ID: 906223701

View in Genome Browser
Species Human (GRCh38)
Location 1:44103709-44103731
Sequence CAGCTCGGACAGCTTGGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906223690_906223701 11 Left 906223690 1:44103675-44103697 CCATGTCCTGCTTGGCCGGCTGG 0: 1
1: 0
2: 17
3: 42
4: 209
Right 906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG No data
906223696_906223701 -4 Left 906223696 1:44103690-44103712 CCGGCTGGAGGGCGGCCTCCAGC 0: 1
1: 12
2: 16
3: 57
4: 277
Right 906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG No data
906223694_906223701 5 Left 906223694 1:44103681-44103703 CCTGCTTGGCCGGCTGGAGGGCG 0: 1
1: 0
2: 10
3: 37
4: 223
Right 906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG No data
906223688_906223701 16 Left 906223688 1:44103670-44103692 CCGCGCCATGTCCTGCTTGGCCG 0: 1
1: 8
2: 10
3: 20
4: 130
Right 906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906223701 Original CRISPR CAGCTCGGACAGCTTGGCGT TGG Intergenic
No off target data available for this crispr