ID: 906227003

View in Genome Browser
Species Human (GRCh38)
Location 1:44130415-44130437
Sequence GTCCAGGTTGAGGATTCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906227003 Original CRISPR GTCCAGGTTGAGGATTCAAA AGG (reversed) Intronic