ID: 906231600

View in Genome Browser
Species Human (GRCh38)
Location 1:44169408-44169430
Sequence GCTCTGGGAAGTGCATGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906231595_906231600 -1 Left 906231595 1:44169386-44169408 CCCTGGGGCAGGCAGCACTCAGG No data
Right 906231600 1:44169408-44169430 GCTCTGGGAAGTGCATGCTTTGG No data
906231597_906231600 -2 Left 906231597 1:44169387-44169409 CCTGGGGCAGGCAGCACTCAGGC No data
Right 906231600 1:44169408-44169430 GCTCTGGGAAGTGCATGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906231600 Original CRISPR GCTCTGGGAAGTGCATGCTT TGG Intergenic
No off target data available for this crispr