ID: 906234412

View in Genome Browser
Species Human (GRCh38)
Location 1:44195870-44195892
Sequence GGGTGGACTAATGCCAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906234412_906234417 3 Left 906234412 1:44195870-44195892 CCTCAATTGGCATTAGTCCACCC No data
Right 906234417 1:44195896-44195918 AATTTGCATGTAATCGAAAGTGG No data
906234412_906234418 4 Left 906234412 1:44195870-44195892 CCTCAATTGGCATTAGTCCACCC No data
Right 906234418 1:44195897-44195919 ATTTGCATGTAATCGAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906234412 Original CRISPR GGGTGGACTAATGCCAATTG AGG (reversed) Intergenic
No off target data available for this crispr