ID: 906237204

View in Genome Browser
Species Human (GRCh38)
Location 1:44219239-44219261
Sequence GGCTGGCGGAACCTCCGCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906237204_906237217 28 Left 906237204 1:44219239-44219261 CCGGTGCGGAGGTTCCGCCAGCC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 906237217 1:44219290-44219312 CAAGGCCTCACCCCGAGTGGAGG 0: 1
1: 0
2: 1
3: 9
4: 92
906237204_906237218 29 Left 906237204 1:44219239-44219261 CCGGTGCGGAGGTTCCGCCAGCC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 906237218 1:44219291-44219313 AAGGCCTCACCCCGAGTGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 99
906237204_906237214 10 Left 906237204 1:44219239-44219261 CCGGTGCGGAGGTTCCGCCAGCC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 906237214 1:44219272-44219294 TGGAAGGGTCACCTGGCACAAGG 0: 1
1: 0
2: 1
3: 25
4: 272
906237204_906237213 3 Left 906237204 1:44219239-44219261 CCGGTGCGGAGGTTCCGCCAGCC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 906237213 1:44219265-44219287 CTCAGGGTGGAAGGGTCACCTGG 0: 1
1: 0
2: 1
3: 17
4: 234
906237204_906237211 -5 Left 906237204 1:44219239-44219261 CCGGTGCGGAGGTTCCGCCAGCC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 906237211 1:44219257-44219279 CAGCCTAGCTCAGGGTGGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 201
906237204_906237216 25 Left 906237204 1:44219239-44219261 CCGGTGCGGAGGTTCCGCCAGCC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 906237216 1:44219287-44219309 GCACAAGGCCTCACCCCGAGTGG 0: 1
1: 0
2: 1
3: 7
4: 97
906237204_906237207 -10 Left 906237204 1:44219239-44219261 CCGGTGCGGAGGTTCCGCCAGCC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 906237207 1:44219252-44219274 TCCGCCAGCCTAGCTCAGGGTGG 0: 1
1: 0
2: 1
3: 6
4: 107
906237204_906237210 -6 Left 906237204 1:44219239-44219261 CCGGTGCGGAGGTTCCGCCAGCC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 906237210 1:44219256-44219278 CCAGCCTAGCTCAGGGTGGAAGG 0: 1
1: 0
2: 0
3: 21
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906237204 Original CRISPR GGCTGGCGGAACCTCCGCAC CGG (reversed) Exonic
900256106 1:1699049-1699071 GGCTGCGGGAAGCTCCTCACGGG + Intronic
900264774 1:1751659-1751681 GGCTGCGGGAAGCTCCTCACGGG + Exonic
900364563 1:2305813-2305835 GCCTGGCGGAAACTCCGGATGGG + Intronic
901852057 1:12022041-12022063 GGCTGCCAGAACCTACCCACCGG - Intronic
903371959 1:22842166-22842188 GGCTGGCAGAGCCTCCTCTCTGG - Intronic
905465061 1:38146998-38147020 AGCTGGCAGAACCCCCACACTGG + Intergenic
906237204 1:44219239-44219261 GGCTGGCGGAACCTCCGCACCGG - Exonic
910588063 1:88900626-88900648 AGCTAGCAGAACCTCTGCACTGG + Intergenic
919230164 1:194763658-194763680 AGCTGGCAGAACCACCACACTGG - Intergenic
923068541 1:230541978-230542000 GGTTGGCAGAACCTTCACACTGG + Intergenic
923390547 1:233510780-233510802 GGCTGGTGAAACCTACTCACAGG - Intergenic
924732481 1:246724522-246724544 GGCAGGCGGGAGCTCCGCTCCGG - Exonic
1066167186 10:32800351-32800373 AGCTGGCAGAACCTCCACATTGG - Intronic
1071942940 10:90608883-90608905 AGCTGGCAGAACCCCCGCATTGG - Intergenic
1074865814 10:117543762-117543784 AGCCGGAGGAACCTCCGCCCAGG - Intronic
1075866013 10:125719827-125719849 GGCCGGCGGACCCTCGGCTCCGG - Exonic
1076549193 10:131267151-131267173 GGCTGGTGGCAACTCAGCACTGG - Intronic
1081110322 11:39127289-39127311 AGCTGGCAGAACCCCCACACTGG + Intergenic
1083267967 11:61555626-61555648 GGCGGGCGGCGCCTCCGCATTGG + Intronic
1084218233 11:67663108-67663130 GGCTGGGGGAACCTGCGGTCTGG + Exonic
1084943349 11:72625964-72625986 GGCTGGAGCAACCTCAGCCCGGG + Intronic
1085685808 11:78621064-78621086 AGCTGGCGGAACCCCCACAATGG + Intergenic
1086278469 11:85159333-85159355 AGCTGGCAGAACCTCCACATTGG + Intronic
1086821966 11:91445990-91446012 GGCTGGCTGCATCTCTGCACTGG + Intergenic
1096197127 12:49655890-49655912 GGCTGGGGGAAATTCCACACAGG + Intronic
1098730907 12:74036218-74036240 AGCTGGCAGAACCTCCACATTGG + Intergenic
1098733162 12:74064521-74064543 AGCTGGCAGAACCCCCACACTGG + Intergenic
1100540036 12:95548843-95548865 GGCTGTCGTAGCCGCCGCACCGG - Intronic
1103561204 12:121794047-121794069 GGCTGGCTGTGCCTCCGCACCGG + Exonic
1105018099 12:132798388-132798410 AGCTGACGGAAACTCAGCACAGG - Exonic
1114758404 14:25284991-25285013 AGCTGGCAGAACCACCACACTGG - Intergenic
1120973515 14:90229337-90229359 AGCTGGCAGAACCCCCACACTGG + Intergenic
1122393617 14:101407452-101407474 GGCTGGCAGAGCCTCTGCAGAGG - Intergenic
1122412374 14:101532291-101532313 GGCTGGCGGAGTCTCCGGGCTGG - Intergenic
1122945719 14:105007968-105007990 GGCTGGCGGAGCCACCGGAAAGG - Intronic
1124803886 15:32861771-32861793 GGGTGGTGGAACTTCAGCACGGG - Intronic
1125814796 15:42575408-42575430 GACTGGCCGAACGTCCACACGGG + Intergenic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1132989426 16:2785377-2785399 GGCTGGGGCAGCCTCCGCCCAGG - Exonic
1136403871 16:30032126-30032148 GGCTGGTGCAAGCTCCTCACTGG + Intronic
1140597566 16:76434758-76434780 AGCTGGCGGAACCTCCACATTGG - Intronic
1145273664 17:21417750-21417772 GGCTGGAGGAACTTCAGCAGTGG - Exonic
1145291664 17:21551459-21551481 GGCTGACTGAACGCCCGCACCGG - Exonic
1145311851 17:21705192-21705214 GGCTGGAGGAACTTCAGCAGCGG - Intergenic
1148136972 17:45299623-45299645 AGCTGGAGGAACCTCAGAACTGG + Intronic
1154506032 18:15041733-15041755 AGCTGGCAGAACCCCCGCATTGG + Intergenic
1156544526 18:37950452-37950474 GGCAGGCGGTTCCTCCGAACAGG + Intergenic
1159205999 18:65253719-65253741 GGCAGGAAGAACCTCAGCACAGG + Intergenic
1160859405 19:1231264-1231286 GCTTGGGGGAACCTGCGCACGGG + Exonic
1161314015 19:3609433-3609455 GGCTGGGGGAATCTCTGCAGGGG + Intergenic
1163744301 19:19035708-19035730 GGCTGGCAGAAGCTCCACAGAGG + Intronic
1164872705 19:31659508-31659530 GGCTGGGGGATCCTCCACCCTGG + Intergenic
1167471815 19:49679792-49679814 GGGTGGCGGAACCTGGGCTCTGG - Intronic
1168343780 19:55640958-55640980 AGGCGGCGGAACCTCCGCACTGG + Intronic
1168539502 19:57198506-57198528 AGCTGGCAGAACCCCCACACTGG - Intronic
925798721 2:7575040-7575062 GGCTGAAGGAGCCTCCACACAGG + Intergenic
930536749 2:52653383-52653405 GGCTGGCAGAACCCCCACATTGG - Intergenic
936074620 2:109393975-109393997 GGCTGGCCGCACCTCCCCACCGG + Intronic
940171468 2:150833849-150833871 GGCTGGCAGAATCCCTGCACTGG - Intergenic
943799793 2:192043692-192043714 AGCTGGCGGAAACCCCGCATTGG + Intronic
945495417 2:210502007-210502029 GGCAGGAGGCACCTCCTCACAGG + Intronic
1169948815 20:11019098-11019120 AGCTGGCGCAACCTCGGCAGGGG + Intergenic
1176187316 20:63788064-63788086 TCCTGGAGGAACCTCCCCACGGG + Intronic
1176791821 21:13327291-13327313 AGCTGGCAGAACCCCCGCATTGG - Intergenic
1178922156 21:36745807-36745829 AGCTGGCGGTATCTCCGCAGAGG - Intronic
1181730913 22:24845712-24845734 GGCTGGGGGCACCACCCCACGGG + Intronic
1183466191 22:37981517-37981539 GGCTGGGGGAACCTGGGGACAGG + Intronic
1184306280 22:43604594-43604616 GGCTGGTGGAACCTCTGGACAGG - Intronic
1184603715 22:45559520-45559542 AGCTGGCAGAACCCCCACACTGG - Intronic
955303770 3:57809481-57809503 GGCTGAGGGAAGCTCAGCACTGG + Intronic
966811102 3:183845704-183845726 GGCGGGCAGAGCCTCCTCACAGG + Intronic
967108310 3:186271417-186271439 GCCTGGGGGACCCTCAGCACAGG + Intronic
977400469 4:96524764-96524786 GGCTGCAGGGACCTCTGCACAGG - Intergenic
977465848 4:97382261-97382283 AGCTGGCAGAACCCCCACACTGG + Intronic
980999498 4:139814854-139814876 GGCTGGAGGAACCTGGGCAACGG + Intronic
991013965 5:61912036-61912058 AGCTGGCAGAACCCCCACACTGG - Intergenic
1001530074 5:172455160-172455182 GGCTGGGGGAACCTGGTCACGGG - Intergenic
1006062200 6:31432090-31432112 AGCTGGCAGAACCCCCACACTGG + Intergenic
1010559797 6:77334432-77334454 GGCTGGCGGCACCTCTGCTTGGG - Intergenic
1010818479 6:80387269-80387291 AGCTGGCAGAACCTCCACATTGG + Intergenic
1012730316 6:102873189-102873211 AGCTGGCAGAACCCCCACACTGG + Intergenic
1017175989 6:151505273-151505295 GGCAGGCGGCATCTCAGCACTGG + Intronic
1024557437 7:50615547-50615569 AGCTGGCGGGACCCCAGCACAGG - Intronic
1034204631 7:149304813-149304835 GGCTGCCGGCACCACCCCACAGG + Intergenic
1035579002 8:728198-728220 GGCTGGCGGAGCCTCCTCCCTGG - Intronic
1039951108 8:42173324-42173346 GGCTGGGGGTTCCTTCGCACTGG + Intergenic
1044487299 8:92768256-92768278 AGCTGGCAGAACCCCCACACTGG - Intergenic
1044614032 8:94120844-94120866 GGCTGGCGGCACCTCTGCTTGGG - Intergenic
1044750277 8:95409099-95409121 AGCTGGCAGAATCTCCACACTGG + Intergenic
1049313392 8:141946070-141946092 GGCTGGCAGATCCTGCGCTCCGG + Intergenic
1051591009 9:18776927-18776949 GGCTTGCGGACCCTGCGCGCCGG - Exonic
1051881994 9:21849524-21849546 AGCTGGCAGAACCCCCACACTGG + Intronic
1055446377 9:76387620-76387642 GGCTGGCAGTATCTCTGCACAGG + Intronic
1059247677 9:112862413-112862435 GGCTGGCCTCACCTCCCCACAGG - Intronic
1191742675 X:64452438-64452460 AGCTGGCAGAACCTCCACATTGG - Intergenic
1197796032 X:130299541-130299563 GGCTGGGGGCAGCTCAGCACTGG - Intergenic