ID: 906232039

View in Genome Browser
Species Human (GRCh38)
Location 1:44172249-44172271
Sequence CTTCAGAACCCGACAGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906232039_906232041 -4 Left 906232039 1:44172249-44172271 CCCAGGTCTGTCGGGTTCTGAAG No data
Right 906232041 1:44172268-44172290 GAAGCCCACGTGTTTTCTCTAGG No data
906232039_906232045 13 Left 906232039 1:44172249-44172271 CCCAGGTCTGTCGGGTTCTGAAG No data
Right 906232045 1:44172285-44172307 TCTAGGGAAGATATAAGAAGCGG No data
906232039_906232042 -3 Left 906232039 1:44172249-44172271 CCCAGGTCTGTCGGGTTCTGAAG No data
Right 906232042 1:44172269-44172291 AAGCCCACGTGTTTTCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906232039 Original CRISPR CTTCAGAACCCGACAGACCT GGG (reversed) Intergenic
No off target data available for this crispr