ID: 906245284

View in Genome Browser
Species Human (GRCh38)
Location 1:44269040-44269062
Sequence GTCCCATTGGAAGAAGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906245284_906245296 27 Left 906245284 1:44269040-44269062 CCCTCAACTTCTTCCAATGGGAC 0: 1
1: 0
2: 0
3: 22
4: 199
Right 906245296 1:44269090-44269112 GTAGTTGGTAAGGGTAAAAGTGG 0: 1
1: 0
2: 0
3: 11
4: 159
906245284_906245288 -5 Left 906245284 1:44269040-44269062 CCCTCAACTTCTTCCAATGGGAC 0: 1
1: 0
2: 0
3: 22
4: 199
Right 906245288 1:44269058-44269080 GGGACAGTGGAGCCATCCCAAGG 0: 1
1: 0
2: 0
3: 23
4: 286
906245284_906245293 17 Left 906245284 1:44269040-44269062 CCCTCAACTTCTTCCAATGGGAC 0: 1
1: 0
2: 0
3: 22
4: 199
Right 906245293 1:44269080-44269102 GCCAGACATTGTAGTTGGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 101
906245284_906245295 18 Left 906245284 1:44269040-44269062 CCCTCAACTTCTTCCAATGGGAC 0: 1
1: 0
2: 0
3: 22
4: 199
Right 906245295 1:44269081-44269103 CCAGACATTGTAGTTGGTAAGGG 0: 1
1: 0
2: 0
3: 11
4: 146
906245284_906245292 12 Left 906245284 1:44269040-44269062 CCCTCAACTTCTTCCAATGGGAC 0: 1
1: 0
2: 0
3: 22
4: 199
Right 906245292 1:44269075-44269097 CCAAGGCCAGACATTGTAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906245284 Original CRISPR GTCCCATTGGAAGAAGTTGA GGG (reversed) Intronic
900083195 1:874521-874543 GGCCCATGGAAAGAAGTTGGAGG - Intergenic
900974142 1:6006841-6006863 CGGCCCTTGGAAGAAGTTGAGGG - Intronic
901749198 1:11395699-11395721 GTCCCACTGGAAGAAGCAGTAGG + Intergenic
902491845 1:16788329-16788351 GGCCCACTGGAAGAAATTCAAGG + Intronic
906245284 1:44269040-44269062 GTCCCATTGGAAGAAGTTGAGGG - Intronic
906749650 1:48247509-48247531 GCCCCAGAGGAAGATGTTGATGG - Exonic
907605604 1:55814375-55814397 GTCCCATAGGAAGATGCTGAGGG - Intergenic
908444084 1:64185098-64185120 GTCCCACTGGAAGATCTTCAAGG + Intergenic
908500311 1:64736794-64736816 GTCCCACTGGAAGATCTTCAGGG - Intergenic
910346542 1:86245375-86245397 GTCCCAATGGAAGGACTTCAGGG + Intergenic
910943831 1:92566707-92566729 GTCCCACTGGAAGATCTTCAGGG - Intronic
912641749 1:111352795-111352817 GTCCCTTTGGAGGATATTGATGG + Exonic
914730741 1:150368033-150368055 ATCCCATTGCAACAAGTTGAAGG + Intronic
917050809 1:170920501-170920523 GTCCCATTGGGATATGTTGTGGG - Intergenic
918174093 1:182028185-182028207 GTCCCATTGGAAGGTCTTCAGGG + Intergenic
918817994 1:189214846-189214868 GTCCCATTGGAAGGTCTTCAGGG - Intergenic
919649618 1:200133875-200133897 GTCCCATTGGAAGGTCTTCAGGG - Intronic
923281220 1:232444984-232445006 GTACCATTGGAAGCTGGTGAGGG - Intronic
923528600 1:234794210-234794232 GGCCCACTGGAAGAAATTCAAGG - Intergenic
924376532 1:243415070-243415092 GTCACATTGAAAGAAATTGCAGG - Intronic
924934816 1:248758846-248758868 GTCCCCTTCTAAGAAGATGATGG - Intergenic
1063469991 10:6276729-6276751 GTCACATTGGGAGAAACTGAGGG - Intergenic
1064122655 10:12633273-12633295 GTCCCATGGGAGGAGGTTAATGG + Intronic
1064947377 10:20806038-20806060 GTCTCATTGGAAGAAGGTATAGG - Intronic
1065974453 10:30830138-30830160 GTCCCATTTGAAGACTCTGATGG + Intronic
1069211217 10:65761895-65761917 GTCCCACTGGAAGGTCTTGAGGG + Intergenic
1070400499 10:76049212-76049234 GTTCCCTTGGAAGGAGTTGAGGG + Intronic
1072183352 10:93009927-93009949 ATCCTACTGGAAGAAGTGGATGG + Intronic
1073086675 10:100895446-100895468 GACCCACTGCAAGAAGGTGAAGG - Intergenic
1074094312 10:110296030-110296052 GTCTATTTGGAAGTAGTTGAAGG - Intronic
1074973999 10:118565912-118565934 GTCCCATTGGACAAAGGTGAAGG - Intergenic
1076112653 10:127872717-127872739 GTCCCTTTGAAAGAAGTGGCGGG - Intergenic
1076120438 10:127932771-127932793 GTCTCACTTGACGAAGTTGACGG + Intronic
1076158077 10:128218889-128218911 GTCCCATTGGAAGGTCTTGAGGG - Intergenic
1076165930 10:128282813-128282835 GTCCCATTGGAAGGTCTTCAGGG + Intergenic
1076182001 10:128416761-128416783 GTCCCACTGGAAGTTCTTGAGGG - Intergenic
1076672709 10:132131854-132131876 GCCCCATGGGAAGAAGTGCAGGG + Intronic
1078031437 11:7755442-7755464 GTCCCACTGGAAGGTGTTCAGGG - Intergenic
1078329100 11:10404198-10404220 GTCCCACTGGAAGATCTTCAGGG - Intronic
1080090060 11:28336953-28336975 GTCCCACTGGAAGGTGTTCAGGG - Intergenic
1081566363 11:44263539-44263561 GTCCCTGTGGAAGAAGTGTAAGG + Exonic
1084164996 11:67371480-67371502 GGCCCAGGGGAAGAAGCTGAGGG + Intronic
1084474710 11:69382116-69382138 GTCACATTGCAAGAGGATGAAGG + Intergenic
1085241050 11:75055975-75055997 GTCCCACTGGAAGATCTTCAGGG - Intergenic
1087156763 11:94912312-94912334 GTCCCATTGGAAGGTCTTCAGGG + Intergenic
1088708837 11:112487922-112487944 GTCCAAGTGGAAGATGATGATGG + Intergenic
1091085716 11:132719776-132719798 GTACCATCTGGAGAAGTTGAGGG - Intronic
1093956398 12:25224305-25224327 GTCCCACTGGAAGATCTTCAGGG - Intronic
1094408661 12:30146788-30146810 GTCCTATTGAAAGAAGTTCTGGG - Intergenic
1095382097 12:41607296-41607318 GCCGCATTAGAAGAAGCTGAAGG + Intergenic
1097025561 12:56052738-56052760 GTCCCACTGGAAGATCTTCAGGG + Intergenic
1097649417 12:62278194-62278216 GTCCCATTGGAAGGTCTTCATGG + Intronic
1099874606 12:88389519-88389541 GTCCCATAGAATGAAGTTTACGG - Intergenic
1100355510 12:93825395-93825417 GACCCCTTGGGAGAAGATGATGG + Intronic
1102918005 12:116769438-116769460 GTCCCACTGGAAGATCTTCAGGG - Intronic
1103206994 12:119137648-119137670 TTCACATTGGAAGGGGTTGAGGG + Intronic
1105720438 13:23108286-23108308 TTCCGATTGGCAGAAGTTGAGGG - Intergenic
1106175404 13:27326322-27326344 GTCCCACTGGAAGACCTTCAGGG + Intergenic
1107445044 13:40462921-40462943 GTCCCATTGGAAGGTCTTCAGGG + Intergenic
1110758440 13:79203162-79203184 GTCCCACTGGAAGGACTTCAGGG - Intergenic
1111591908 13:90358759-90358781 GTCCCATTGGAAGTTCTTCAGGG - Intergenic
1114267725 14:21082489-21082511 GAGCACTTGGAAGAAGTTGAGGG - Intronic
1114879246 14:26763259-26763281 GTCCCACTGGAAGGTGTTCAGGG + Intergenic
1118896404 14:69949310-69949332 GTCCCACTGGCAGGTGTTGAGGG + Intronic
1118923824 14:70173578-70173600 TTCCCATTGGAGAAAGTGGAGGG - Intronic
1119841395 14:77795932-77795954 GTCCCATTCCCAGTAGTTGAAGG + Intergenic
1120199555 14:81521892-81521914 GTCCCATTGGAAGGTCTTCAGGG - Intronic
1123966306 15:25462897-25462919 CTCCAAGTGGAAGAAGTTGGAGG + Intergenic
1129952204 15:79601756-79601778 GTCACATTGGAAGGTATTGAGGG + Intergenic
1131046382 15:89319077-89319099 GTCACAGTGGAAGAAGTGGGAGG - Exonic
1132000982 15:98179890-98179912 GTCCCAGAGGAAGAAGGAGATGG + Intergenic
1133416918 16:5613988-5614010 GCCCCATTGAGAGAAGTGGAGGG - Intergenic
1134157928 16:11859149-11859171 GTCCCATTAGAAGGTGTTCAAGG - Intergenic
1135872180 16:26161265-26161287 GTCACATTAGAAGAAGAAGAAGG + Intergenic
1138670693 16:58611923-58611945 GTCCAGTTGGAAGGAGTTAAGGG - Intronic
1139296672 16:65907397-65907419 ATCACCTTGGAAGAAATTGAAGG + Intergenic
1150759377 17:67946815-67946837 GTGCCATTGCAAGATGTTGCTGG - Intronic
1154109700 18:11556206-11556228 GTCCCAGTGGAAGATTTTCAGGG + Intergenic
1155950873 18:31912013-31912035 GTCCTATTGGCTTAAGTTGATGG - Intronic
1156077346 18:33296505-33296527 CTCCCATTGGAAGAAGCTGGAGG + Intronic
1156527477 18:37780061-37780083 GTCCCATAGGAAGGAGGAGATGG + Intergenic
1157351203 18:46887588-46887610 GTCACATTGTAAGCAATTGATGG + Intronic
1158889624 18:61860786-61860808 GTCCCATTGGAAGGTCTTCAGGG - Intronic
1159425194 18:68275807-68275829 GTCCCATAAGAAGAAGTCTAGGG - Intergenic
1164756768 19:30695526-30695548 GTCTCAATGGAAGAAGATGTGGG + Intronic
925630077 2:5882928-5882950 GTCCCATTGGAAGGTTTTCAGGG - Intergenic
926676688 2:15630053-15630075 GTACCAGTGGATGAATTTGATGG + Exonic
927422284 2:22946043-22946065 GTCCCATTGGAAGGACTTCAGGG + Intergenic
927430834 2:23025018-23025040 GTCCCATGGGAAGACATGGACGG - Intergenic
928499501 2:31875648-31875670 GGGCCATTGGCAGAAGTTCAAGG - Intronic
928736878 2:34301350-34301372 GTCCCACTGGAAGGTGTTCAGGG + Intergenic
930262792 2:49166741-49166763 GTCACATTGGAAGATGTTCCTGG - Intergenic
931898405 2:66760216-66760238 GTCCCATTGGAAGGTCTTCAGGG - Intergenic
932420277 2:71597355-71597377 ATCCCATTAGGAGAAGCTGAAGG + Intronic
933873806 2:86598026-86598048 GTCCCTTTGGTAGAATTTTAAGG + Intronic
935716240 2:105941585-105941607 GTCCCACTGGAAGGTCTTGAGGG + Intergenic
936933663 2:117816500-117816522 GTCCCACTGGAAGATCTTCAGGG + Intronic
939037652 2:137151435-137151457 GTCCCATTGGAAGATCTTTAGGG + Intronic
940975158 2:159934757-159934779 GTACCATTAGAAGAAGCTGAAGG - Intronic
942803274 2:179900547-179900569 GTCCCACTGGAAGACTTTCAGGG + Intergenic
943769306 2:191697886-191697908 GTCCCACTGGAAGGTCTTGAGGG + Intergenic
945637750 2:212378063-212378085 GTCCCATTGGAAGGTCTTCACGG + Intronic
1170251825 20:14292013-14292035 CTCCCATTGGAATCAGATGAAGG - Intronic
1170493983 20:16906760-16906782 TTCCTATTGAAAGAATTTGAGGG - Intergenic
1172824761 20:37771972-37771994 AACCCATTGGAAAAAGATGAAGG - Intronic
1173414648 20:42844925-42844947 GTCACATTGGCAGAAGGTGCTGG - Intronic
1175549418 20:59807386-59807408 GTCCCACTGGAAGATCTTCAGGG + Intronic
1175652978 20:60744210-60744232 GTCCCATTGGAAGGTTTTCAGGG - Intergenic
1175883444 20:62273961-62273983 GTTCCATAGGAAGAAGTTTCAGG - Intronic
1177732583 21:25047185-25047207 ATCCCAGTGGGAGAAGCTGAAGG - Intergenic
1178430897 21:32517870-32517892 CTCCCATAGGGAGAAATTGAAGG + Intergenic
1178445505 21:32637806-32637828 GTCACATTTGTAAAAGTTGAAGG - Intronic
1178615385 21:34128665-34128687 TTCCCAGTGGAACAACTTGATGG + Intronic
1180261347 21:46671223-46671245 CTCCCATTGGAAGAGGAGGAAGG + Intergenic
1180743080 22:18067292-18067314 GTCACATGGGAAGCAGTGGATGG - Intergenic
1183486604 22:38090410-38090432 GTGCCATTGAAAGAAGTTTTAGG - Intronic
950852103 3:16071825-16071847 GTCCCATTGGAAGATCTTTAGGG - Intergenic
951662416 3:25084093-25084115 GTCCCATTGGACTCAGTTTAGGG - Intergenic
957021081 3:75127088-75127110 GTCCCATTGGAAGGTCTTTAAGG - Intergenic
957592147 3:82213155-82213177 GTCCCATTGGAAGATCTTCAGGG - Intergenic
957612854 3:82490932-82490954 GTCCCAGTGAAAGAATTTTAAGG + Intergenic
958882940 3:99693420-99693442 GTCCCACTGGAAGAACTTCAGGG - Intronic
958948472 3:100391383-100391405 GTCCCACTGGAAGATCTTCAAGG - Intronic
959860062 3:111206628-111206650 GTACCATCAGAAGAAATTGAGGG - Intronic
962400222 3:135052222-135052244 GACCCATTGAATGAACTTGATGG + Intronic
962431106 3:135320821-135320843 CTCCCATTGGAAGAACTTAATGG + Intergenic
964592612 3:158382192-158382214 GTCCCATTGGAAGATCTTCAGGG + Intronic
965133585 3:164733090-164733112 GTCCTATTGGAATATGTAGATGG - Intergenic
965469830 3:169077315-169077337 GTACCATGGAAAGCAGTTGAGGG + Intergenic
968953060 4:3704419-3704441 GTCCCCAGGGAAGAGGTTGAGGG - Intergenic
970790034 4:19846436-19846458 GTCCAAATGGAAGAACCTGAGGG + Intergenic
972682301 4:41318159-41318181 ACCCCATTGGAAGAACTTGCCGG + Intergenic
974283355 4:59829567-59829589 GTGCCATAGGAAGAAATTTAAGG + Intergenic
974516353 4:62918239-62918261 GTCCCATTGGAAGGTCTTCAGGG + Intergenic
976050056 4:81001024-81001046 GTTCCATTGGGATAAGTTGCTGG - Intergenic
976394563 4:84542292-84542314 GTCCCACTGGAAGGATTTCAGGG + Intergenic
980658335 4:135820155-135820177 GCCCCATTGAAAGAAATTTAAGG + Intergenic
981125477 4:141101419-141101441 GTCCCATTGGAAGGTCTTCAGGG + Intronic
981185346 4:141795507-141795529 GTCCCTTTAGCAGAAGTCGAAGG - Intergenic
981517627 4:145626885-145626907 GTCCCCTGGGAAGAAGTTTGAGG + Intronic
982027870 4:151269942-151269964 GTCCCACTGGAAGGTGTTCAGGG + Intronic
982096419 4:151927399-151927421 GTGCACTTGGAGGAAGTTGAAGG + Intergenic
983282083 4:165693765-165693787 GTCCCATTGGAAGGTCTTTAGGG - Intergenic
987480261 5:18446973-18446995 GTCCCATTGGAAGATCTTCAAGG + Intergenic
987619737 5:20325500-20325522 GTCACAGTGGATGAAGTTGGAGG - Intronic
988831458 5:34991231-34991253 GTCCCATTGGAAGATCTTCAAGG - Intergenic
989276889 5:39599389-39599411 GTCCCAATGAGAGAAGTTGCTGG + Intergenic
989826542 5:45863536-45863558 TTCTGATTGGAAGAAATTGATGG + Intergenic
992270150 5:75054771-75054793 GTCCCATGGGGAGAAAATGAAGG - Intergenic
992416754 5:76559307-76559329 TTCCCATTGTGAGATGTTGAGGG - Intronic
993036625 5:82765889-82765911 GTCCCATTGGGAGCAGTTTAGGG - Intergenic
994128330 5:96195098-96195120 GACCTATTTGAAGAAGTTGCTGG + Intergenic
994252798 5:97556411-97556433 GTACCATTGAAAAAAGGTGAGGG - Intergenic
994488991 5:100417478-100417500 GTCACTTTGGAACAAGTGGAGGG - Intergenic
995900250 5:117057268-117057290 GTCCCACTGGAAGATTTTCAGGG - Intergenic
999385890 5:151154195-151154217 GGCCCACTGGTAGAAGTTGGGGG + Intronic
1000437931 5:161236154-161236176 TTCCCATTGTAAGTAGGTGATGG - Intergenic
1001572898 5:172742195-172742217 GCCCCACTGGAAGAAGTAGGGGG - Intergenic
1001744012 5:174076255-174076277 CTCCCAGTGAAAGAAGTTAAGGG - Intronic
1001791571 5:174461972-174461994 CTCCTCTTGGAAGAACTTGAGGG + Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1004948862 6:20645921-20645943 GTCCCACTGGAAGATCTTCAGGG + Intronic
1005164851 6:22907958-22907980 GCCTCAGTGGAAGACGTTGATGG - Intergenic
1006243849 6:32712278-32712300 GTCCCATTGGAAGGCCTTTAGGG + Intergenic
1008772070 6:54991624-54991646 GTCCCATTGGAAGGTCTTCAGGG - Intergenic
1010026996 6:71230406-71230428 GTCCCACTGGAAGATCTTCAGGG - Intergenic
1012829227 6:104185541-104185563 GACCCTTTGAAAGAAGTAGAAGG + Intergenic
1013759828 6:113504928-113504950 GTCCCATTGGAAGGTCTTCAGGG + Intergenic
1014473244 6:121841522-121841544 GTGGGATTGGAGGAAGTTGAAGG + Intergenic
1014501932 6:122202447-122202469 GTCCCATTGGAAAATCTTCAGGG + Intergenic
1017186795 6:151609624-151609646 GTCCCACTGGAAGAAAATTAGGG + Intronic
1017460011 6:154640286-154640308 GTCCCACTGGAAGATCTTCAGGG - Intergenic
1017655884 6:156629265-156629287 GTCCCACTGGAAGGTGTTTAGGG - Intergenic
1018061874 6:160096508-160096530 GTCACAGTGGAAGAAGATGGTGG - Exonic
1018631115 6:165823376-165823398 GTCCCATTGGAAGGTCTTCAGGG + Intronic
1020505796 7:8986417-8986439 GTCCCACTGGAAGATCTTCAGGG + Intergenic
1023659086 7:42454875-42454897 GTCTCAGTGGAAGGAGTTAAAGG + Intergenic
1024131344 7:46355595-46355617 CTGCCATTGCAAGAAGATGACGG - Intergenic
1028977248 7:96927641-96927663 GTCCCACTGGAAGGAATTCAGGG - Intergenic
1029924539 7:104301891-104301913 AACCCATTGGAAGAGGTTTAAGG + Intergenic
1032532160 7:132630957-132630979 GTGTCATGGGAAGAAGTTGAAGG - Intronic
1032627149 7:133604124-133604146 GTCCCACTGGAAGATCTTCAGGG + Intronic
1032662282 7:133998105-133998127 GTCACATTTGAAAAAGTAGAGGG + Intronic
1032867801 7:135945590-135945612 GTCCCATTGGAAGATTTTCAGGG + Intronic
1034776137 7:153828391-153828413 GTAGCATTGGCAGAAGCTGAGGG + Intergenic
1036241095 8:7081737-7081759 GTCCCCTTTGAGGAAGTTGAAGG - Intergenic
1037090119 8:14904221-14904243 TTCCCAAAGGAAGAAGTTCAGGG - Intronic
1038961891 8:32529740-32529762 GTCCCATTGGAAAAAGTCCAGGG + Intronic
1039143724 8:34421785-34421807 GAGCCATTGGAAGAAGAAGAGGG + Intergenic
1040455868 8:47596953-47596975 GTCCCACTGGAATGTGTTGAGGG + Intronic
1040595045 8:48829285-48829307 ATCCTAAAGGAAGAAGTTGAGGG - Intergenic
1040759502 8:50821870-50821892 GTCCCAGTGGAAGATTTTCAGGG + Intergenic
1041134294 8:54740275-54740297 GACCCATTGGAAGATATTCAGGG - Intergenic
1043061484 8:75510056-75510078 GTCCCATTGGAAGGTTTTCAGGG - Intronic
1043307220 8:78810199-78810221 GTCCCACTGGAAGGTGTTCAGGG + Intergenic
1045747059 8:105435133-105435155 GTCCTATAGGAGGAAATTGAAGG - Intronic
1045858154 8:106788295-106788317 GTCCCACTGGAAGGTGTTCAGGG + Intergenic
1046233851 8:111394629-111394651 GTCTCACTGGAAGAACTTCAGGG - Intergenic
1046663107 8:116970252-116970274 GTCCCACTGGAAGGACTTTAGGG + Intronic
1048257072 8:132913149-132913171 GTCCCCTTGGAGGAAGCGGATGG - Exonic
1050973215 9:11904460-11904482 GTCCCAATGGAAGTAGATTAAGG - Intergenic
1051560683 9:18437386-18437408 GTCTCATTGGAAGAAACTGGAGG - Intergenic
1052146546 9:25057441-25057463 GGCCCATAGAAAGGAGTTGAAGG + Intergenic
1055121306 9:72663989-72664011 GTCCCACTGGAAGATCTTCATGG + Intronic
1055287827 9:74748480-74748502 GTCCCACTGGAAGGTGTTCAGGG - Intronic
1056242518 9:84662465-84662487 GTCCCACTGGAAGATCTTCAGGG + Intergenic
1058746527 9:107997104-107997126 TTCGCATTGGAAGAAGGTGGGGG - Intergenic
1186635775 X:11402978-11403000 GTTCCTTTCGAAGAAGATGAAGG - Intronic
1186934553 X:14433652-14433674 GTTCCATTGGATTAAGGTGATGG + Intergenic
1187341876 X:18427964-18427986 CTCCCATTGAAAGAAATTGCAGG + Intronic
1188328308 X:28835236-28835258 GGCCCAAGGGAAGTAGTTGAGGG - Intronic
1189428548 X:40926295-40926317 GTCCCACTGGAAGATCTTCAAGG - Intergenic
1189765450 X:44367738-44367760 GTCCCACTGGAAGATCTTCAGGG - Intergenic
1190427020 X:50343138-50343160 GTCCCATTGGAAGTTCTTCAGGG - Intronic
1190476204 X:50830241-50830263 TTACCAGTGGAAGAGGTTGAAGG + Intergenic
1191056567 X:56247711-56247733 GTCCCACTGGAAGATCTTCAGGG + Intronic
1193237642 X:79128843-79128865 GTCCCACTGGAAGATCTTTAGGG - Intergenic
1196839138 X:119842088-119842110 GTTCAACTGGAAGAAGTTGGGGG + Intronic
1196960740 X:120997950-120997972 GTCCCATTGGAAGGTCTTCAGGG + Intergenic
1197193773 X:123678006-123678028 GTCCCACTAGAAGATGTTTAGGG + Intronic
1199573965 X:149295100-149295122 GTCTCATTGGAAGAAAATGTTGG - Intergenic
1199989051 X:152974232-152974254 TTCCCATTGTAACAAGATGAAGG - Intergenic