ID: 906211888

View in Genome Browser
Species Human (GRCh38)
Location 1:44016729-44016751
Sequence CACCTCCGGCCCGTCTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906211882_906211888 23 Left 906211882 1:44016683-44016705 CCGTGGCACAGACAATGAGGCTG 0: 1
1: 0
2: 0
3: 21
4: 237
Right 906211888 1:44016729-44016751 CACCTCCGGCCCGTCTCCCCGGG 0: 1
1: 0
2: 1
3: 17
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906211888 Original CRISPR CACCTCCGGCCCGTCTCCCC GGG Intronic
900650329 1:3727231-3727253 CACCTCCACCCCGTGTGCCCGGG - Intronic
901302465 1:8209633-8209655 CACCTCTGGCCAGGCTTCCCCGG - Intergenic
901416623 1:9120973-9120995 CAGAGCTGGCCCGTCTCCCCAGG - Intronic
902985636 1:20152556-20152578 CCCCTCCCGCCCCTCTGCCCTGG + Intergenic
903522255 1:23959689-23959711 CACCTCCGCGCCTTCGCCCCCGG + Intronic
904356713 1:29944970-29944992 CAGCTCCAGCCAGTCTCCACCGG - Intergenic
904645167 1:31960082-31960104 CACCTCCCGCCCTTCTTTCCAGG + Intergenic
905012977 1:34759581-34759603 CACCTGCGGCTCTTCTCTCCTGG - Intronic
905167127 1:36089179-36089201 CACCCCCGACCCGTCGCCCCCGG - Intronic
906211888 1:44016729-44016751 CACCTCCGGCCCGTCTCCCCGGG + Intronic
913518413 1:119623877-119623899 CACCTCGGTGCCGACTCCCCAGG + Exonic
915213333 1:154325575-154325597 CAGCTGCGGCCCCGCTCCCCCGG - Intronic
915366898 1:155321819-155321841 CACCTCCAGCACGTCTCCCTGGG + Exonic
915931245 1:160062186-160062208 CACCTCCTGCCCATCCCCCCTGG + Intronic
920373438 1:205493582-205493604 CAGCCCCTGCCCTTCTCCCCTGG - Intergenic
920673980 1:208026205-208026227 CACCTCCAGGCCGTTTCCCCAGG + Exonic
924064283 1:240207673-240207695 CCCCTCCGCCCCCTCTTCCCGGG + Exonic
1062902426 10:1156315-1156337 CCCCTCGGTCCCGTGTCCCCAGG + Intergenic
1067045700 10:42983990-42984012 CACCTCACGCCCATATCCCCTGG + Intergenic
1067179216 10:43972233-43972255 CACCCCCGTCCCCACTCCCCTGG - Intergenic
1073441546 10:103555463-103555485 CCCCTCCGCCCGGCCTCCCCAGG - Intronic
1074833719 10:117268674-117268696 CACCTCCTGCCAGTCACACCTGG + Intronic
1076356511 10:129857487-129857509 CACCTCCCAACCATCTCCCCAGG + Intronic
1076674844 10:132142488-132142510 CGGCCCCGGCCCCTCTCCCCCGG + Intronic
1076737101 10:132463801-132463823 CACGTCCTGCCCATCTCCTCAGG - Intergenic
1076908232 10:133373633-133373655 CGCCTCCGCGCGGTCTCCCCGGG - Exonic
1077058051 11:605523-605545 CTCCTCCGTGCCGTCTCCCTGGG + Intronic
1077210556 11:1369254-1369276 CACCTCCGTCCCGTTCTCCCTGG - Intergenic
1084416537 11:69035860-69035882 CACCCCCGACCCCTCTCCCAGGG + Intergenic
1085524643 11:77157229-77157251 CTCCTCTGGCCCTCCTCCCCTGG + Intronic
1088590011 11:111395227-111395249 GACCTCAGGCCGGTCTCTCCTGG - Intronic
1089273183 11:117315623-117315645 CCCCTCCGGCCGGGCTCCTCGGG + Exonic
1090403831 11:126465693-126465715 CTCCTCCAGCCCCTCTGCCCAGG - Intronic
1090415082 11:126535038-126535060 CACCTCCTGCCCACCTCCCTAGG - Intronic
1090805158 11:130198025-130198047 CACCTCCGGCCTTTCTGCCTCGG - Intronic
1091243260 11:134069276-134069298 CCCCTCCGGCCCGGGACCCCGGG - Intronic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1091624732 12:2113294-2113316 CACCTCCACCCCGTCCCCACAGG - Intronic
1094797624 12:33994369-33994391 CACCCCCGGCCCCTCCACCCAGG + Intergenic
1096495448 12:52037134-52037156 CAGCCCCGGCGCGCCTCCCCCGG - Intronic
1097193390 12:57231007-57231029 CAACCCCTGCCCATCTCCCCAGG - Intronic
1103188190 12:118979882-118979904 CACCTCTGGGCCCTCTCCCCCGG + Intergenic
1103585193 12:121948018-121948040 CTCCTGCAGCCCTTCTCCCCAGG + Intronic
1104568340 12:129904060-129904082 CACATCTGGCCCGCCTCCCCCGG - Intergenic
1104636534 12:130440976-130440998 CACCTCCCTACCATCTCCCCAGG + Intronic
1113200687 13:107865976-107865998 CACCTCCTGCCCGTCCCCCCCGG + Exonic
1113595636 13:111529978-111530000 CACCTCCAGCCCGTCTCAGAAGG - Intergenic
1116739247 14:48734166-48734188 CCCCTTCGGCCAGTCTGCCCTGG - Intergenic
1118036806 14:61877113-61877135 CATCTCCCACCCGCCTCCCCAGG - Intergenic
1118423370 14:65633003-65633025 CTCCCCCCCCCCGTCTCCCCAGG + Intronic
1119199786 14:72743776-72743798 CTCCCCCGGACCATCTCCCCAGG - Intronic
1123495201 15:20816963-20816985 CACCTCTGGCCCCTCCGCCCCGG - Intergenic
1123551693 15:21386056-21386078 CACCTCTGGCCCCTCCGCCCCGG - Intergenic
1124226976 15:27903114-27903136 CTCCTGCGCCCCCTCTCCCCTGG + Intronic
1128264622 15:66255100-66255122 CTCCTCCCGCCCGACTCCACTGG - Intergenic
1128388169 15:67165226-67165248 CACCTCTGCTCTGTCTCCCCCGG + Intronic
1128535326 15:68486007-68486029 CACCCTCGGCCCCTCTCCCAGGG - Intergenic
1128815052 15:70602233-70602255 CACCTCCAGCCACTGTCCCCAGG + Intergenic
1129460283 15:75697042-75697064 CCCATCAGGCCCGCCTCCCCCGG + Intronic
1129652131 15:77498517-77498539 CACCTCTGGCCCTGCTTCCCAGG + Intergenic
1130213989 15:81951513-81951535 CACCTCCAGCCTCTCTGCCCTGG + Intergenic
1131061419 15:89407011-89407033 CACCTTCAGCCCGACTCCTCAGG - Intergenic
1132011516 15:98280614-98280636 CACCTTCGGCCCGGCCTCCCAGG - Intergenic
1132143069 15:99410590-99410612 CAGCTCCCTCCCCTCTCCCCAGG + Intergenic
1202960035 15_KI270727v1_random:113298-113320 CACCTCTGGCCCCTCCGCCCCGG - Intergenic
1132542869 16:519450-519472 CACCTCCAGCCGGGCTCCTCTGG - Intronic
1132883556 16:2172681-2172703 CAGCTCCGGCCTACCTCCCCGGG - Intronic
1133039057 16:3050232-3050254 CACCTCACTCCCCTCTCCCCAGG + Exonic
1133249933 16:4474354-4474376 CTCCTCCTTCCCGCCTCCCCCGG + Exonic
1133346202 16:5072122-5072144 CACTTCCGCCTCGACTCCCCGGG - Intronic
1134143453 16:11742212-11742234 CACCCCCGACCCGCCTCCCTCGG + Intronic
1136537730 16:30910339-30910361 CTGCTCCTGCCCCTCTCCCCAGG - Intergenic
1136666767 16:31819482-31819504 CACGTCCGGCCCGCCGCCGCCGG - Intergenic
1138599972 16:58048292-58048314 AACCCCCGTCCCTTCTCCCCGGG + Intergenic
1142592022 17:1010422-1010444 CACCTCAGGGCAGTCTTCCCTGG + Intronic
1144794026 17:17878918-17878940 CACCTCAGGCCTGTTTCCCAGGG - Intronic
1144950712 17:18992098-18992120 CACCTCCGGCATGTCTGTCCAGG + Intronic
1145012626 17:19378468-19378490 CCCCTCCGCCCCGCCTCCCAAGG - Intronic
1147536429 17:41325507-41325529 CACCTCCGGCCAGGCTCCAGAGG + Intergenic
1148391401 17:47275651-47275673 CAGCTCCCGCCCCTCCCCCCAGG - Intronic
1148679778 17:49466887-49466909 CACCTCCGACCCCTCTATCCAGG - Intronic
1148733433 17:49851380-49851402 CGCCCCCGGCCCGGCTCCCGCGG - Intergenic
1149657593 17:58318425-58318447 GACCTCCCGCCGGGCTCCCCTGG - Exonic
1151619946 17:75239488-75239510 CCCCTCCTGCCCTTCTCCACGGG - Exonic
1152097296 17:78279392-78279414 CACCTGGTGCCAGTCTCCCCAGG - Intergenic
1152108101 17:78342300-78342322 CACCTCCCGCCCGCCGCCGCGGG - Intergenic
1152109865 17:78352062-78352084 CACCTACGGCCAGTCCCCCGAGG - Intergenic
1152703653 17:81832323-81832345 CACCTCCTCACCCTCTCCCCTGG + Intronic
1152729040 17:81960976-81960998 CACCCCCGGCCCGGCACCCCCGG - Exonic
1152794211 17:82298891-82298913 GACCTCCGGCTTGTCACCCCAGG - Intergenic
1157496739 18:48161923-48161945 CCCCACCCGCCCGCCTCCCCGGG + Intronic
1159546012 18:69839805-69839827 CACCTCCTGCCCCACGCCCCTGG - Intronic
1160566159 18:79787971-79787993 CGCCTGCGTCCCGCCTCCCCCGG - Intergenic
1160980996 19:1816569-1816591 CCCCTCCTGCCCGTTCCCCCAGG - Exonic
1161319461 19:3634264-3634286 CACCTCCGTCCCGCCTCCTGAGG + Intronic
1161439130 19:4280377-4280399 CCCCTCCACCCAGTCTCCCCAGG - Intronic
1161592626 19:5135654-5135676 CCACACCGGCCCCTCTCCCCAGG + Intronic
1161769397 19:6223189-6223211 CCCCGTCGGCCCCTCTCCCCAGG + Intronic
1162421533 19:10568582-10568604 CACCTCCTGCACGTCGCCCCGGG + Exonic
1162808900 19:13152782-13152804 CACCCCCGGCCCCCCTCCCTTGG + Exonic
1163441540 19:17324628-17324650 CCCCTTCAGCCCCTCTCCCCAGG + Intronic
1166072911 19:40397293-40397315 CACCTCAGGTGCCTCTCCCCGGG + Exonic
1166122306 19:40693037-40693059 TAACTCCCACCCGTCTCCCCAGG - Exonic
1167268921 19:48497553-48497575 CACCTCCGGCCTGGCTCTCGGGG + Exonic
925236710 2:2285134-2285156 CACCTCCAGCTCATCTCCCCGGG - Intronic
925343615 2:3154036-3154058 CACCTCCAGCCCTGCTCCTCAGG + Intergenic
926246213 2:11123831-11123853 CACCCCCGCCCTCTCTCCCCAGG + Intergenic
927156476 2:20224249-20224271 CAGCCCTGGCCCGGCTCCCCGGG + Intronic
928885385 2:36142463-36142485 CACCTCCTGCCCATGTACCCCGG - Intergenic
930358089 2:50346245-50346267 CACCTCCTGCCCATCTTCCCTGG - Intronic
930804224 2:55473972-55473994 ACCCTCCGGCCACTCTCCCCCGG - Intergenic
931515819 2:63050361-63050383 CTCCTCCAGCCCGCCGCCCCCGG + Intronic
932374790 2:71226514-71226536 CATCCCCCGCCCCTCTCCCCGGG - Intronic
932812024 2:74833937-74833959 CGCCCCCGGCGCGCCTCCCCAGG + Intergenic
933666797 2:84971080-84971102 CACCCCCCGCCCCTCTCCCCCGG - Exonic
934570975 2:95373143-95373165 CACCGTCGCCCTGTCTCCCCTGG - Intronic
934792503 2:97073610-97073632 CACCTCAGACCCATATCCCCAGG + Intergenic
938639535 2:133265599-133265621 CACCTCCCGCCCAGCTCACCAGG - Intronic
948420914 2:237859580-237859602 CGCCCCCGGCGCGTCTCCTCCGG + Exonic
948560561 2:238848711-238848733 CACCTCCGGACCGGCGCGCCAGG + Exonic
1168830123 20:841266-841288 CTCCTCCGGCCCGGCCCACCTGG - Intronic
1170588113 20:17750653-17750675 CACTTCCGGCCAGTCTCCTTAGG + Intergenic
1172221992 20:33280455-33280477 CACCTCCTGCCCTCCTCCCTGGG + Intronic
1172364725 20:34340206-34340228 CTCCTCTGGCCTGACTCCCCAGG + Intergenic
1172976464 20:38909724-38909746 CACCTACTGCCTGTCTCACCAGG + Intronic
1173526809 20:43739007-43739029 CCCTCCCGGCCCCTCTCCCCTGG + Intergenic
1173584889 20:44175084-44175106 CACCTTTGTCCGGTCTCCCCAGG + Intronic
1175218813 20:57405417-57405439 CGCCTCCTGTCCCTCTCCCCAGG - Intronic
1175256986 20:57653436-57653458 CACCCCTGGCCCCACTCCCCTGG + Intronic
1175264619 20:57695211-57695233 CACCGCCTGCCCGCCTCACCTGG - Intronic
1175611402 20:60354259-60354281 TCCCTCCTGCCAGTCTCCCCAGG - Intergenic
1175908522 20:62393504-62393526 CACCTCGGCCCAGTGTCCCCCGG - Exonic
1175918125 20:62437021-62437043 CTCCTGCTGCCCCTCTCCCCTGG + Intergenic
1176035231 20:63033020-63033042 CACATCCCCCCCGTCTCCCTGGG + Intergenic
1176095397 20:63341410-63341432 CACCTCGGGCACGTGTCCTCAGG + Intergenic
1176248759 20:64110045-64110067 CACCTCCAGCCGGCCTCCCCGGG - Intergenic
1180236030 21:46459540-46459562 GACCTCCTGCCCCTCACCCCCGG + Intronic
1181490942 22:23260495-23260517 CACCTGGGGCCCGCCTCACCTGG - Intronic
1183942013 22:41301419-41301441 CGCCCCCCGCCCTTCTCCCCAGG + Intergenic
1184060735 22:42079599-42079621 CACCTCCCTCCCGCCGCCCCAGG + Intergenic
1184639853 22:45864773-45864795 GACCCCCGGCCCTGCTCCCCAGG + Intergenic
1185228476 22:49667428-49667450 CCCCTCCACCCCGGCTCCCCAGG + Intergenic
953925292 3:46979606-46979628 CACCGCCGCCCCGCCTCTCCTGG - Intronic
954372306 3:50175256-50175278 CACCTGAGGCCAGCCTCCCCAGG + Intronic
956737019 3:72245816-72245838 CACCTCCTGCCCCTCTCACTAGG - Intergenic
961373754 3:126448958-126448980 CTGCCCCGTCCCGTCTCCCCAGG - Intronic
961483216 3:127197129-127197151 CACCTCCAGCCACTGTCCCCAGG + Exonic
961508099 3:127384876-127384898 CACCTCCTGCTCCACTCCCCTGG - Intergenic
963081900 3:141402412-141402434 CGCCGCCGGCGCGTTTCCCCGGG - Intronic
966806379 3:183810914-183810936 CTCCTTGGGCCCGCCTCCCCAGG + Exonic
967035174 3:185643641-185643663 CACCTACCGCCTGTCTGCCCAGG + Intergenic
967166324 3:186783230-186783252 CGGCTCCGGCGCGGCTCCCCCGG + Intronic
968741161 4:2332418-2332440 CACCTCTGGGCCGGCTGCCCTGG + Intronic
968819418 4:2838261-2838283 CACTTCCGGCCTCTCTGCCCTGG + Exonic
969756417 4:9153167-9153189 CACCTCCTGACCGTATCCCCAGG + Intergenic
970379148 4:15489249-15489271 CACCCCAGGCCAGTCTCTCCAGG - Intronic
975622093 4:76306323-76306345 CACCTCGGCGCCTTCTCCCCAGG - Intronic
975683265 4:76896986-76897008 CAGCTCCGGCCGGTCTCCGCGGG + Exonic
975689339 4:76949367-76949389 TCCCTGCGACCCGTCTCCCCCGG + Intergenic
981136978 4:141221172-141221194 CACCTCCGCCGCTTCTCCCCTGG + Intronic
983620646 4:169757827-169757849 TACCTGCGGCCCCTCTCCGCCGG + Exonic
985570785 5:643683-643705 CACCTGCGGCCAGGGTCCCCAGG - Intronic
985639639 5:1057710-1057732 CACCTCCGGCCTGGCATCCCGGG - Intronic
985879566 5:2628165-2628187 CACCTCCTGCTCCTCTCCTCAGG - Intergenic
990295195 5:54394745-54394767 CACCTCTGGCTCTACTCCCCTGG + Intergenic
997395234 5:133554255-133554277 CACCTCCCCCCCATCTCCCCAGG - Intronic
999230372 5:150058220-150058242 CACCTCAGGCCCATCCACCCAGG - Intronic
999973703 5:156890144-156890166 CACCTGTGGCCTCTCTCCCCAGG + Intergenic
1001981400 5:176040345-176040367 CAGCTGCTGCCCTTCTCCCCTGG + Intergenic
1002236065 5:177803721-177803743 CAGCTGCTGCCCTTCTCCCCTGG - Intergenic
1002691297 5:181052687-181052709 CACGTCCCTCCCGGCTCCCCAGG - Intronic
1002896822 6:1384312-1384334 CTCCTCCCGCCCGCCTTCCCAGG - Intergenic
1003175838 6:3751797-3751819 CGCCTCCCGCCCGCCTCCCGCGG + Exonic
1004274164 6:14221093-14221115 CTCCCCCTGCCCTTCTCCCCTGG - Intergenic
1006581672 6:35081078-35081100 CGCCTCCTGCCTGTGTCCCCTGG - Exonic
1006887575 6:37395406-37395428 CAATTCCTGCCCGTCTTCCCTGG + Intergenic
1007818453 6:44541847-44541869 CACTTACTGCCCCTCTCCCCTGG - Intergenic
1009495375 6:64339891-64339913 CACCTCCTTCCCTTCTCGCCAGG - Intronic
1012410222 6:98947976-98947998 CGGCTCCGCCCCGCCTCCCCGGG - Intronic
1012625485 6:101399686-101399708 CCACTCCCGCCTGTCTCCCCCGG + Intronic
1019171457 6:170135595-170135617 CCCCTCCGACCTGTCTGCCCAGG - Intergenic
1019459842 7:1151806-1151828 CACCTCCGGGCCATCTTCACGGG - Intergenic
1019460159 7:1153990-1154012 CACCTCCGGGCCATCTTCACGGG - Intronic
1019541019 7:1551039-1551061 CACCTCCTTCCCGGCTCACCTGG - Intronic
1019541047 7:1551121-1551143 CACCTCCTTCCCGGCTCACCTGG - Intronic
1019541087 7:1551241-1551263 CACCTCCTTCCCGGCTCACCTGG - Intronic
1019541114 7:1551323-1551345 CACCTCCTTCCCGGCTCACCTGG - Intronic
1019541142 7:1551405-1551427 CACCTCCTTCCCGGCTCACCTGG - Intronic
1020292088 7:6730002-6730024 CACCTCCCGCCCGGTTCCCCTGG - Intergenic
1022404823 7:30078891-30078913 CACCTCCTGTCCATCCCCCCAGG - Exonic
1026850307 7:73719520-73719542 CACTTCCCGCCCGGCTCCCGCGG - Intronic
1027275245 7:76549553-76549575 CACCTCCCGCCCGGCCCCTCTGG - Intergenic
1029720954 7:102364103-102364125 CACCTCCCGCCCGGCCCCTCTGG - Exonic
1032087154 7:128890513-128890535 CAGCCCCTGCCCTTCTCCCCAGG - Exonic
1033099933 7:138460941-138460963 CCCCTCCTGGCCCTCTCCCCGGG - Intronic
1034284906 7:149878334-149878356 CACCTCTGTCCAGGCTCCCCCGG - Intronic
1034596804 7:152204022-152204044 CACCTCTGGCCTGTCTGCCTTGG - Intronic
1035431983 7:158829386-158829408 CGCCTCCGGGCCCTCGCCCCGGG + Exonic
1035853182 8:2942298-2942320 CACATCCGGCACGTGTACCCCGG + Intronic
1036849913 8:12194178-12194200 CACCTCCTGACCCTATCCCCAGG - Intergenic
1036871277 8:12436451-12436473 CACCTCCTGACCCTATCCCCAGG - Intergenic
1038828464 8:31032891-31032913 CACGCCGGGCCCGGCTCCCCCGG + Exonic
1039554781 8:38468054-38468076 CGGCTCCGGCCCGCCGCCCCCGG + Intronic
1043045304 8:75315420-75315442 CACCTCTGTTCCCTCTCCCCAGG - Intergenic
1044821962 8:96160925-96160947 CACCTCCGGCCCGCACCACCCGG - Intergenic
1048351878 8:133623250-133623272 CACCTCTGTCTCATCTCCCCAGG + Intergenic
1049366905 8:142243593-142243615 CACCTCCTCCCCTGCTCCCCCGG - Intronic
1049472762 8:142783662-142783684 CACCCAAGGCCCATCTCCCCAGG - Intergenic
1049565970 8:143339322-143339344 CACCCCCAGCACGTCTCCACTGG + Intronic
1049583426 8:143422692-143422714 CAGGTCCGGCCCGCCCCCCCAGG - Intronic
1049597040 8:143489496-143489518 CTCCCCTGGCCCCTCTCCCCTGG - Intronic
1053050507 9:34957889-34957911 CCCCTCCGGGCCGCCTCCTCCGG + Intronic
1057996305 9:99823888-99823910 AACCTCCGCCCCCGCTCCCCAGG + Intronic
1060200643 9:121650275-121650297 CCCCTCCTGCCCCTCCCCCCTGG + Intronic
1060975724 9:127763979-127764001 CACCTCCGCCCACTCTTCCCGGG + Intronic
1061914634 9:133743085-133743107 CACCTCCAGGCTGTCTGCCCTGG + Intergenic
1062338302 9:136082191-136082213 CCCCCTCTGCCCGTCTCCCCAGG + Intronic
1062463188 9:136670355-136670377 CACTGCCTGCCCGCCTCCCCAGG - Intronic
1062631103 9:137463531-137463553 CAGCTCCGGGCCCCCTCCCCAGG - Exonic
1186884946 X:13903760-13903782 CACCCCCGGCCCGTCTCATGGGG - Intronic
1189340477 X:40201127-40201149 CTCCTCCTTCCCTTCTCCCCTGG + Intergenic
1190385204 X:49878339-49878361 CACCTGCTGCCCCCCTCCCCCGG + Intergenic
1192177056 X:68892764-68892786 CACCGCCTGCCCGCCTGCCCGGG - Intergenic
1192536232 X:71930194-71930216 CACCTCCCACCCGTTTCACCGGG + Intergenic
1200235935 X:154467745-154467767 CACCTCAGGCCTGTCCCCACAGG + Exonic