858691 3:37794323-37794345 ACAGGACAGCACAGGCCAGAGGG - Intronic
953077225 3:39581858-39581880 GGAGGAGAGGAGAGGTCAGAAGG + Intergenic
953797718 3:45997996-45998018 GCAGGTGAAAGGAGGGCAGAAGG + Intergenic
953982925 3:47421733-47421755 GGGGGTGAGCAGAGAACAGATGG - Intronic
954218855 3:49140059-49140081 GCAGGAGTGCAGAGGTGAGAGGG - Intergenic
954443936 3:50536538-50536560 GGAGGGGAGCAGAAGCCAAAAGG - Intergenic
954752716 3:52822825-52822847 GGAGGTGGGAAGAGTCCAGATGG - Intronic
954884009 3:53856123-53856145 GCAGGTGTGAGGAGGTCAGAGGG + Intronic
955203712 3:56876212-56876234 GGAGGTGGGCAGGGGCCAGACGG + Intronic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
955576226 3:60366657-60366679 GCAGGGGAGCGGACGGCAGAAGG - Intronic
955676344 3:61452870-61452892 GCACGTGCTCTGAGGCCAGAAGG - Intergenic
955856551 3:63278789-63278811 TCAGGTGAGGAGAGGTCGGATGG + Intronic
955871312 3:63441669-63441691 GCAGGTGAGGGGTGGCCACAGGG + Intronic
956190498 3:66603197-66603219 CCAGGTGAGCAAAGGACAAAGGG + Intergenic
956220001 3:66892872-66892894 GAGGGTGAGCAGAAGCCAGGTGG + Intergenic
956249089 3:67216902-67216924 GCAGGTGAGATGAGGTGAGAGGG - Intergenic
956674512 3:71721845-71721867 ACATGTGAGCAGAGGCTTGAAGG + Intronic
958776187 3:98485765-98485787 GAAGGTGAGCAGAGGCCATGTGG - Intergenic
960595262 3:119402394-119402416 GCAGGTAAGTAGAGGAGAGAGGG + Exonic
961448459 3:126991924-126991946 GCTGGGGAGCAGGGCCCAGAGGG - Intronic
961632195 3:128309274-128309296 GCAGGTGCAAAGAGGGCAGAGGG + Intronic
963774996 3:149429563-149429585 TGAGGTTAGCAGAGGTCAGAGGG + Intergenic
965357571 3:167695089-167695111 GCTGGTGAGCAGCAGCAAGAAGG - Intronic
966571793 3:181452133-181452155 TCTGGGGAGCAGAGGCCTGATGG + Intergenic
966627042 3:182028618-182028640 GCCGGTGAGTAGAGACAAGAGGG + Intergenic
967308395 3:188082252-188082274 GCAGATGTTCAGAGGTCAGATGG + Intergenic
968427995 4:535768-535790 GCTGTGGAGCAGAAGCCAGAGGG - Intronic
968447960 4:661958-661980 GAAGGCCAGCAGAGGCCAGTGGG + Intronic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
968647972 4:1749372-1749394 GCAGGTGAGGAGGGGGCAGATGG - Intergenic
968762971 4:2451808-2451830 CCAGGCTAGCAGAGGACAGAAGG + Intronic
968816307 4:2823570-2823592 GCAGGTGGGCGGTGGCCAGGTGG + Intronic
969132793 4:5004127-5004149 GCAGCTGAGCAGAGGAGAGATGG + Intergenic
969148001 4:5141289-5141311 ACATGTGAGCAGAGACCTGAAGG + Intronic
969215421 4:5718561-5718583 GCATGAGAGCAGAGACAAGAAGG + Intronic
969248998 4:5954964-5954986 GCAGGTCAGCAGAGGTCTGCAGG - Intronic
969254549 4:5993134-5993156 GCAGGTGGGCAGAGACCCCAGGG + Intergenic
969317786 4:6392496-6392518 GCATTTGAGCAGAGACCTGAAGG + Intronic
969352120 4:6603992-6604014 GGAGGTGAGCAGAGGCCAGGAGG + Intronic
969507857 4:7599240-7599262 GCAGGGGAGCAGAGGCTGAAGGG - Intronic
970012884 4:11479986-11480008 GCATGTGAGCAGAACCCTGAAGG + Intergenic
972604139 4:40598777-40598799 ACATATGAGCAGAGGACAGATGG - Intronic
972975705 4:44632959-44632981 GGAGGTGAGCAGTGGGCAGTGGG + Intronic
973707660 4:53596122-53596144 GCAGATGAGCAGATCTCAGAAGG + Intronic
974264785 4:59571338-59571360 GCAGCTGTGCAAAGGCCAGGAGG - Intergenic
976649983 4:87423862-87423884 GCATGTGAGCAGGTACCAGATGG + Intronic
977246134 4:94633874-94633896 GCCTTTGAGCAGAGACCAGAAGG + Intronic
977294105 4:95192491-95192513 GCAGGGGAGGAGAGGTGAGAAGG - Intronic
977354984 4:95934084-95934106 GCAGGAGGGCAGAGGGCAAAAGG + Intergenic
978331250 4:107614919-107614941 GCTGGGGAGTAGAGGGCAGAGGG - Intronic
980820979 4:138017153-138017175 ACAGGTTAACAGGGGCCAGAAGG - Intergenic
980824267 4:138054662-138054684 GTAGGTGTGCAAAGGCAAGATGG - Intergenic
981315041 4:143333805-143333827 GCAGGTCACCTGAGGCCAGGAGG - Intergenic
982274265 4:153623171-153623193 TCAGGAGTGCAGAGGACAGATGG + Intronic
982969891 4:161972041-161972063 GAAGTGGAGCAGTGGCCAGAAGG - Intronic
983854324 4:172623094-172623116 GCAGTAGAGGAGAGGCAAGAAGG + Intronic
984762688 4:183376638-183376660 GCGGGGGAGCAGAGGCGAGGAGG - Intergenic
984850059 4:184144962-184144984 TCAGGTCAGCGGAGGACAGAGGG + Intronic
985471301 5:48556-48578 GCTGGAGAGCAGAGTCCAGGAGG + Intergenic
985528203 5:418488-418510 GCTGCTGAACCGAGGCCAGATGG - Intronic
986075312 5:4330827-4330849 GGAGTAGAGCAGAGGGCAGAGGG + Intergenic
988602547 5:32653428-32653450 GTTGGTAAGCAGAGGGCAGAGGG + Intergenic
989116777 5:37962464-37962486 GTCAGTGAGCAGAGGCTAGATGG + Intergenic
993641288 5:90409468-90409490 GCAGGGCATCAGAGCCCAGAGGG + Intronic
995523794 5:113034791-113034813 GCAGGTAAGAAAAGGACAGAAGG - Intronic
996077707 5:119216407-119216429 GCAGGTGAGATTTGGCCAGATGG - Intronic
996088332 5:119326434-119326456 GCAGGTGAGCAGAGGCCCAGAGG + Intronic
996622515 5:125525161-125525183 GCAACAGAGCAGAGGCCATATGG - Intergenic
997749415 5:136330138-136330160 GCAGGTGGGCAGGGGACAGGTGG - Intronic
998463159 5:142324187-142324209 GCAGCGGAGCAAAGGTCAGACGG + Intronic
1000073404 5:157762502-157762524 GCAGGTGGGAAGAGGCTGGATGG - Intergenic
1000901522 5:166917049-166917071 ACATGTGAGCAGAGACCTGAAGG - Intergenic
1000977883 5:167784579-167784601 GCAGGTGAGCAGAGACTACTAGG - Intronic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1001570682 5:172728575-172728597 GGAGGTGAGGGGAGGCCACATGG + Intergenic
1002160233 5:177310598-177310620 GCAGGGGAGGGAAGGCCAGAGGG + Intronic
1002401492 5:178993838-178993860 GCAGGAGACCAGAGCTCAGAAGG + Intronic
1002835341 6:860895-860917 GCAGGTGAAGACAGGCCAGTGGG - Intergenic
1004320790 6:14630083-14630105 GCAGCGGAGCAGCGTCCAGACGG + Intergenic
1005337212 6:24809240-24809262 TCAGATGGGCAGAGGCCACAGGG + Intronic
1005338573 6:24821647-24821669 TCAAGTGAGTAGAGGCCAAAAGG - Intronic
1005840833 6:29743754-29743776 GCAGGTGAGGAGTGGGCAGCAGG - Intergenic
1005850176 6:29814973-29814995 GCAGGTGAGGAGTGGGCAGCAGG - Intergenic
1006060038 6:31412680-31412702 GCAGGTGAGGAGTGGGCAGCAGG + Intronic
1006175667 6:32119963-32119985 GCAAGTGAGCAGAGGTCAGAGGG + Intronic
1006338360 6:33432414-33432436 GCAGGGGGGCAGAGCCAAGAAGG - Intronic
1006801952 6:36765304-36765326 GCAGGAGGGCAGGGGCGAGAAGG - Intronic
1006925266 6:37650470-37650492 GGAGGTAAGCAGGAGCCAGAAGG - Intronic
1007673866 6:43579169-43579191 GCAGGTGAAAGGAGGGCAGAAGG - Intronic
1008062116 6:47009456-47009478 GCAGCTGTGCAGACTCCAGAAGG + Exonic
1008330587 6:50240295-50240317 GCAGGTGATGAGAAGCGAGAAGG - Intergenic
1008389151 6:50929365-50929387 ACATTTGAGCAGAGGCCAGAAGG + Intergenic
1009398161 6:63226848-63226870 GCAGGTGGGAAGCGGGCAGAAGG + Intergenic
1009883313 6:69596336-69596358 GAAGCTGAGCAGATGCCAGCAGG - Intergenic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1011241525 6:85276609-85276631 GCAGGTGATAAGAGGAAAGAAGG - Intergenic
1011518604 6:88179909-88179931 GCAGGTGATCAGAGGGCAGGAGG - Intergenic
1012448955 6:99334841-99334863 GCAGGTGGGCAGTGGCTAGATGG - Intronic
1013674547 6:112443373-112443395 GAAAGTGACCAGAGCCCAGAGGG + Intergenic
1013871435 6:114766536-114766558 TCAGGTGAGCAGAGGGATGATGG + Intergenic
1015430557 6:133125894-133125916 GTAGGGGAGCATAGGCCATATGG + Intergenic
1015635658 6:135271499-135271521 GCAGCTGAGCCCAGGGCAGAGGG + Intergenic
1016348983 6:143146972-143146994 GAAGATGAGGAGAGGGCAGATGG + Intronic
1016441524 6:144089356-144089378 GCAGGGAAGCAGGGGCCAAAGGG + Intergenic
1016825900 6:148388250-148388272 GCAGCACAGCAGAGGCCAGGAGG + Intronic
1019641880 7:2107632-2107654 GCATCTGAGCAGAGGCCTGAGGG - Intronic
1022183003 7:27940096-27940118 GCAGGTGAGAGGAGGGCAGCAGG - Intronic
1022261626 7:28711065-28711087 AGAGGTGGTCAGAGGCCAGATGG + Intronic
1023778820 7:43636575-43636597 GCTGGTGGCCAGAGGACAGAAGG + Intronic
1023982591 7:45078558-45078580 GAAGGTGAGGGGACGCCAGAGGG + Intergenic
1024085352 7:45888040-45888062 CCAGGTGAGGAAAGGCGAGATGG - Intergenic
1026892401 7:73989981-73990003 ACACATGAGCAGAGGCCACAGGG + Intergenic
1026915127 7:74115541-74115563 GCAGGTGGGGAGGGGGCAGAGGG + Intronic
1027173501 7:75889045-75889067 GCAGGTGACCAGGGCCCAGTGGG + Intergenic
1027357713 7:77375469-77375491 GAAGGAGAGCAGAGGGCAGGAGG + Intronic
1027746694 7:82083709-82083731 GCAGGGTTGCAGATGCCAGATGG - Intronic
1029513934 7:101014181-101014203 AGAGGTCAGCTGAGGCCAGATGG + Intronic
1029542339 7:101191243-101191265 GCAGGAGAGAGGAGGCCAGGAGG + Intergenic
1030711393 7:112754187-112754209 GCAGATGAGCATAGGGGAGAAGG - Intergenic
1031041506 7:116843140-116843162 CCAGTTGAGCTGAGGCCTGATGG - Intronic
1031517412 7:122718358-122718380 GCAGGTGAGTAGGGGAGAGAGGG + Intronic
1032267852 7:130381176-130381198 GCAGGTCAGAAGAGGGGAGAAGG + Exonic
1032441644 7:131946681-131946703 GGAGGAGAGCAGAAGTCAGAGGG + Intergenic
1032458486 7:132092325-132092347 GCAGGTGAGCAGATTCCTGGAGG - Intergenic
1034228651 7:149501842-149501864 GGAGTTCAGCAGAGGCCAGTCGG - Intergenic
1034348532 7:150401939-150401961 GGTGGTGAGCAGAGGGGAGAAGG - Intronic
1034589436 7:152127420-152127442 GCAGGGGAGCATGGTCCAGACGG - Intergenic
1034589452 7:152127484-152127506 GCAGGGGAGCATGGTCCAGATGG - Intergenic
1034762157 7:153682921-153682943 GCAGGGTAGCAGAGACCACAAGG - Intergenic
1034828062 7:154284985-154285007 AGAGGTTACCAGAGGCCAGAGGG + Intronic
1034880750 7:154760692-154760714 GCAGGTGAGCAGAAGACATCAGG + Intronic
1035122494 7:156579890-156579912 GCAGGTGACCAGAGGCAGGTGGG + Intergenic
1035185208 7:157121040-157121062 CCAGGTGAGCACAGCACAGATGG + Intergenic
1035589695 8:803025-803047 TAAGGTGAGAAGAGGCCACAAGG + Intergenic
1035750456 8:1992390-1992412 GCAGGGGAGGAAGGGCCAGACGG + Intronic
1036164243 8:6417308-6417330 GCTGTTGAGCAGAGACCATATGG - Intronic
1036446966 8:8829885-8829907 AGAGGTGCCCAGAGGCCAGATGG + Intronic
1036495726 8:9268444-9268466 GCATTTGAGCAGGGGCCTGAAGG + Intergenic
1036612567 8:10362857-10362879 GCAGGAGAGCTGGGGCCAGGAGG - Intronic
1036616945 8:10395514-10395536 TCAGTCTAGCAGAGGCCAGATGG + Intronic
1036810997 8:11867738-11867760 GGAGGGGAGCGGAGGGCAGAGGG + Intronic
1037337108 8:17801762-17801784 GCAGGTGGCCAGAGGCAAGCAGG - Intergenic
1037794285 8:21978841-21978863 GCAGGAGATTAGAGGGCAGAGGG - Intronic
1038030008 8:23629588-23629610 GCAAGAGAGCAGAAGCAAGAAGG + Intergenic
1038511196 8:28137412-28137434 GCAGGAGTGGAAAGGCCAGATGG + Intronic
1039081045 8:33734221-33734243 GTTGGAGATCAGAGGCCAGATGG + Intergenic
1039459133 8:37728784-37728806 GCATGGAAGCAGAGGCCAGTAGG - Intergenic
1040288922 8:46114408-46114430 ACAGGGGAGAAGAGGCGAGATGG - Intergenic
1043036749 8:75208635-75208657 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1043163598 8:76875446-76875468 GCAGGTGAGCTGAGGCTGGTGGG - Intergenic
1043558149 8:81458127-81458149 TCAAGTGGGCAGAGGACAGAGGG + Intergenic
1043597554 8:81902604-81902626 GGAGGAGAGGAGAGGTCAGATGG + Intergenic
1043882405 8:85559849-85559871 GCATGTGAGCAGAGAACTGAGGG - Intergenic
1044301865 8:90593769-90593791 GCAAATGAGCAGAGTCCTGAGGG + Intergenic
1044748204 8:95391672-95391694 GCAGGAGAGCTGAGACAAGAAGG + Intergenic
1044795510 8:95893109-95893131 GCAGGTGAGCAGGTGCCTCAAGG - Intergenic
1045064831 8:98435770-98435792 GCGGGTGTGCAGTGGGCAGAGGG + Intronic
1046013224 8:108575251-108575273 GGTGGTGAGCAGAGGCAAGAAGG + Intergenic
1046512739 8:115219865-115219887 CCAGGTGAACAAAGGCAAGAAGG + Intergenic
1047314517 8:123720195-123720217 GCCAGGGAGCAGAGGGCAGAGGG + Intronic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1048228532 8:132614227-132614249 ACATCTGAGCAGAGGCCTGAAGG + Intronic
1048308215 8:133297953-133297975 GCAGGAGAGAAGAGCCCAGTGGG - Intronic
1048325508 8:133436134-133436156 CAAGGTGGGCAGAGGACAGAAGG + Intergenic
1048743201 8:137585118-137585140 GGAGGTGGGCAGAAGCCACATGG + Intergenic
1049218033 8:141416729-141416751 GCTGGGGAGCAGAGGACAGGAGG - Intronic
1049329003 8:142039723-142039745 GGAGCTGAGAAGAGGCCAGTAGG - Intergenic
1049342039 8:142118380-142118402 GCAGGTGGCCACATGCCAGATGG + Intergenic
1049421683 8:142519415-142519437 GCTGGAGAGCAGAGGGCACAGGG - Intronic
1049435938 8:142586281-142586303 GGAGCAGAGCAGAGGCCAGAGGG + Intergenic
1049568371 8:143355481-143355503 GCAGGAGAGAAGAGAGCAGAGGG + Intronic
1049570813 8:143369518-143369540 GGAAGTGAGAAGAGGCCAGCCGG - Intronic
1049585819 8:143431909-143431931 GGAGTTGCGCAGAGGCCACAGGG + Intergenic
1049785184 8:144447276-144447298 GGAGGCCAGCAGAGCCCAGAAGG + Intergenic
1049895686 9:109250-109272 GCAGCTAAGCAGAGTCCGGAAGG - Intergenic
1050292009 9:4165094-4165116 GCAGGAGAACAGAGGCTGGAGGG + Intronic
1052054461 9:23887868-23887890 TAAGGTGGGGAGAGGCCAGATGG + Intergenic
1053220308 9:36307052-36307074 GCAGGTGAGCAGACTTCAGCAGG + Intergenic
1053272600 9:36760615-36760637 GCCGGCGAGCAGAGCCAAGAAGG - Intergenic
1053462584 9:38282021-38282043 GAGGCTGAGCAGAGGGCAGAGGG + Intergenic
1053931198 9:43115056-43115078 GCAGCTGAGCAGAGCCCACTGGG + Intergenic
1054914073 9:70479906-70479928 GGAGGTGAGCAGGGCACAGAGGG - Intergenic
1055339053 9:75262234-75262256 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1056655564 9:88505913-88505935 GCAGGTGGTGCGAGGCCAGAGGG - Intergenic
1056774002 9:89498247-89498269 GGAGGTGAGCAGGGGCGAGGAGG - Intergenic
1057275890 9:93675786-93675808 GCAGGTGAGGAGGGGCGAGAAGG + Exonic
1057460233 9:95254424-95254446 GAGGGTGAGCAGAAGCCAGGTGG + Intronic
1057495300 9:95555618-95555640 GCATGTGAGCAGAGGTCTGCAGG - Intergenic
1057521240 9:95762259-95762281 CCAGGTGAACTGAGGCCAGCTGG + Intergenic
1057882344 9:98802041-98802063 GCAGGAGATCAGAGGGCAGGAGG - Intergenic
1058539792 9:105999764-105999786 ACAGGTCAGCAGAGGGCTGAAGG + Intergenic
1059313134 9:113401938-113401960 GGAGATGTGCAGAGGCAAGAGGG + Intergenic
1059395605 9:114032353-114032375 GCAGGAGAGCAGATGGCAAATGG - Intronic
1059610777 9:115890751-115890773 GCAGGTTAGCATAGGGAAGAAGG - Intergenic
1060418532 9:123450358-123450380 GCGGGTGGGCAGGTGCCAGATGG + Intronic
1061147525 9:128808640-128808662 TCAGGGGAGCAGAGGCAAGCGGG - Exonic
1061202832 9:129147351-129147373 GCAGGTGAGCAGAGTGGTGAGGG - Intronic
1061242270 9:129381630-129381652 GCAGAGGAGCAGAGGCCAGGAGG - Intergenic
1061246563 9:129403803-129403825 TCAGGAAAGCAGAGGCCTGAGGG - Intergenic
1061532894 9:131228764-131228786 GCAGGGGAGCAGGGGACACAGGG - Intronic
1061723250 9:132566777-132566799 ACAGATCCGCAGAGGCCAGAGGG - Intronic
1061921543 9:133785212-133785234 GCAGGTGAGCTGGGGCCTGCAGG - Intronic
1062123613 9:134847846-134847868 ACAGCAGGGCAGAGGCCAGAGGG + Intergenic
1062170198 9:135130667-135130689 AGAGGAGAGCAGAGGCCAGCAGG - Intergenic
1062271889 9:135713651-135713673 GCAGGAGAGCAGAGGGGGGATGG - Intronic
1062303608 9:135889585-135889607 GCTGGTGAGGAGAGGCTGGAGGG + Intronic
1062715153 9:138006462-138006484 GGAGGTGGGCAGAGGCGAGGAGG - Intronic
1203458217 Un_GL000220v1:10555-10577 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
1186137774 X:6537314-6537336 GATGGTTACCAGAGGCCAGAAGG - Intergenic
1186298431 X:8173326-8173348 GATGGTTACCAGAGGCCAGAAGG - Intergenic
1186324345 X:8462579-8462601 GATGGTTACCAGAGGCCAGAAGG + Intergenic
1187473403 X:19589036-19589058 GAAGGTGGGCGGTGGCCAGAAGG - Intronic
1187721878 X:22159700-22159722 GTAGTTGTGCAGAGGCCATATGG + Intronic
1189319925 X:40081801-40081823 ACAGCTGAGAAGAGGTCAGATGG + Intronic
1189622518 X:42857251-42857273 TGAGGGGAGCAGAAGCCAGATGG - Intergenic
1189890391 X:45595533-45595555 GCAGGTGAGGAGAGGCCAGCAGG + Intergenic
1190262084 X:48803710-48803732 GGTGGTGAGGAGAGGTCAGATGG - Intronic
1190715046 X:53096053-53096075 ACAGCTGAGTAGAGGCCTGAAGG - Intergenic
1190911378 X:54775212-54775234 GGAGGTGTGCAGAGGCCACTGGG - Intronic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195199236 X:102532092-102532114 GCAGGTGTGCAGTGCCAAGAGGG + Intergenic
1195326962 X:103765865-103765887 GGAGGAGGGCAGAGGTCAGATGG + Intergenic
1195711125 X:107774832-107774854 GAAGGTGGGCAGACCCCAGATGG - Intronic
1196525577 X:116725040-116725062 GGAGGAGAGGAGAGGTCAGATGG + Intergenic
1196740340 X:119019577-119019599 GCATGTAAGCAGAAACCAGATGG + Intergenic
1198002427 X:132452564-132452586 GCAGGTGAGGACTGGCCAGAGGG + Intronic
1200134462 X:153868152-153868174 GGAGGGGAGAAGAGCCCAGATGG - Intronic
1201439115 Y:13989128-13989150 GATGGTTACCAGAGGCCAGAAGG - Intergenic
1201445458 Y:14053580-14053602 GATGGTTACCAGAGGCCAGAAGG + Intergenic