ID: 906244440

View in Genome Browser
Species Human (GRCh38)
Location 1:44263113-44263135
Sequence GGGAAGGTTAATGGAACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906244440_906244444 -3 Left 906244440 1:44263113-44263135 CCAGAAGTTCCATTAACCTTCCC 0: 1
1: 0
2: 1
3: 8
4: 126
Right 906244444 1:44263133-44263155 CCCTCAGCTCCTACATCAGAAGG 0: 1
1: 0
2: 1
3: 17
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906244440 Original CRISPR GGGAAGGTTAATGGAACTTC TGG (reversed) Intronic
903676335 1:25066988-25067010 GGCAAGGTGAAAGGAACATCAGG + Intergenic
905764293 1:40587313-40587335 GACAAGGTTCATGGAGCTTCTGG - Intergenic
906244302 1:44262362-44262384 AGGAAGGTTAATGGAACTGCTGG - Intronic
906244440 1:44263113-44263135 GGGAAGGTTAATGGAACTTCTGG - Intronic
908279300 1:62514081-62514103 GGAAAGGTTCATTAAACTTCAGG - Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
912565476 1:110584513-110584535 GGGAAGCTTGAGGGAACTGCTGG + Intergenic
913575844 1:120173981-120174003 GGGAAGGGTAGTGGTACTACTGG + Intronic
914558158 1:148789552-148789574 GGGAAGGGTAGTGGTACTACTGG + Intergenic
914614676 1:149340678-149340700 GGGAAGGGTAGTGGTACTACTGG - Intergenic
915765463 1:158357691-158357713 TGGAATGTTAATGAATCTTCAGG + Intergenic
919110451 1:193212663-193212685 GGGAAAGTTACAGAAACTTCTGG + Intronic
924246924 1:242094242-242094264 GGGAAGGTGCATGGGCCTTCAGG + Intronic
1068547647 10:58367198-58367220 GAGGAGGTTCATGGAACCTCTGG - Intronic
1070383771 10:75905198-75905220 GGGAAGTTTAATGCATTTTCTGG - Intronic
1071720837 10:88144676-88144698 GGGAAGGCTACTTGACCTTCAGG + Intergenic
1073490419 10:103849591-103849613 GGGCAGGTGAATGGAAGGTCAGG - Intronic
1074153734 10:110781148-110781170 GGGAAGGTTCATGGAGGGTCCGG - Exonic
1075704713 10:124493582-124493604 TGGAAGGTTAACGGCTCTTCTGG + Intronic
1078474498 11:11619974-11619996 GGGAAGGTTCAGGGAGGTTCAGG - Intronic
1090159931 11:124481997-124482019 CGGGAGGTTAATGGAAATTAAGG + Intergenic
1090502872 11:127278892-127278914 GGCATGGTTACTGGAACTTGTGG + Intergenic
1092653260 12:10656982-10657004 GGGATGGCTAATGGAAGTTATGG + Intronic
1096892504 12:54786073-54786095 GGGAATGTCAATGGGGCTTCAGG + Intergenic
1097021147 12:56021569-56021591 GGGAAGGATAATGTAAGTTCAGG + Exonic
1098012371 12:66067042-66067064 GGGATGGTTAAAGGAACTTGGGG + Intergenic
1098510095 12:71301556-71301578 GGGCAGGAAAATGGAAGTTCAGG + Intronic
1100293909 12:93242963-93242985 GGAAAGGTTTAAGGAACTCCTGG - Intergenic
1101679372 12:106949993-106950015 GGGAGGGGTAATGGAACTGTTGG - Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104502132 12:129296598-129296620 GGGAAGGTGTAGGAAACTTCAGG - Intronic
1105540490 13:21312050-21312072 GGGAAGGTTTGTGGCACTGCAGG - Intergenic
1106972141 13:35154226-35154248 GGGAAGGAAAATGAAACTTCTGG + Intronic
1108265952 13:48708786-48708808 GGAAATGTTAATAGAATTTCAGG - Exonic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1113448474 13:110388373-110388395 GGGAAGGTTTCTGGGACTCCTGG + Intronic
1116119574 14:40705512-40705534 GGGAAGGTGATTGGATCTTGGGG - Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1126495263 15:49283075-49283097 TGGAATGTTAATGGAGCTACGGG - Intronic
1133776089 16:8896300-8896322 GGAAAGGTTTATGCAACTTTCGG - Intronic
1135413558 16:22252434-22252456 GGGACTTTTATTGGAACTTCTGG - Intronic
1135905146 16:26505164-26505186 GGGAGGGTTGATGCACCTTCAGG + Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1143153848 17:4823290-4823312 GGGAAGGATAAAGCCACTTCTGG + Exonic
1143897163 17:10145314-10145336 AGGAAGGAAAATGGAACTTCAGG + Intronic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1146623900 17:34421413-34421435 GGGAAGGTCCATGGAACATCAGG - Intergenic
1146678712 17:34791861-34791883 AGGAAGGGTAAGGGAACCTCAGG - Intergenic
1149311519 17:55398876-55398898 TGGAAGATAAATGGAAATTCCGG - Intronic
1150132250 17:62675498-62675520 GGGAAGATGAATGGCCCTTCAGG - Intronic
1150174355 17:63034570-63034592 GGCAAAGTGAATGGAAATTCTGG + Intronic
1151390862 17:73785912-73785934 AGGAAGGTAAATGCCACTTCTGG + Intergenic
1153769406 18:8403100-8403122 GGGATGGTTAATAGGACCTCAGG + Intronic
1157158572 18:45291406-45291428 GGGAAAGGTAATGGATCTGCAGG - Intronic
1160471577 18:79139813-79139835 GGGAAGGTTAGTGGGAGTTGTGG - Intronic
1162043040 19:7981923-7981945 GGAAAGGTAAATGGAACTGGTGG - Intronic
1167725719 19:51211619-51211641 GGGAAGGTCAAAGGGACCTCAGG + Intergenic
927155101 2:20216784-20216806 GGGGAGGTTGGAGGAACTTCTGG - Intronic
927881200 2:26691548-26691570 GGGAAGGGTAGTGGAAACTCAGG - Intergenic
930609919 2:53530704-53530726 GGGAAGGTGAAAGGAAATCCTGG - Intergenic
931673649 2:64672219-64672241 GGGAAGTCTGCTGGAACTTCTGG + Intronic
933081330 2:77990568-77990590 GGGAAGGTTAAAGGTAATTTAGG + Intergenic
935152329 2:100449310-100449332 GGGAAGGTGAAGGGAAATTAAGG - Intergenic
936033863 2:109094079-109094101 GGGATGGTTAATGGCAGTTATGG + Intergenic
940424494 2:153515047-153515069 AGAAAGGTTAATGGATCTTAGGG - Intergenic
944774154 2:202945110-202945132 GGGAAACTTAGTGGAACTTTTGG + Intronic
946773549 2:223113940-223113962 GCGAGGTGTAATGGAACTTCAGG + Intronic
1169151016 20:3289482-3289504 GGGAAGGTTATAGGAAGTGCAGG - Intronic
1170015657 20:11778921-11778943 TGGATGGTTAAAGGAACTCCTGG + Intergenic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1178301870 21:31459921-31459943 GGGGAAGATAATGGAACCTCAGG - Intronic
1178776406 21:35555306-35555328 GAAAAGGTGAATGGCACTTCAGG - Intronic
1179117913 21:38511110-38511132 AGGAAGGTTATTGAAAATTCAGG - Intronic
1182401162 22:30079203-30079225 GGGGAGGTTCATGGGACTCCAGG + Intergenic
1184808474 22:46812100-46812122 GGGGAGGTTAATCGGGCTTCTGG + Intronic
949924228 3:9028312-9028334 TGGAAGCTTCATGGGACTTCTGG + Intronic
949964011 3:9339831-9339853 AGGAAGGCTAATGGACCCTCAGG + Intronic
951973338 3:28473872-28473894 GGGAAGGTTAATGGAGTGTCAGG + Intronic
952695931 3:36264911-36264933 GGGAAGGTTGATGGCCCATCTGG - Intergenic
953211568 3:40879693-40879715 GGGACAATAAATGGAACTTCAGG + Intergenic
953682635 3:45051381-45051403 TGGAAGGTTTTTGGTACTTCTGG + Intergenic
953715174 3:45311443-45311465 AGGAAGGAACATGGAACTTCTGG + Intergenic
955611110 3:60758197-60758219 GGGAAGGTTATTGGGACCTGAGG - Intronic
956779792 3:72594945-72594967 AGGAATGTGATTGGAACTTCTGG - Intergenic
956924498 3:73969179-73969201 GAGAAAGTTAATGGCCCTTCTGG + Intergenic
958472683 3:94541350-94541372 GGGAAAGTAACTGAAACTTCAGG - Intergenic
962058746 3:131902941-131902963 GGGAATCTTAATTTAACTTCAGG - Intronic
962073913 3:132060355-132060377 GGGAACATTAATGGAGCTTGAGG - Intronic
963774700 3:149426561-149426583 GGGAGGCTAAATGGAACTCCAGG + Intergenic
965121060 3:164558165-164558187 GGGAAGGTTAAGAGATCATCAGG - Intergenic
965365795 3:167798312-167798334 GGGAGAATTTATGGAACTTCTGG - Intronic
968093740 3:195913696-195913718 GGGAAGCTTGATGGAAATGCTGG - Intergenic
968877789 4:3283150-3283172 GGAAAGGTTAAGGGAAATGCTGG - Intergenic
972192980 4:36616984-36617006 GGGAAGGTTATTGGATCATGAGG - Intergenic
980960277 4:139468006-139468028 GGGAAGGGTAGTGGGGCTTCGGG - Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
994631613 5:102295110-102295132 GGGAAGGTTAAAGCTGCTTCTGG - Intronic
1000888299 5:166773589-166773611 CAGTAGGGTAATGGAACTTCTGG - Intergenic
1001487920 5:172133011-172133033 GGGAAGGGTAAAGGCACTCCTGG + Intronic
1002547916 5:179963727-179963749 GAGAAGGTTAGTGGAAGTACTGG + Intronic
1002568405 5:180127157-180127179 GGGATGGGTAAGGGAACTCCTGG - Intronic
1006278889 6:33030212-33030234 GGGAAGGTGAAAGAAACTTGGGG - Intergenic
1007362757 6:41370626-41370648 GGGAGGGTCAATGGAAAGTCAGG - Intergenic
1008860884 6:56148823-56148845 GGGAAGATTCACTGAACTTCAGG - Intronic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1012815271 6:104016230-104016252 GGTAAGGTTGATGGAACATGAGG - Intergenic
1023934159 7:44727294-44727316 GGGAAGTTTAATGTAACTCACGG - Intergenic
1027955599 7:84875305-84875327 TGGAAAGTTATTGGAAATTCAGG - Intergenic
1028218711 7:88167845-88167867 GGGAAGAGTAATGAAACTTAGGG - Intronic
1028379116 7:90178139-90178161 TGCAAGCTTGATGGAACTTCAGG + Intronic
1037824034 8:22150112-22150134 GGGAAGGTTGTTGGGACTTGGGG - Intronic
1038018527 8:23534282-23534304 GGGAAGGTTGAGGGAACTTTAGG - Intronic
1042990862 8:74638146-74638168 GGGATGGTTGATGGAAGTTGGGG + Intronic
1043649910 8:82578596-82578618 GGGAATGTCAATGGAGCTACAGG - Intergenic
1044249629 8:89990648-89990670 GGCAGGGTTAATGGAATTTTGGG - Intronic
1052113337 9:24617444-24617466 GGCAATGTGATTGGAACTTCAGG + Intergenic
1052145015 9:25037899-25037921 GGTAAGTTTAAAGGAACTCCTGG - Intergenic
1054808309 9:69413319-69413341 GGGAAGGTGGATGGAGCTGCGGG - Intergenic
1058177326 9:101751734-101751756 GGGAATGTTACTGGTACTTTTGG + Intergenic
1203479616 Un_GL000224v1:630-652 GGGATGGTGAATGGTAGTTCCGG + Intergenic
1203480583 Un_GL000224v1:6926-6948 GGGATGGTGAATGGTAGTTCCGG + Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1193099366 X:77591479-77591501 GGGAATGTTGAAGGATCTTCAGG - Intronic
1193761265 X:85469125-85469147 GGGAAGGTTAATGGAGCAGTAGG + Intergenic
1193907468 X:87260828-87260850 GGGAAGGGTATTGGCAGTTCAGG - Intergenic
1195346943 X:103960290-103960312 GGGAAGGTGAATGGAAGTGGAGG + Intronic
1195360499 X:104078551-104078573 GGGAAGGTGAATGGAAGTGGAGG - Intergenic
1195363017 X:104103325-104103347 GGGAAAGTTCATGGAATGTCTGG + Exonic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1196256091 X:113521126-113521148 GGGCAGGAGAATGGAACTTAGGG - Intergenic
1196920779 X:120583287-120583309 GGGATGGTTAATGGCAGTTATGG + Intergenic
1197582833 X:128306106-128306128 GTAAATTTTAATGGAACTTCTGG - Intergenic
1198441367 X:136666612-136666634 GGGAAGGTCACTGGAAATTGAGG - Exonic
1199115403 X:143986074-143986096 GGGCATGTTACTGGACCTTCAGG + Intergenic
1201986614 Y:19975332-19975354 GACAAGGTTCATGGAGCTTCTGG + Intergenic