ID: 906215087

View in Genome Browser
Species Human (GRCh38)
Location 1:44033927-44033949
Sequence GACTGAGGACAGACTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 1, 2: 2, 3: 40, 4: 378}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906215076_906215087 10 Left 906215076 1:44033894-44033916 CCTGGGCCACTGTGGGGCGGGCA 0: 1
1: 0
2: 0
3: 25
4: 318
Right 906215087 1:44033927-44033949 GACTGAGGACAGACTGGGGCAGG 0: 1
1: 1
2: 2
3: 40
4: 378
906215081_906215087 4 Left 906215081 1:44033900-44033922 CCACTGTGGGGCGGGCAGGGGGA 0: 1
1: 0
2: 4
3: 44
4: 405
Right 906215087 1:44033927-44033949 GACTGAGGACAGACTGGGGCAGG 0: 1
1: 1
2: 2
3: 40
4: 378
906215073_906215087 14 Left 906215073 1:44033890-44033912 CCAGCCTGGGCCACTGTGGGGCG 0: 1
1: 1
2: 1
3: 44
4: 484
Right 906215087 1:44033927-44033949 GACTGAGGACAGACTGGGGCAGG 0: 1
1: 1
2: 2
3: 40
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906215087 Original CRISPR GACTGAGGACAGACTGGGGC AGG Intergenic
900048736 1:529325-529347 GACAGAGGAGAGGCAGGGGCAGG + Intergenic
900070967 1:771149-771171 GACAGAGGAGAGGCAGGGGCAGG + Intergenic
900360529 1:2286699-2286721 GAGTGAGGACAGACTGCGTGTGG + Intronic
900373721 1:2343953-2343975 GACTGAGGCGGGACTGGGCCTGG + Intronic
900818743 1:4870257-4870279 AAATGAGGACATACTGGAGCAGG + Intergenic
901480490 1:9521584-9521606 GGCTGAGGAAGGACTGGTGCAGG - Intergenic
901492399 1:9603168-9603190 GTCGGAGGACAGAGTGGCGCTGG - Intronic
902236852 1:15063257-15063279 CTCAGAGGACAGACTGGGACAGG + Intronic
902478178 1:16698963-16698985 GGCTCAGGATAGACAGGGGCAGG + Intergenic
902536397 1:17121342-17121364 GACTGGGGCCAGAGTGGGGGAGG + Intergenic
902638244 1:17749332-17749354 ACCTGAGGCCAGACTGGGGATGG + Intergenic
902645214 1:17793049-17793071 CACTCAGGACAGGCTTGGGCAGG - Intronic
902767278 1:18625780-18625802 CACTGGGACCAGACTGGGGCGGG + Intergenic
903416671 1:23188187-23188209 GACTGTGGAAAAACTGGGACAGG + Intergenic
904277406 1:29393460-29393482 GACTGTGGACAGGGTAGGGCTGG + Intergenic
904281809 1:29425839-29425861 GTCTGGGGACAGACTGGCCCTGG + Intergenic
904677814 1:32209079-32209101 GACTGAGGATACACTATGGCAGG + Exonic
905371478 1:37484822-37484844 GAGGAAGGACAGACTGGGGCAGG + Intergenic
906215087 1:44033927-44033949 GACTGAGGACAGACTGGGGCAGG + Intergenic
906237650 1:44221533-44221555 GGCCGAGGACAGGATGGGGCAGG - Exonic
906479485 1:46190709-46190731 GAATGTGGACAGGTTGGGGCTGG - Exonic
906531341 1:46525680-46525702 GACTGAGGAAAGCCAGGGGCTGG + Intergenic
907525437 1:55051250-55051272 GACTCAGGAGACCCTGGGGCAGG + Intronic
907654368 1:56327380-56327402 AAATGAGGACAGGCTGGGGAAGG + Intergenic
907668462 1:56453270-56453292 GAGTGAGGTCAACCTGGGGCTGG + Intergenic
909464123 1:75953706-75953728 GGCTGAGGACGGAGTGTGGCAGG - Intergenic
913014151 1:114716136-114716158 GACTGAGTACAAACTGGTGGTGG - Exonic
914913166 1:151802566-151802588 CACAGAGCACAGCCTGGGGCTGG + Exonic
915236739 1:154489009-154489031 GACTGAAGTCACACTGGGGCGGG + Intronic
915245496 1:154553342-154553364 GACTGTGGAGGGAATGGGGCTGG - Intronic
915248643 1:154572952-154572974 GACTGACCACAGGGTGGGGCCGG - Intronic
915472519 1:156134566-156134588 GGGTGATGACAGACTTGGGCTGG + Intronic
915615456 1:157034307-157034329 GAATGGGGCCAGCCTGGGGCAGG + Intronic
915740719 1:158116477-158116499 GAAGGAGGACAGAGTGGGGAGGG + Intergenic
915751265 1:158213042-158213064 AGCTGAGGACAGACTGGTGCTGG + Intergenic
916002528 1:160630710-160630732 TATAGAGAACAGACTGGGGCAGG - Intronic
916248376 1:162710802-162710824 GACTGAGGTCAAGTTGGGGCAGG - Intronic
919639211 1:200033092-200033114 GACTGAGGTCTGAGTGGGGTGGG + Intronic
920669709 1:207993891-207993913 CACTGAGGTGAGCCTGGGGCTGG + Intergenic
920818268 1:209355803-209355825 AAATGAGGACAAACTGGAGCAGG + Intergenic
920962474 1:210675800-210675822 GACAGAGGCCAGAGAGGGGCAGG + Exonic
922106331 1:222516599-222516621 GACAGAGGACAGGCAGGGGCAGG + Intergenic
922158809 1:223062589-223062611 GTCTCAGGACAGCCTGGGCCAGG - Intergenic
922385875 1:225081836-225081858 GCCAGAGGACAGACTAGTGCTGG + Intronic
924348511 1:243094164-243094186 GACAGAGGAGAGGCAGGGGCAGG + Intergenic
924384372 1:243488176-243488198 GACTGAGGGCAGCCAGAGGCCGG + Intronic
1062874276 10:932136-932158 GTCTGGGGACAGGCTAGGGCCGG - Intergenic
1063120585 10:3103012-3103034 CACTCAGGACAGACCTGGGCTGG - Intronic
1066064464 10:31752110-31752132 GTCTAAGGAAAGAGTGGGGCTGG - Intergenic
1066727848 10:38410737-38410759 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1067081996 10:43217263-43217285 GACTGGGGGCTGCCTGGGGCAGG - Intronic
1068560525 10:58510606-58510628 GAATTAGGACTCACTGGGGCAGG - Intergenic
1068753767 10:60626874-60626896 GACTGAGGACCAGCTGGGGAGGG + Intronic
1069818865 10:71215358-71215380 GACTCATAACAGACTGAGGCAGG + Intronic
1070496309 10:77027215-77027237 GACTGATGAGGGACTGGGTCTGG - Intronic
1070827139 10:79397853-79397875 GACTGGGGCCAGACTGGAGGTGG + Intronic
1070869265 10:79735206-79735228 GACTGAGTCCAGACTAGAGCAGG - Intergenic
1071636183 10:87257393-87257415 GACTGAGTCCAGACTAGAGCAGG - Intergenic
1071659057 10:87480550-87480572 GACTGAGTCCAGACTAGAGCAGG + Intergenic
1072571909 10:96665759-96665781 TACTGAGGAAAGAAGGGGGCAGG + Intronic
1073446013 10:103580711-103580733 GAGAGAAGACAGACTTGGGCTGG + Intronic
1073476640 10:103757907-103757929 GACTCAGCACAGAGTGGGGAGGG + Intronic
1074026683 10:109642961-109642983 GAAGGAGGACAGAGTGGGGTGGG - Intergenic
1074958102 10:118412275-118412297 GAATTAGGAAAGAATGGGGCTGG + Intergenic
1075418085 10:122280355-122280377 GTCTCAGGCCAGACTGGGGAGGG + Intronic
1075532762 10:123243981-123244003 GACTGAGACCACACTGTGGCTGG - Intergenic
1077481236 11:2815650-2815672 GACTGGGGTCAGCCTGGGGCTGG - Intronic
1077722747 11:4644331-4644353 GACAGAGGACAGGCTGGGCTGGG + Intronic
1078452182 11:11448751-11448773 GTCTGAGGTCAGGCAGGGGCCGG + Exonic
1079097733 11:17521703-17521725 GACTGATGACAGGCGGGGCCTGG + Intronic
1079130497 11:17744424-17744446 GAGTGAGGACAGGATGAGGCAGG - Intronic
1080244065 11:30159659-30159681 TTCTGAGAACTGACTGGGGCAGG - Intergenic
1081652017 11:44830529-44830551 GAATGTGGCCAGACTGTGGCTGG - Intronic
1082007027 11:47425058-47425080 GAATGGGGACAGCCTGGGGTGGG - Intronic
1083595277 11:63916008-63916030 GACTGAGGTCTGGCTGGAGCAGG - Intronic
1083602703 11:63958738-63958760 CCCTGAGGACAGACGGGGTCTGG + Intergenic
1083922960 11:65790265-65790287 ACCTGAGGACAGACTGAGGCTGG + Intronic
1084084543 11:66849012-66849034 CACTGAGCACACACAGGGGCTGG + Exonic
1084462290 11:69302656-69302678 GCCTGGGGCCAGGCTGGGGCTGG + Intronic
1084491046 11:69478443-69478465 GAGTGAGGAAAGACAGGAGCAGG - Intergenic
1084935275 11:72583614-72583636 GACTGGGGCCAGAATGGGACAGG - Intronic
1084961137 11:72717316-72717338 GACTGAGGTCTGACTGGCCCTGG - Intronic
1085464902 11:76716694-76716716 GTCAGAGGCCAGACTGAGGCTGG - Intergenic
1089611710 11:119672957-119672979 AAATGAGGAGTGACTGGGGCAGG - Intronic
1090902888 11:131048025-131048047 GACTGAGGATAGATTGGAGAAGG + Intergenic
1091174497 11:133546569-133546591 GGCAGAGGCCACACTGGGGCAGG - Intergenic
1091398683 12:170001-170023 GACTCAGGGCCGACTGTGGCGGG - Intronic
1094232974 12:28129005-28129027 GCCTGAGGTCAAACTGGGGGTGG + Intergenic
1095984075 12:47988215-47988237 TACTGAGAACAGACTGGGGCCGG - Intronic
1096086013 12:48865536-48865558 GGCTGAGGATGGGCTGGGGCTGG + Intronic
1096625948 12:52896110-52896132 GAGTGGGGACAGGCTGGTGCAGG - Intergenic
1096842831 12:54389946-54389968 GACTGAGGACACACAGGAGGAGG + Intronic
1099084116 12:78223887-78223909 ATCTGAGCACAGTCTGGGGCTGG - Intergenic
1099451733 12:82815884-82815906 GACTGAGGATAGAGTGGGACTGG + Intronic
1100289177 12:93197859-93197881 GAATGAGGTAAGACTGGGACTGG - Intergenic
1101709525 12:107251973-107251995 GAATGAGGACATTCTCGGGCAGG + Intergenic
1103786353 12:123436162-123436184 GAATGAGGGCAGCCTGGCGCTGG - Exonic
1103905978 12:124327367-124327389 GGGTGGGGACAGACGGGGGCGGG + Intronic
1103932816 12:124459556-124459578 GACTGAGGCCAGACTCAGTCAGG - Intronic
1105987791 13:25586326-25586348 GACTGAGAATAGAATGGGTCAGG + Intronic
1108041526 13:46343922-46343944 AACTGGGGACAAATTGGGGCCGG - Intronic
1108127612 13:47261503-47261525 TAGAGAGGACAGAGTGGGGCTGG - Intergenic
1108162775 13:47660000-47660022 ATCTGAGGACTGACTGGGGAAGG + Intergenic
1109030925 13:57186166-57186188 GAGTGAGGAAAGACTGATGCAGG - Intergenic
1111987159 13:95077149-95077171 GAATGAGGCCATACTGGGGCAGG + Intronic
1112784665 13:102938575-102938597 AACTGGGGAGAGACTGGGGGAGG + Intergenic
1113138101 13:107116414-107116436 GACTGAGGTCAGACAGGGAAAGG - Intergenic
1113592497 13:111511010-111511032 GGCTGAGGACAGGGTGGGGCAGG - Intergenic
1113973784 13:114211326-114211348 CCCTGTGGACAGGCTGGGGCTGG - Intergenic
1113986846 13:114324470-114324492 GACTCAGGAGATACAGGGGCAGG - Exonic
1114378695 14:22177341-22177363 GGCTGAGGACAGTCTAGGACTGG + Intergenic
1114619763 14:24088355-24088377 GACTGTGGACAGACTTGGGATGG + Intronic
1115727285 14:36230936-36230958 GAGTGAGGAAAGCCTGGGGCTGG - Intergenic
1116871247 14:50070857-50070879 CCCTGAGGACAGACGGGCGCGGG + Intergenic
1117465945 14:55994199-55994221 CACTGAGGCCAGTCAGGGGCTGG - Intergenic
1117828105 14:59724566-59724588 GATTAAGAACAGCCTGGGGCTGG + Intronic
1118771221 14:68943971-68943993 GACTGAGCAGGGACTGGTGCAGG - Intronic
1118791060 14:69093665-69093687 GACACAGGACTGACTGGGGCTGG - Intronic
1119036138 14:71231640-71231662 GGCTGAGGACAGTCTGGCACTGG + Intergenic
1120590012 14:86363972-86363994 GGCTGAGGACAGTTTGGTGCTGG + Intergenic
1120809212 14:88785812-88785834 GACTGAAGAGAGGCAGGGGCAGG - Intronic
1121254307 14:92520078-92520100 TACTGAGGTCAAATTGGGGCAGG - Intronic
1122077559 14:99245931-99245953 GGCTGGGGACCGACGGGGGCGGG + Intronic
1122234402 14:100323663-100323685 GGCTGAGGGCAGGCTGGGGATGG + Intronic
1122289055 14:100669812-100669834 CCCTGAGAACAGACTGGGGGCGG - Intergenic
1122293259 14:100690907-100690929 GACAGAGGACACTCTGGGGCTGG + Intergenic
1122362896 14:101177884-101177906 CACTGAGGCCAGAGAGGGGCAGG + Intergenic
1122365379 14:101192072-101192094 GACTGAGGAAAGTGTGGGGCAGG + Intergenic
1122538424 14:102482484-102482506 GAACGAGGCCAGACTGGAGCTGG - Intronic
1123988358 15:25664934-25664956 GTCAGAGGAAAGACTTGGGCTGG - Intergenic
1124220573 15:27846900-27846922 GGCTGAGGACAGGCAAGGGCAGG + Intronic
1125000223 15:34762184-34762206 CCCTGAGTACAGAATGGGGCAGG + Intergenic
1125551114 15:40545580-40545602 GGCTTAGGAAAGGCTGGGGCTGG + Intronic
1126739082 15:51759880-51759902 GCCTGAGGCCAGCCAGGGGCAGG + Intronic
1128445114 15:67752387-67752409 GACTGAAGACAGGCTGGGCACGG + Intronic
1128943064 15:71804379-71804401 CACTGGGGGCAGGCTGGGGCAGG - Intronic
1129479866 15:75815149-75815171 GAGAGAGGACAGACCGGAGCTGG - Intergenic
1129790551 15:78338165-78338187 GGCTGGGGAGGGACTGGGGCAGG - Intergenic
1130034087 15:80342001-80342023 GAATGGGGACAGACTGTGGTGGG + Intergenic
1131465563 15:92652599-92652621 GAGGGAGGACAGACTGGAGAGGG + Intronic
1132679132 16:1132593-1132615 GGCGGAGGCCAGGCTGGGGCCGG + Intergenic
1132826948 16:1909872-1909894 AACTGAGGCCAGACTCAGGCAGG - Intergenic
1133019715 16:2961983-2962005 GACTGAGGCCAGACTGGGGCAGG - Intergenic
1134102257 16:11460686-11460708 GGCTGAGGCCAGGCTGGGCCGGG - Intronic
1135662923 16:24312025-24312047 TACTGAGAGCAGACTGGTGCAGG - Intronic
1135720579 16:24814213-24814235 GCCAGAGGAAAGAGTGGGGCTGG + Intronic
1136683612 16:31981775-31981797 GACAGAGGACAGCCGGGGGATGG - Intergenic
1136885543 16:33928471-33928493 GACAGAGGACAGCCGGGGGATGG + Intergenic
1139532979 16:67552524-67552546 GACTGAGGTCAGACTGGTGGAGG + Intergenic
1140399952 16:74663504-74663526 GTCAGAGGCCAGACTGGTGCAGG + Intronic
1140473774 16:75228663-75228685 GAGTGAGGGCAGATTGGGGCAGG - Intronic
1141099306 16:81185414-81185436 TACTGAGGACCCACTGAGGCTGG - Intergenic
1141828184 16:86495279-86495301 ATCTGAGAACAGACAGGGGCGGG - Intergenic
1142146848 16:88496344-88496366 GAGGGAGGGCAGAGTGGGGCTGG + Intronic
1142445180 16:90131733-90131755 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1203086898 16_KI270728v1_random:1189341-1189363 GACAGAGGACAGCCGGGGGATGG - Intergenic
1142495455 17:304148-304170 GTCTCAGGAAAGAGTGGGGCAGG + Intronic
1142641380 17:1287982-1288004 GCCTGTGGACAGAGTGGGGAGGG - Intronic
1143106033 17:4531007-4531029 GGCTGAGCAGAGACAGGGGCTGG - Intronic
1143471503 17:7178587-7178609 GACTGAGTCAAGACTGAGGCTGG + Exonic
1143572301 17:7767099-7767121 GGCTCATAACAGACTGGGGCGGG - Intronic
1145380273 17:22383209-22383231 GACTGAGCTGGGACTGGGGCTGG + Intergenic
1146713570 17:35063997-35064019 ATCTGAGAACAGGCTGGGGCTGG + Intronic
1147144530 17:38477482-38477504 GACAGAGGACAGCCAGGGGATGG - Intronic
1147596965 17:41723779-41723801 GAATGGGGACAGGCTGGGACGGG + Exonic
1147897275 17:43758845-43758867 CAATGAGGACAGGCTGGGGCAGG + Intergenic
1148053484 17:44780345-44780367 CACTGAGCACAGTCAGGGGCTGG + Exonic
1151195574 17:72429259-72429281 TACTGAGGACAGGATTGGGCTGG + Intergenic
1151236791 17:72726155-72726177 GACTGAGTGCTGCCTGGGGCAGG + Intronic
1151328324 17:73392167-73392189 GGGTGAGGAGAGAATGGGGCAGG + Intronic
1151553211 17:74833932-74833954 TACAGAGGCCAGACTGGGCCCGG - Intronic
1151680689 17:75621197-75621219 GACTGAGGACAGACAGGCACAGG - Intergenic
1151829037 17:76538788-76538810 GCCTGAGGCCAGACAGGGCCTGG + Intronic
1151991053 17:77574532-77574554 GAGAGAGGACAGAGTGGAGCAGG - Intergenic
1152045272 17:77930940-77930962 GCCTGAAGAAAGACTGGGGTTGG + Intergenic
1152097596 17:78280961-78280983 GAGTGGGGACAGAGTGGGGGAGG + Intergenic
1152758958 17:82098448-82098470 GACTGAGGAGCGCCGGGGGCGGG + Intergenic
1152798529 17:82320500-82320522 GTCTGAGGACAGCATGGGGCCGG + Intergenic
1153139411 18:1954653-1954675 ACCTGAGGACAGCCTGGCGCTGG - Intergenic
1154127382 18:11703876-11703898 GACTGGGGACAGATGGAGGCAGG + Intronic
1154168863 18:12036398-12036420 GACTGAGGCCATCCTCGGGCAGG - Intergenic
1155455262 18:26005136-26005158 GCCTCTGGACACACTGGGGCAGG - Intergenic
1157237419 18:45977786-45977808 GACTGAAGACAGGCTGGGCATGG + Intergenic
1157481750 18:48059819-48059841 AGCTGGGGAGAGACTGGGGCAGG - Intronic
1157706909 18:49814422-49814444 TTCTGAGAACAGACTGAGGCCGG + Intronic
1157741412 18:50096658-50096680 TACAGTGGACAGACTGGTGCTGG - Intronic
1158473230 18:57757340-57757362 GGCTGATTACAGGCTGGGGCAGG - Intronic
1158876984 18:61743240-61743262 GACTGAGGACAGCCAGCTGCCGG - Intergenic
1160560143 18:79750992-79751014 CACAGAGGACAGGCTGGGGAAGG + Intronic
1160575188 18:79849129-79849151 GACTGAAGACAGGGTGGGGCTGG - Intergenic
1161047621 19:2144527-2144549 GACTGAGCACAGAGACGGGCTGG - Intronic
1161285297 19:3465511-3465533 GACCAAGGACAGCCAGGGGCTGG - Intronic
1161332359 19:3694413-3694435 GACTGAGGACAGAGCAGGACTGG - Intronic
1161363865 19:3867756-3867778 AACTGAGGCCTGACTGGGGAAGG - Intronic
1162029829 19:7912547-7912569 GACTGAGGACAGAGAGTGGGGGG + Exonic
1162311850 19:9912755-9912777 GACGGGGCGCAGACTGGGGCCGG - Intronic
1162943554 19:14028612-14028634 GTCTGAGGACAGGTGGGGGCGGG + Intronic
1162981436 19:14242791-14242813 CACAAAGGCCAGACTGGGGCAGG + Intergenic
1162998061 19:14348894-14348916 CACAGAAGACAGAATGGGGCTGG + Intergenic
1163176427 19:15566890-15566912 GACGGAGGAGAGACTGTGCCAGG - Intergenic
1163326417 19:16606252-16606274 GCCTGAAGACACAATGGGGCCGG + Intronic
1165178151 19:33945210-33945232 GTGTGAGGACCGTCTGGGGCGGG + Intergenic
1165247588 19:34506005-34506027 CCCTGAGAACAGATTGGGGCTGG + Exonic
1165489880 19:36116915-36116937 GAATAAGGACAGAAAGGGGCTGG - Intronic
1165609960 19:37142873-37142895 CACTGAGCACAGACTGGTCCTGG - Intronic
1165723185 19:38093940-38093962 CACTGGGGACAGAGTGGGGATGG + Intronic
1165743761 19:38218472-38218494 GACTGAGGTCAGACTGTGGCAGG + Intronic
1166314074 19:41978853-41978875 GACAGGGGACAGGATGGGGCAGG - Intronic
1166811390 19:45516490-45516512 AACTGAGGTCAGGCAGGGGCTGG + Intronic
1167270580 19:48503525-48503547 GACTGAGAAGAGTCTGGGGCAGG - Intronic
1167299931 19:48672447-48672469 CAGTGAGGCCAGGCTGGGGCAGG - Intronic
1167612915 19:50515787-50515809 GACAGAGGTCAGACTGGACCAGG - Intergenic
1167723019 19:51191820-51191842 GGCTGAGGACTGACTGGGCAGGG - Intergenic
1167921556 19:52786788-52786810 GACTGAAGCCAGGCCGGGGCAGG + Intronic
1168056410 19:53867459-53867481 GAGTGAGGTGAGACGGGGGCGGG + Intronic
1168072228 19:53959616-53959638 TGCTGAGGTCAGGCTGGGGCTGG - Intergenic
1168115189 19:54218369-54218391 GTCTGAGGACAGGGTGGAGCTGG - Exonic
1168184853 19:54693658-54693680 CACTGGGGACTGTCTGGGGCTGG - Intronic
1168314590 19:55479088-55479110 GACAGAGGACAAAGTGGTGCCGG + Intronic
1168469747 19:56630441-56630463 GACAGAGAACAGATGGGGGCTGG + Intergenic
1202712199 1_KI270714v1_random:24791-24813 GGCTCAGGATAGACAGGGGCAGG + Intergenic
926268930 2:11350391-11350413 GACTGAGGAGAGGCTAGGGAAGG - Intergenic
927194825 2:20539977-20539999 GACAGAGAGCAGGCTGGGGCCGG + Intergenic
927687837 2:25184342-25184364 GGTTGAGGACAGACTGAGGGAGG + Intergenic
927857293 2:26535643-26535665 CAGTGTGGAGAGACTGGGGCAGG - Intronic
927874043 2:26642588-26642610 GAAAGAGGAGAGAGTGGGGCTGG - Intergenic
928314800 2:30236818-30236840 GAGGGAGGGCAGACTGGGGCTGG + Intronic
929715695 2:44307001-44307023 GACTGAGGACAGAGAGGGAGGGG - Intronic
930664155 2:54085329-54085351 GACTGCGGACTGTCCGGGGCTGG + Intronic
930696412 2:54416278-54416300 GTGTGAGGAGAGAGTGGGGCAGG + Intergenic
931428573 2:62192531-62192553 CTCTGAGGAGAGGCTGGGGCTGG - Intergenic
932723181 2:74154079-74154101 TACTCAGGAGAGGCTGGGGCAGG + Exonic
933274759 2:80271710-80271732 GACTGAGGATAGGCTGGGCACGG - Intronic
934555023 2:95282516-95282538 GACTGAGGACAGGCATTGGCTGG + Intronic
934922807 2:98359647-98359669 GGCTGGGGACAGAAGGGGGCAGG - Intronic
935191555 2:100782433-100782455 CAGTGGGGAGAGACTGGGGCTGG - Intergenic
937045036 2:118846713-118846735 GACAGAGGCCAGACTGCCGCAGG - Exonic
937258020 2:120568415-120568437 TCCTGAGGAATGACTGGGGCTGG - Intergenic
937383142 2:121399993-121400015 GGCTGTTGATAGACTGGGGCCGG - Intronic
938370641 2:130766268-130766290 GACTGGGGCCAGATTGAGGCCGG - Exonic
939113334 2:138033223-138033245 GCCAGAAGACAGACAGGGGCGGG + Intergenic
940237549 2:151527245-151527267 GACTGAGTTCTGACTGAGGCTGG - Intronic
941269458 2:163407613-163407635 GACTGAGGAGATGCTGGGCCAGG + Intergenic
941715593 2:168760095-168760117 GAGGGAGGACTGACTGGGGTTGG - Intronic
941734979 2:168964340-168964362 GACTGTGGCCAGATTGGAGCAGG + Intronic
944058754 2:195549101-195549123 GACATAGGACAGAGCGGGGCCGG + Intergenic
944843982 2:203650672-203650694 GAATGACCACACACTGGGGCTGG - Intergenic
945923256 2:215777917-215777939 GAGTGAGGTAAGAATGGGGCAGG + Intergenic
946202262 2:218077331-218077353 GACTGAGGACTGAGGGGGGATGG - Intronic
947074649 2:226329326-226329348 TTCTGAGGACAGACTGCGGCAGG - Intergenic
947797196 2:232901947-232901969 TGCCGAGGACAGACTGAGGCCGG - Intronic
947963559 2:234260033-234260055 GACTGAGGTGAGGCTGAGGCTGG - Intergenic
947974643 2:234355226-234355248 GACTCGAGACAGCCTGGGGCCGG + Intergenic
948178482 2:235961979-235962001 TGCTGGGGACAGGCTGGGGCAGG + Intronic
948605490 2:239132063-239132085 CACTGAGGACGGACAGGGGCTGG + Intronic
948705147 2:239786358-239786380 GACTGAGAACAGCCCGGGGAGGG + Intronic
948900197 2:240952823-240952845 GACTGGGGAGAGGCTGAGGCAGG + Intronic
1168772940 20:427741-427763 GACTGGGGTCAGACTGGCCCAGG - Intronic
1169081174 20:2798525-2798547 AAAGGAGGACAGCCTGGGGCGGG + Exonic
1169202175 20:3716843-3716865 GACAGATGACAGACTGGGTGAGG - Intergenic
1169569775 20:6893190-6893212 GCCTGAGGACATACCAGGGCAGG + Intergenic
1171017704 20:21556896-21556918 GTCTGAGGACAGCCTGTGTCAGG - Intergenic
1171200012 20:23233212-23233234 AAGTGAGGGCAGGCTGGGGCAGG + Intergenic
1172209521 20:33187095-33187117 GACTGAGGACAGTGAGGGCCAGG + Intergenic
1173324778 20:42022925-42022947 GACTAAGGACAGAGTGCTGCTGG - Intergenic
1174172469 20:48625947-48625969 GAATGAGGAGAGGCCGGGGCGGG + Intronic
1175173400 20:57094755-57094777 GGGTGAGGACAGGATGGGGCAGG + Intergenic
1175479538 20:59301490-59301512 GACTGTGAAGAGACTGTGGCTGG + Exonic
1175645157 20:60664717-60664739 GACTGTGGTCAGAGAGGGGCTGG - Intergenic
1175899316 20:62353798-62353820 GACTGAGCAGAGCCTGGGGAGGG - Intronic
1176089479 20:63312552-63312574 GAGTGGGGAGAGGCTGGGGCTGG + Intronic
1179479072 21:41666355-41666377 GACTGAGCACCGCCTGAGGCTGG + Intergenic
1182676658 22:32044129-32044151 CACTTATGACAGACTGTGGCAGG + Intronic
1182922629 22:34094166-34094188 GACTGATCACACACTGAGGCTGG + Intergenic
1184130478 22:42514078-42514100 GTCTGAGGATGGACTGGGGGTGG + Intronic
1184248403 22:43247054-43247076 GACTGAGGCCAGGCTGGCTCCGG + Intronic
1184453063 22:44594327-44594349 GACTGGAGAGAGACTGGGGATGG - Intergenic
1185233972 22:49700343-49700365 GGCTGAGGACACACTGAGGAGGG - Intergenic
949795172 3:7842084-7842106 GTCTGTGGATAGACTGGAGCTGG - Intergenic
950265873 3:11572511-11572533 GACTGAGGAGGGCCTGGAGCAGG - Intronic
950331312 3:12158362-12158384 GACTGGGGACAGAAAGGGGAGGG - Intronic
950465225 3:13149438-13149460 GACAGAGGACAGGCAGGGACAGG + Intergenic
951246010 3:20342341-20342363 GACTGAGGGCACACAGGGCCAGG - Intergenic
952482489 3:33775931-33775953 GACTGAGGACATACTTTGGTAGG - Intergenic
952516823 3:34112869-34112891 GACAGAGGCCAGACTGGAGTGGG - Intergenic
952819815 3:37476628-37476650 TGCCGAGGACAGAGTGGGGCAGG - Intronic
953383192 3:42489691-42489713 GTCTGAGGCCAGACTAGGGCTGG - Intronic
953614020 3:44473660-44473682 GACTGATGCCAGGCTGGGGAGGG + Intronic
953912429 3:46899756-46899778 GTCAGAGGTCAGCCTGGGGCTGG + Intronic
954213251 3:49110126-49110148 GACAGTTCACAGACTGGGGCCGG - Intronic
955989515 3:64611470-64611492 GACTGAGGGAAGAGTGGGGTGGG + Intronic
958485212 3:94697224-94697246 GACTGAGTTCAGAGTGGGGGTGG + Intergenic
960333813 3:116392534-116392556 TGCTGAGGACAGCCTGGTGCTGG + Intronic
960858187 3:122124123-122124145 GACTGATAACAGAATGAGGCAGG - Intergenic
961318659 3:126057464-126057486 GCCTGAGGGCAGGCTGGGGCAGG + Intronic
963683717 3:148411689-148411711 GTGTGAGAACAGACTGGGGCTGG - Intergenic
963805107 3:149714590-149714612 TGCTGAGGACAGCCTGGCGCTGG + Intronic
964563029 3:158019372-158019394 AACTGAGCAGAGACTGGAGCTGG - Intergenic
965635959 3:170781012-170781034 GATTGAGGACAGGGTGGTGCTGG + Intronic
966853184 3:184176931-184176953 GACCTAGGACAGGCGGGGGCAGG - Exonic
966886099 3:184379004-184379026 GACTGTGGGGAGACTGGGACTGG - Intronic
967365066 3:188677088-188677110 AACTGAGGATTGACTGGGGAAGG - Intronic
968556801 4:1249694-1249716 GCCTGGGGACGCACTGGGGCAGG - Intronic
969049640 4:4363598-4363620 GGCAGAGCACAGACTGGGGCAGG + Intronic
969562271 4:7956787-7956809 GACTGATCACAGACTGGTGGAGG - Intergenic
969616779 4:8257819-8257841 GACACAGAACAGACTGGGGAAGG - Intergenic
969651313 4:8469819-8469841 GCCTGAGGACAGGCTGGGTGGGG - Intronic
970764594 4:19532320-19532342 GACTGAGGGCAGATTGCAGCAGG - Intergenic
970792899 4:19880258-19880280 GACAGAAGCCAGACTGGGGAGGG - Intergenic
970824132 4:20252867-20252889 GAGTGGGGACTGACTGGGGGCGG - Intergenic
971856645 4:32053271-32053293 GATTTAGGAGAGACTGGGGTTGG - Intergenic
973118888 4:46492965-46492987 TTCTGAGGACAGACTGGCCCAGG - Intergenic
973783272 4:54310914-54310936 TACTGAGGAGAGGCTGAGGCAGG - Intergenic
977409369 4:96641926-96641948 GACTGATCATAGACTGGGGGGGG - Intergenic
977809867 4:101346631-101346653 GACAGAGGAGAACCTGGGGCGGG + Intronic
978169667 4:105654362-105654384 GACTGGGGAGAGAGTGGAGCAGG - Intronic
979254831 4:118599017-118599039 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
981419985 4:144538295-144538317 CACTGAGGCCAGAATGGGGATGG + Intergenic
982100622 4:151964072-151964094 TTCTGAGGACAGTCTGGGCCAGG - Intergenic
982398279 4:154937144-154937166 CACTGAGGGCAGGCTGGTGCTGG + Intergenic
983626823 4:169809945-169809967 GACTGTGGACACTGTGGGGCCGG + Intergenic
985784841 5:1888031-1888053 GCCTGGGGTCAGACTAGGGCTGG + Intergenic
986297256 5:6449462-6449484 GACTGAGACCAGACGGGGACGGG - Intronic
986347733 5:6850289-6850311 GAGTGGGGACAGACTGTGGGTGG + Intergenic
987999544 5:25330970-25330992 GGCCGAGGACAGCCTGGTGCTGG + Intergenic
988993071 5:36690225-36690247 GACTGACGGCAGCCTGGGGTCGG - Intergenic
989268054 5:39500336-39500358 GACTGAGCACAGTGTGGGGTGGG + Intergenic
993050835 5:82924057-82924079 GATTGAGGAAAGACTGAGGATGG - Intergenic
998060562 5:139115474-139115496 CCCTGAGGTCAGAGTGGGGCTGG - Intronic
998179820 5:139928789-139928811 GACTGAGGAAAAGCTGAGGCAGG - Intronic
998306755 5:141084981-141085003 GCGGGAGGACAGACTGGAGCAGG + Intergenic
998632182 5:143911495-143911517 GACTGTGGACAGACGGGAGATGG - Intergenic
999047908 5:148489530-148489552 GACTGAGGAGAAAGTGGGGCAGG + Intronic
999735391 5:154509235-154509257 GCCTGAAGGCAGAGTGGGGCAGG + Intergenic
1002605358 5:180379899-180379921 GACTGAGGAATGCGTGGGGCTGG + Intergenic
1002662706 5:180802640-180802662 GACGGAGGTCAGACCGGGGGAGG - Intronic
1002725021 5:181289083-181289105 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1003324953 6:5084641-5084663 GGCTGCGGCCAGACTGGGGCGGG - Exonic
1005696342 6:28355939-28355961 GCCTGAGGACAGGCTGTGGGTGG - Intronic
1006285649 6:33092125-33092147 GCCTGAGGAGAGGCTGGTGCAGG + Intergenic
1006358633 6:33575255-33575277 GACAGAGGAGTGACTGGAGCTGG + Intronic
1006745077 6:36336033-36336055 GATAGAGGACAGAATGGGGTGGG - Intronic
1007138184 6:39543235-39543257 AACAGAGCTCAGACTGGGGCTGG + Intronic
1007378256 6:41470716-41470738 GACTGAAGAGAGACGGGGGAGGG + Intergenic
1007849242 6:44788274-44788296 GACAGAAAACAGCCTGGGGCCGG - Intergenic
1012142053 6:95636592-95636614 GACTGAGGACAGCCCGGAGCTGG - Intergenic
1016936944 6:149454715-149454737 GCCTGATGACAGCCTGGGGCGGG - Intronic
1017426729 6:154329929-154329951 CACGGAGGCCAGAGTGGGGCTGG - Intronic
1018254305 6:161903226-161903248 CACTGAGTACAGACTTGGGAAGG - Intronic
1019104519 6:169657372-169657394 GTCTGAGGACGGACTGACGCAGG + Intronic
1019575124 7:1734044-1734066 GACTGAAGGCAGACAGGTGCTGG - Intronic
1019641875 7:2107618-2107640 GCCTGAGGGCAGCCGGGGGCTGG - Intronic
1020812492 7:12864245-12864267 GACTGAGGACAGCCTGGTACTGG - Intergenic
1021585864 7:22207449-22207471 GACTGGGGACAGCCAGGGGGTGG + Intronic
1022169257 7:27808057-27808079 GACTGATTCCAGGCTGGGGCAGG - Intronic
1022807985 7:33842367-33842389 TCCTGAGGTAAGACTGGGGCAGG + Intergenic
1023969427 7:44979986-44980008 ATCCCAGGACAGACTGGGGCAGG + Intergenic
1024047195 7:45592866-45592888 CATTGAGGACCGACTGAGGCTGG + Exonic
1024069922 7:45776696-45776718 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1024343716 7:48291992-48292014 GACTGAGAACAGAAAGGGTCTGG - Intronic
1025187377 7:56871516-56871538 GACAGAGGAGAGGCTGGGGCAGG + Intergenic
1025188790 7:56881320-56881342 GACAGAGGAGAGGCCGGGGCAGG + Intergenic
1025683145 7:63695600-63695622 GACAGAGGAGAGGCTGGGGCAGG - Intergenic
1025684548 7:63705404-63705426 GACAGAGGAGAGGCTGGGGCAGG - Intergenic
1026698157 7:72614340-72614362 GACAGAGGTCAGACTGGGCATGG + Intronic
1026842733 7:73679516-73679538 CACTGAGCACAGCCTGGGCCAGG + Intergenic
1027232507 7:76280939-76280961 GACAGAGGAGAGACGGGGGTGGG - Intronic
1029152035 7:98487550-98487572 TACTCAGGAGAGACTGAGGCAGG + Intergenic
1029226766 7:99034154-99034176 GAGTCAGGACAGGCTGGGCCAGG + Intronic
1031083845 7:117282951-117282973 GACTGAGTGGAGACTGGGGGAGG + Intronic
1032047320 7:128620982-128621004 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1033092734 7:138402030-138402052 GACTGGGGATAGACTGGTGGGGG - Intergenic
1033227186 7:139571406-139571428 AACTGGGGACAGAGTGGGGCAGG + Exonic
1035662964 8:1361078-1361100 CACTGTGAACAGCCTGGGGCTGG - Intergenic
1035796552 8:2362601-2362623 CACTGAGGACAGACAGTGGGAGG - Intergenic
1036485795 8:9177734-9177756 GACAAAGGACAGACTGGCGGAGG - Intergenic
1036915488 8:12799878-12799900 GGCTGAGGGCAGCTTGGGGCTGG - Intergenic
1037287704 8:17318741-17318763 GAGTGAGGACAGATTGGAGTGGG - Intronic
1038345814 8:26731515-26731537 GACTGAGGTCAGATTGTGGAGGG + Intergenic
1038400421 8:27280243-27280265 GACTGTGTACAGACTGGACCAGG - Intergenic
1039022717 8:33225322-33225344 GACTGAGAAGAGACTGTGGATGG - Intergenic
1041022998 8:53657370-53657392 CAGTGAGGATAGACTGAGGCAGG + Intergenic
1041205542 8:55495024-55495046 TATTGAGGACAGCCTGGTGCTGG - Intronic
1042655442 8:71090646-71090668 CATTGAGAACAGACTGGAGCAGG - Intergenic
1043523527 8:81072249-81072271 GGCTGAGGACACAGTGGGACAGG - Intronic
1043745533 8:83869485-83869507 AGCTGAGGACAGCCTGGTGCTGG + Intergenic
1044525004 8:93241775-93241797 GGCTGAGGACAGCTTGGTGCTGG - Intergenic
1045057485 8:98382116-98382138 AGCTGAGTGCAGACTGGGGCAGG + Intergenic
1045873333 8:106950201-106950223 GACTGAGGGCAGCCTGGTGCAGG + Intergenic
1048437579 8:134432464-134432486 GGTGGAGGAGAGACTGGGGCAGG + Intergenic
1048720011 8:137312748-137312770 GCCAGAGGACAGAGTGGGGCTGG - Intergenic
1050096483 9:2072816-2072838 TAGTGAGGACAGGCTGTGGCTGG + Intronic
1050683700 9:8143190-8143212 AATTGAGGGCAGAGTGGGGCAGG - Intergenic
1051429482 9:16967212-16967234 GACAAAGGACAGGCTGGGGATGG - Intergenic
1051897623 9:22005467-22005489 GACTGAGGACAAAGTGGAGGAGG - Exonic
1052549222 9:29926693-29926715 GGCAGAGGACAGGCTGGGACAGG - Intergenic
1052842130 9:33301084-33301106 GACTGAGGCCAAAAAGGGGCAGG - Intronic
1055379319 9:75688995-75689017 GTAAGAGGACAGTCTGGGGCAGG + Intergenic
1056891587 9:90499134-90499156 GAGTGAGGACAGACTGAAGACGG - Intergenic
1057043771 9:91867753-91867775 CACTGTGGCCAGACTGGGACGGG - Intronic
1057220692 9:93256323-93256345 GACGGAGGGCAGGCGGGGGCCGG - Exonic
1057497867 9:95574731-95574753 CACAGAGGACAGCCTGGGGGCGG - Intergenic
1058417723 9:104805695-104805717 GTCACAGGACAGACTGTGGCAGG - Intronic
1058580026 9:106445993-106446015 AACTCAGGAGAGACTGAGGCAGG - Intergenic
1059333938 9:113556778-113556800 TACTGAGGCCAGAGAGGGGCAGG + Intronic
1059415949 9:114162608-114162630 GACTGGGGTGAGACTGGGACTGG + Intronic
1059424325 9:114211198-114211220 GACTGGGGCCTGGCTGGGGCTGG + Intronic
1060754835 9:126205398-126205420 GAATGAGGACGGTTTGGGGCTGG - Intergenic
1061479777 9:130891764-130891786 GTCTGAGGACAGAGTGGTTCAGG - Intergenic
1061604163 9:131696011-131696033 ACCTGAGGCCTGACTGGGGCTGG + Intronic
1062539181 9:137034169-137034191 GACAGAGGCAAGACTGGGACAGG + Intronic
1062562039 9:137146036-137146058 AGCCGAGGACAGGCTGGGGCGGG - Intronic
1062750165 9:138246730-138246752 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1186113611 X:6281782-6281804 AACTGAAGAAAGACCGGGGCTGG - Intergenic
1186853212 X:13600944-13600966 GAGTGAGGAGTGACTGGGTCTGG - Intronic
1189316975 X:40063391-40063413 GACTGGAGACAGCCTGAGGCTGG + Intronic
1189626555 X:42903322-42903344 GAGTGAGCTCAGGCTGGGGCTGG + Intergenic
1195589868 X:106612090-106612112 GAGTCAGGACAGCCTGAGGCTGG + Exonic
1199236694 X:145501582-145501604 GACTGAGGTCAGACTGTGATGGG + Intergenic
1200092841 X:153643904-153643926 GGCTGGGGCCAGCCTGGGGCCGG + Intronic
1201291055 Y:12421144-12421166 TATGGAGGACAGACGGGGGCGGG - Intergenic
1201747072 Y:17388409-17388431 GAAAGAAGACAGACAGGGGCCGG + Intergenic