ID: 906243399

View in Genome Browser
Species Human (GRCh38)
Location 1:44256524-44256546
Sequence CTGGGGCCCCTGAAGTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906243399_906243406 17 Left 906243399 1:44256524-44256546 CCAACATACTTCAGGGGCCCCAG 0: 1
1: 0
2: 1
3: 12
4: 125
Right 906243406 1:44256564-44256586 TTCATCAACGGAACCTGAGTGGG 0: 1
1: 0
2: 1
3: 1
4: 41
906243399_906243403 5 Left 906243399 1:44256524-44256546 CCAACATACTTCAGGGGCCCCAG 0: 1
1: 0
2: 1
3: 12
4: 125
Right 906243403 1:44256552-44256574 CTGCTGCCTCTCTTCATCAACGG 0: 1
1: 0
2: 2
3: 20
4: 220
906243399_906243405 16 Left 906243399 1:44256524-44256546 CCAACATACTTCAGGGGCCCCAG 0: 1
1: 0
2: 1
3: 12
4: 125
Right 906243405 1:44256563-44256585 CTTCATCAACGGAACCTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906243399 Original CRISPR CTGGGGCCCCTGAAGTATGT TGG (reversed) Intronic
902224618 1:14988773-14988795 CAGGGGCCACTGAATTGTGTCGG + Intronic
905872743 1:41414537-41414559 CTGGTGCCCCTGAAGGAAGGAGG + Intergenic
906243399 1:44256524-44256546 CTGGGGCCCCTGAAGTATGTTGG - Intronic
909800136 1:79796672-79796694 CTGGGTCTGCTGGAGTATGTAGG + Intergenic
916753898 1:167749973-167749995 CTGGGGCCACTCAGGTATGTCGG - Intronic
916836652 1:168552967-168552989 CTGGGGGACCTGAAGTCTGCTGG - Intergenic
919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG + Intergenic
1063670675 10:8097175-8097197 ATGTGTCCCCAGAAGTATGTTGG + Intergenic
1064021834 10:11815170-11815192 TTGGGAACCCTGCAGTATGTGGG - Intergenic
1065316670 10:24470669-24470691 CTGGGCCCCCTGGAGTATGCAGG - Intronic
1067825825 10:49572224-49572246 CTGGGCCCACAGAAGAATGTTGG + Intergenic
1069738136 10:70670790-70670812 CTGGGGCCCCTGAGTTTTCTAGG + Intergenic
1070647307 10:78210892-78210914 CGTGGGCCCCTGAAGTTTCTAGG + Intergenic
1073096890 10:100985307-100985329 CAGGGGCCTCTGAAGTCTCTAGG + Exonic
1073338712 10:102729402-102729424 CTGGGGCCGCTGCAGCATGGTGG + Intronic
1077320973 11:1941854-1941876 CTTGTGCCCCTGTAGCATGTGGG - Intergenic
1079118343 11:17655369-17655391 CTGAGGCAACTGAAATATGTGGG + Intergenic
1085621339 11:78040115-78040137 CTGCAGCCCCGGAAGTCTGTTGG - Intronic
1087332287 11:96795587-96795609 ATTGAGCACCTGAAGTATGTTGG - Intergenic
1088974445 11:114803243-114803265 CTTAGTCCCCTGAAGTGTGTAGG - Intergenic
1091206220 11:133823140-133823162 CTGGGGACCCTGGGGTAAGTGGG - Intergenic
1092945618 12:13451330-13451352 CTGGTCCCCCTGAGGTATCTTGG + Intergenic
1097145870 12:56939062-56939084 CTGGGCTCCCTGCAGTAAGTGGG + Intergenic
1097151431 12:56982600-56982622 CTGGGCTCCCTGCAGTAAGTGGG + Intergenic
1100952500 12:99867018-99867040 CTGGTGCCCCTGATTTAAGTTGG - Intronic
1101408977 12:104453731-104453753 CTGGGGCCCCTGGCTGATGTTGG + Intergenic
1104443916 12:128818494-128818516 CTGGGGACCCTGAGGTGTGCAGG - Intronic
1104694257 12:130851752-130851774 CTGAGGCCCCAGAAGGATCTGGG - Intergenic
1110871262 13:80455018-80455040 CTGGGGCCATTGAAGTGTGGAGG + Intergenic
1113782396 13:112984094-112984116 CTGCTGCCTCTGAAGTATGGTGG - Intronic
1114769055 14:25408172-25408194 TTGGGGCCACTGCAGGATGTTGG + Intergenic
1115326822 14:32149018-32149040 CTTGGGGCCCAGAAGTATTTTGG + Intronic
1118719363 14:68583375-68583397 CTGGACCCCCAAAAGTATGTGGG - Intronic
1121119211 14:91365284-91365306 CTGGAGCCCATGAAGCAGGTAGG + Intronic
1124577386 15:30921869-30921891 CTGTGTTCCCAGAAGTATGTGGG + Intronic
1125831764 15:42721881-42721903 CAGGGGACCCTGAAGTTTGCTGG + Intergenic
1126716765 15:51525915-51525937 CTGGGGCTCCTGCAGTCTGCAGG - Intronic
1129681749 15:77662169-77662191 CTGGGGCCCCAGAACTGTGTAGG - Intronic
1132624086 16:881878-881900 CTGGGGCTGCTGACGTGTGTCGG + Intronic
1132720538 16:1313601-1313623 CTGGGGCCCCAGATGGATGTGGG - Intronic
1134893852 16:17866173-17866195 CTGGGTCCCCTGAAGTTTCCAGG - Intergenic
1136566333 16:31072989-31073011 ATGGGGTCCCTTAAGTTTGTGGG + Intronic
1137394188 16:48105490-48105512 CTGGGGCCTCTGAGCTTTGTGGG + Intronic
1144824529 17:18098346-18098368 CTGGGGTCATTGAAGTAAGTGGG + Exonic
1145253585 17:21310521-21310543 CTGGGGCCCTTGCAGGATGGGGG - Intronic
1146691487 17:34879340-34879362 CTGGAGCCCCAGAAGTGTCTGGG + Intergenic
1147234935 17:39050451-39050473 CTGAGGCCCCTGAAGATTTTTGG + Intergenic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1147915552 17:43883209-43883231 GTGGGGCTCCTGGAGGATGTGGG + Exonic
1147924584 17:43938688-43938710 CTGGGGCCCCGGGAGGAGGTCGG - Exonic
1148808875 17:50278159-50278181 CTGGCGCCCATGGAGTATGAGGG - Intronic
1149300901 17:55304078-55304100 CTGGGCCCACTGAAGTGGGTAGG - Intronic
1149991674 17:61387084-61387106 CAGGGGCCCCAGCAGTAGGTCGG - Intronic
1153709503 18:7783685-7783707 CTTGGGCCTCTGGAGTATCTGGG + Intronic
1155431277 18:25761674-25761696 CTGGGGCCGCAGAAGAATGGGGG - Intergenic
1159706468 18:71695634-71695656 CAGGGGCATCTGAAGGATGTCGG - Intergenic
1161200240 19:3010576-3010598 CTGGGGCCCCTGAAAGAAGCTGG - Intronic
1161446662 19:4322661-4322683 CTGGGGCCCAAGGAGTATCTGGG + Intronic
1161843193 19:6694626-6694648 CTGGGGTCCCTGCAGCAGGTGGG + Exonic
1162435585 19:10655939-10655961 CTGGGGCCCCTTGCTTATGTGGG + Intronic
1162523630 19:11195474-11195496 CTGGGGCCTCTGCAGCATGATGG - Intronic
1162806590 19:13140561-13140583 CTGGGGTCCCTGAAACAAGTGGG - Exonic
1163175355 19:15560934-15560956 CAGGGCCCCCTGGAGTAGGTGGG - Intergenic
1167000082 19:46740692-46740714 CTGGGGCACCTGATGTGTGTGGG - Intronic
1167139914 19:47643339-47643361 CCGGGGCCCCAGATGTATTTGGG - Intronic
1167445869 19:49537233-49537255 CTGGGTCCCCGGAAGGGTGTGGG - Intronic
1168312057 19:55465309-55465331 CTGGGACCCCTGGTGTCTGTGGG + Intergenic
927432917 2:23042036-23042058 CTGGGACCCCTGAACTTTGAAGG - Intergenic
931457975 2:62426897-62426919 CTGGGGCCACTGGGGCATGTTGG + Intergenic
934962932 2:98693589-98693611 CTGAGCCCCCGCAAGTATGTGGG - Intronic
937227937 2:120380449-120380471 CTGGGGGCCCTGCAGGATGCTGG - Intergenic
937912506 2:127082317-127082339 CAGGGGCCCCTGGAGCATGAGGG - Intronic
941116182 2:161474967-161474989 CCTGGGCCTCTGAAGTAGGTGGG - Intronic
948052828 2:234991594-234991616 TTGGGGCCCCTGAAGACTGACGG + Intronic
949047185 2:241877530-241877552 CAGGGGGCCCTGAAGTTTGCAGG + Intergenic
1170614016 20:17934814-17934836 CTGAGGCCCCTGAACTTTGGAGG - Intergenic
1173901073 20:46589151-46589173 CTGGGGCCCATCAAGTATGTGGG - Exonic
1174448756 20:50607606-50607628 CAGGGGCCCCTGAAGTGTACAGG - Intronic
1179789931 21:43750334-43750356 CCGGGGCCCCTGCAACATGTGGG - Intronic
1181042053 22:20196934-20196956 CTCGGGCCCCTGGGGTGTGTGGG + Intergenic
1183077509 22:35436289-35436311 CTGGGGCCCATGCGGTCTGTGGG - Intergenic
1184469808 22:44690094-44690116 CTGGGGCCCAAGGAGGATGTGGG + Intronic
953808396 3:46091241-46091263 CTGGGGCCACTGGATTAGGTTGG + Intergenic
954123509 3:48514895-48514917 CAGGGGCCCCTGAACGAGGTGGG + Intergenic
961684509 3:128620382-128620404 CTGGGCCCCCTGGAGGATGCGGG + Exonic
962220652 3:133561959-133561981 CTGTGGCCTCTGCAGTATGGAGG - Intergenic
966940163 3:184741115-184741137 CTGGGGCTCCTGGAGGTTGTGGG - Intergenic
969666498 4:8560416-8560438 CTGGGGACCCTGAGGCATGGAGG - Intronic
969839679 4:9871766-9871788 CAGGTGCCCCTGAAGTCAGTGGG - Intronic
982665375 4:158254513-158254535 CTGGGGCGGCTGAAGTAGGAGGG + Exonic
985370489 4:189280875-189280897 CTGTGCCTCCTGAAGTATCTGGG - Intergenic
985843701 5:2329096-2329118 CTGGGTCCCATGAAATCTGTGGG + Intergenic
988915860 5:35892948-35892970 CAGGAGCCCATGAAGTAGGTGGG + Intergenic
992992069 5:82294008-82294030 TGGGGTCCCCTGAACTATGTTGG + Intronic
998182706 5:139956498-139956520 CTGGGGACCCTGGAGGATGCTGG - Intronic
1000188722 5:158887056-158887078 CTGGGGCCTTTGAAGAATCTAGG - Intronic
1001191893 5:169638948-169638970 CTGGCATCCCTGAAGTGTGTGGG + Intronic
1004297134 6:14423029-14423051 CTGGGGCCCCTGAGCCATGCAGG - Intergenic
1004456706 6:15798182-15798204 CTCTGGCCACTGAAGTGTGTTGG + Intergenic
1006742272 6:36317627-36317649 CTGAGGCCCATGAAGCAAGTAGG - Intronic
1007380708 6:41488523-41488545 TGGAGGCCCCTGAAGTGTGTAGG - Intergenic
1007477047 6:42125751-42125773 CTGGGGCCCCTGGAGTGGGCTGG - Intronic
1015256518 6:131184394-131184416 CTGAGCCCCCTGAAGGAAGTTGG - Intronic
1016358100 6:143239514-143239536 CAGCAGCCCCTGAAGAATGTAGG + Intronic
1017651811 6:156590509-156590531 CTGGCGCCCCTGCACCATGTTGG - Intergenic
1018936299 6:168276050-168276072 CTGGGTCCCCTGTAGTCTGCAGG + Intergenic
1018956566 6:168414066-168414088 CTGGGCTCCCTGACGTCTGTCGG - Intergenic
1019914844 7:4126111-4126133 ATGGGGGCCCTGAAGTATGGCGG + Intronic
1021222703 7:17991869-17991891 CTAGGGCCCCTGCATCATGTAGG + Intergenic
1021499961 7:21321296-21321318 CTGGTGCACCTGAGGTATGCTGG - Intergenic
1026514767 7:71059318-71059340 CTGGGTCCCCAAAAGTGTGTGGG - Intergenic
1033792841 7:144813007-144813029 CTGTGGCCCTTTAAATATGTGGG - Intronic
1034381807 7:150702469-150702491 CTGGGGCCCATGAAGAACATAGG + Intergenic
1034980824 7:155475160-155475182 CTGGGGCCACTGAAGAAGCTGGG - Intronic
1035202509 7:157276486-157276508 CTGGGGCCCCTCACATCTGTGGG - Intergenic
1039716558 8:40115859-40115881 CTGTGGACCCTGAAGTTTGGTGG + Intergenic
1042006350 8:64184104-64184126 CTGGTGTCCCTGAAATATATGGG + Intergenic
1042071947 8:64945285-64945307 CTGGTTCCACTGAAGTAAGTTGG + Intergenic
1042214927 8:66421539-66421561 TTGGAGCACCTGAAGTATGTAGG + Intergenic
1044224476 8:89703867-89703889 CTGGTGCCCATGAAGGATCTCGG - Intergenic
1045323300 8:101098120-101098142 CTGGGGCCCCAGAAGGCTATGGG + Intergenic
1045705728 8:104920375-104920397 CTGGGGTCCCAGAAGGATGTGGG + Intronic
1047349328 8:124058618-124058640 CTGGGGCTCCTGAAGTGTCTTGG - Intronic
1047422188 8:124716445-124716467 CTGCAGCTCTTGAAGTATGTAGG - Intronic
1052684169 9:31733190-31733212 CTGGGTGCCCAGAAGTATGTTGG + Intergenic
1052840724 9:33289421-33289443 CTGGGGTCCCTGAAACAAGTGGG - Intergenic
1057729256 9:97594572-97594594 CTGGGGCCTCTGCAGTACTTGGG + Intronic
1060032645 9:120228667-120228689 CTGGGGCCACAGAAGTCTATGGG + Intergenic
1062352991 9:136148302-136148324 CTTCGGCCCCTGAATTATGCAGG + Intergenic
1062427525 9:136512800-136512822 CTTAGGCCCCTGCAGTATGTGGG - Intronic
1185863820 X:3604640-3604662 CAGGGGCCCCAGAAGCACGTTGG + Exonic
1187522905 X:20029144-20029166 CGGGGGTCCCTGAAGTGTGCTGG + Intronic
1188784458 X:34327314-34327336 GTGGGGCCCCAGAAGCATCTAGG - Intergenic
1190211480 X:48452069-48452091 CTGTGGCCACTGAAGTCTCTTGG - Intergenic
1192298712 X:69878344-69878366 CAGGGGCCCCAGAAGCACGTTGG + Intronic
1193456816 X:81741779-81741801 CTGGGGACCCTGAAGTAGGGAGG - Intergenic
1196140706 X:112260218-112260240 CAGGGGCCCCTGAAGGAAATAGG + Intergenic
1199879396 X:151961240-151961262 CTGGGGCCCCAGAAACATGCTGG - Intronic
1200800336 Y:7381256-7381278 CAGGGGCCCCAGAAGCACGTTGG - Intergenic