ID: 906217731

View in Genome Browser
Species Human (GRCh38)
Location 1:44053578-44053600
Sequence GGCCCAACTCCTGGTAGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906217731_906217737 20 Left 906217731 1:44053578-44053600 CCAGTACTACCAGGAGTTGGGCC No data
Right 906217737 1:44053621-44053643 AGACCTGTGTCCATTGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906217731 Original CRISPR GGCCCAACTCCTGGTAGTAC TGG (reversed) Intergenic
No off target data available for this crispr