ID: 906214032

View in Genome Browser
Species Human (GRCh38)
Location 1:44028940-44028962
Sequence GTGATGAATCGGACTGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906214032 Original CRISPR GTGATGAATCGGACTGGGTA GGG Intronic
905456954 1:38094887-38094909 GGGATGAATCGGCTTGTGTATGG + Intergenic
906214032 1:44028940-44028962 GTGATGAATCGGACTGGGTAGGG + Intronic
906342132 1:44989545-44989567 GAGATGAATCAGGCTGGGCACGG - Intergenic
908782156 1:67700526-67700548 ATGATGGATGGGATTGGGTAGGG - Intergenic
911671515 1:100613694-100613716 GAGATGACTCTTACTGGGTAAGG + Intergenic
911827731 1:102508675-102508697 GAGATGAATCAGATTGGGTCAGG + Intergenic
912582368 1:110732248-110732270 GTGATGATTAGGAATGGGGATGG + Intergenic
914394438 1:147251307-147251329 GTGAAGAAGCAGACTGGCTAGGG - Intronic
1067202865 10:44189250-44189272 AAGATGAATCTGACTGGGCATGG + Intergenic
1073128569 10:101169374-101169396 GTGTTGAATTTGACTGGGTGTGG - Intergenic
1073156277 10:101349530-101349552 TTGATGGATCTGACTGGGTGTGG - Intergenic
1085081138 11:73635123-73635145 ATGATGAGTCTGAGTGGGTAGGG + Intergenic
1089782412 11:120882924-120882946 GTGAGAAATGGGAGTGGGTACGG - Intronic
1092042554 12:5397395-5397417 GTGATGGATTGGGCTGGGTGCGG - Intergenic
1093621672 12:21297757-21297779 GTGATGTAGCTGACTGGGTAGGG + Intronic
1094293050 12:28873547-28873569 GGGATGAAAGGGACTGAGTAGGG + Intergenic
1098365914 12:69703143-69703165 GTGATGAATTGGAGTGGGTAGGG + Intergenic
1098581448 12:72103916-72103938 ATGATTAATTGGAGTGGGTATGG - Intronic
1102460612 12:113097443-113097465 GTGATGACACGGAATGGGTGAGG - Exonic
1107651585 13:42550476-42550498 GCGATGAATTTTACTGGGTATGG - Intergenic
1112060430 13:95734228-95734250 GTGATGAACCTGTCTGGGAAAGG + Intronic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1114777259 14:25498144-25498166 CAGATGAAGGGGACTGGGTAGGG - Intergenic
1122424145 14:101596009-101596031 GTGGTGACTCTGAGTGGGTAAGG + Intergenic
1124030989 15:26011754-26011776 ATGATAAATGGGACTGGGCATGG - Intergenic
1133351218 16:5101921-5101943 ATGATGAATCGTACTGGATTGGG + Intergenic
1138508944 16:57496811-57496833 GTCATGAGTGGGGCTGGGTATGG + Intergenic
1141637930 16:85324815-85324837 GGGATAAATCTGAATGGGTATGG + Intergenic
1143098755 17:4493158-4493180 GAGATGAATCAGAAAGGGTACGG + Intergenic
1146104551 17:30021158-30021180 GTGAGGAATATGACTGGGGAAGG + Intronic
1146695489 17:34906246-34906268 TTGGTAAATCGAACTGGGTAAGG + Intergenic
1146965768 17:37028493-37028515 GTGAAGAATTAGACTGGGCATGG + Intronic
1148701832 17:49592149-49592171 TTGATGAATTGGACAGAGTAAGG - Intergenic
1149781254 17:59398186-59398208 GTGAGGGAGGGGACTGGGTAGGG + Exonic
1151354667 17:73551270-73551292 TTGATGAATCGGGCTGGGGTGGG - Intronic
1158243859 18:55408400-55408422 GAGATGGATGGGACTGGGGATGG - Intronic
1165466105 19:35975860-35975882 GTGATGACTGGTACTGGGCAGGG - Intergenic
1166661318 19:44649127-44649149 GTGATGACTCGGAGAGGGCAGGG - Intronic
1166833427 19:45652120-45652142 GTAATAAATAGGACTGGGTATGG + Intergenic
932330386 2:70895342-70895364 GTGCTGAATCTGACTGGTTCAGG - Intergenic
942194731 2:173506068-173506090 ATTTTGAATTGGACTGGGTATGG - Intergenic
942852221 2:180501543-180501565 GTGATGAAATAGACTGGGAAAGG + Intergenic
1168784767 20:528750-528772 GTGATAAATCTGGCTGGGCATGG - Intronic
1169661361 20:7981941-7981963 GTGCTGATTAGGACTGGGAATGG + Exonic
1170362463 20:15561428-15561450 GGGCTGAATCTGGCTGGGTAGGG + Intronic
1170978192 20:21186337-21186359 GTGATGGACTGGACTGGGCATGG + Intronic
1172006470 20:31821847-31821869 TAGATGAATGGGCCTGGGTAAGG - Intronic
1173054597 20:39598850-39598872 GTAATGAATTGGATGGGGTAAGG - Intergenic
1173362366 20:42356104-42356126 GTGAGGGATCGGGCTGGGGAGGG + Intronic
1176081102 20:63273294-63273316 GTGTTGAAGCGGACGGGGCAGGG - Intronic
1180865478 22:19116470-19116492 GTGATGCATGGGCTTGGGTATGG - Intronic
1184493895 22:44826170-44826192 GTGATGTATAGGCCTGGGTCCGG + Intronic
1184749470 22:46476788-46476810 GTGATTAAGCTTACTGGGTATGG + Intronic
963135412 3:141899083-141899105 GAGAGGAATGGGAATGGGTATGG + Intronic
984879327 4:184396722-184396744 GTGAGGAATCTGGCTGGGTGTGG - Intronic
987537032 5:19202989-19203011 GTGATGATAAAGACTGGGTAAGG - Intergenic
989222039 5:38977438-38977460 GTTATGAATCGGAATTTGTAAGG - Intronic
992245967 5:74822874-74822896 GTGATGAATCTGAATGGCTTTGG - Intronic
1001837300 5:174843138-174843160 GTGATGGCTTGGACTGGGTGGGG + Intergenic
1004294754 6:14400458-14400480 GTGATGGCAGGGACTGGGTAGGG - Intergenic
1007101546 6:39250998-39251020 GTTATGAAGAGGACTGTGTAGGG - Intergenic
1007510288 6:42369536-42369558 GTGTAGAACCGGACTGGGTGGGG - Intronic
1011447970 6:87463047-87463069 GGTTTGAATCGGATTGGGTAAGG + Intronic
1016252365 6:142059529-142059551 GTGTTGAATGGTACTGGGTTGGG - Intronic
1016743614 6:147554392-147554414 TTGATGAATCGGAAGGGGCAAGG - Intronic
1016920058 6:149283790-149283812 GAGTTGAATAGGGCTGGGTAGGG + Intronic
1026639129 7:72109127-72109149 ATGATGAGTCTGAATGGGTAAGG + Intronic
1029471855 7:100759711-100759733 CTGAAGAATGGGTCTGGGTAGGG - Exonic
1032529583 7:132609109-132609131 GTGATGAATCCCACTGGGAATGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033785880 7:144729174-144729196 TTGATGAATAGGATTGGGAAGGG - Intronic
1044062506 8:87655689-87655711 CTGATGAATGGGAATGGGAAGGG - Intergenic
1045460072 8:102417789-102417811 GAGATGCATAGGACTAGGTATGG - Intergenic
1045710234 8:104974752-104974774 GTGTTTACTCGGACTGGGGATGG + Intronic
1045828026 8:106424226-106424248 GTAAAGAATCAGACTGGGTGTGG - Intronic
1050139484 9:2502576-2502598 GTGATGCATCGGGCAAGGTATGG + Intergenic
1051762863 9:20487538-20487560 GTGATGAATAGTACTGATTAGGG - Intronic
1057184909 9:93052002-93052024 GTGATGAGCCGGCCTGGGAATGG + Intergenic
1058426911 9:104883301-104883323 GTGATGAATGGAGCTGGGTGTGG - Intronic
1185808443 X:3081625-3081647 GTGAAGAATCAGACTAGGTGTGG - Intronic
1189432585 X:40960827-40960849 CTGATGAATGGGGCTGGGCACGG + Intergenic
1191249397 X:58253293-58253315 GTGAGGAATGGGCCTGGGTGAGG - Intergenic