ID: 906245566

View in Genome Browser
Species Human (GRCh38)
Location 1:44271081-44271103
Sequence TTGTGTGCATGAAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 355}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906245566_906245571 -6 Left 906245566 1:44271081-44271103 CCCTCTTCCCTTCATGCACACAA 0: 1
1: 0
2: 2
3: 37
4: 355
Right 906245571 1:44271098-44271120 ACACAAACGTGGCAGTTTTCTGG 0: 1
1: 0
2: 0
3: 14
4: 153
906245566_906245574 27 Left 906245566 1:44271081-44271103 CCCTCTTCCCTTCATGCACACAA 0: 1
1: 0
2: 2
3: 37
4: 355
Right 906245574 1:44271131-44271153 CCACTCTTAGAAGGCAGCTTAGG 0: 1
1: 0
2: 1
3: 21
4: 146
906245566_906245572 18 Left 906245566 1:44271081-44271103 CCCTCTTCCCTTCATGCACACAA 0: 1
1: 0
2: 2
3: 37
4: 355
Right 906245572 1:44271122-44271144 GCTACTGTACCACTCTTAGAAGG 0: 1
1: 0
2: 0
3: 1
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906245566 Original CRISPR TTGTGTGCATGAAGGGAAGA GGG (reversed) Intronic
900535880 1:3177114-3177136 ATGGGTGAATGAATGGAAGATGG - Intronic
901774664 1:11552070-11552092 TGTAGTGAATGAAGGGAAGATGG + Intergenic
901922188 1:12545268-12545290 TTGAATGAATGAAGGGAGGAAGG - Intergenic
902209345 1:14893535-14893557 GGGTGTGGAGGAAGGGAAGATGG - Intronic
902589407 1:17462771-17462793 TTGAACGCATGAAAGGAAGAAGG + Intergenic
902828345 1:18992966-18992988 GGGTGGGCATGAATGGAAGAGGG - Intergenic
903282325 1:22257139-22257161 TTGTGATCCTGCAGGGAAGAAGG - Intergenic
904745209 1:32706482-32706504 TTGAATGAATGAAGGGAAGGAGG + Intergenic
904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG + Intergenic
905446460 1:38031022-38031044 TTGTGTGCATCTTGGGAAGGAGG + Intergenic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
907074303 1:51564786-51564808 TTGAGTGGAACAAGGGAAGATGG - Intergenic
907142144 1:52197227-52197249 TTGTGAGCATTATGGGGAGAGGG + Intronic
907509186 1:54945770-54945792 TTCTGTGCAAGCAGGAAAGAGGG + Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908520764 1:64939384-64939406 TTGTGTGAATGTATGGAAGTTGG - Intronic
908997993 1:70181765-70181787 TTGAGTGAATGAAGAGTAGAGGG - Intronic
910781889 1:90947017-90947039 CTGTGTGGATGAAGGCAAGGAGG + Intronic
911141125 1:94503677-94503699 CTGTTTGCATGAAGTGAGGAAGG - Intronic
911244472 1:95501376-95501398 TTGTGTGCAGGCAGGGAATGGGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912938957 1:114028227-114028249 TTGTGATTAGGAAGGGAAGAAGG - Intergenic
913085340 1:115431796-115431818 TTCTGTGCCTGAAGGGAGAAGGG + Intergenic
913563478 1:120047124-120047146 TGCTGTGCTTGAAGGAAAGAGGG - Intronic
913634645 1:120746453-120746475 TGCTGTGCTTGAAGGAAAGAGGG + Intergenic
914284072 1:146206488-146206510 TGCTGTGCTTGAAGGAAAGAGGG - Intronic
914403969 1:147351370-147351392 ATGTATGCATGAAAGGAAGAGGG - Intergenic
914545103 1:148657227-148657249 TGCTGTGCTTGAAGGAAAGAGGG - Intronic
914621463 1:149413461-149413483 TGCTGTGCTTGAAGGAAAGAGGG + Intergenic
915088208 1:153403255-153403277 TTGTGTGTATGAAGGAAGGAAGG + Intergenic
915096679 1:153467565-153467587 TTGTGCGTATGAAGGAAGGAAGG - Intergenic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915856197 1:159389003-159389025 AGGTGAGCTTGAAGGGAAGATGG + Intergenic
917123792 1:171668007-171668029 TTGTGTTCACGACTGGAAGAAGG + Intergenic
918139103 1:181705231-181705253 ATGTGTGCCTGGAGGGATGAGGG - Intronic
918535082 1:185565031-185565053 TTCTTTGTATGAAGGCAAGAGGG + Intergenic
920674152 1:208027434-208027456 TTATGTGCATGAAGGCAGAATGG - Intronic
920692899 1:208160191-208160213 TTGTACTAATGAAGGGAAGAAGG - Intronic
920795231 1:209130593-209130615 GTGTGTGTATGAAAGGAAAAGGG - Intergenic
921479281 1:215645184-215645206 TTGTGGGCATGAAGGGAGAAAGG + Intronic
921707389 1:218339479-218339501 TCGTGTGCTTGTAGGGAAAAAGG - Intergenic
922117285 1:222626414-222626436 AAGTGTGCATGATGGAAAGAGGG + Intronic
923364401 1:233245487-233245509 ATGTGTGCAAGAAGGGCTGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923421204 1:233817057-233817079 TAGTGTTCATGAAAGGAACATGG + Intergenic
924809560 1:247389175-247389197 TTGTGACCAGGAAGGGAAGAAGG - Intergenic
1062928677 10:1337905-1337927 TAGTGTGCACGAGGTGAAGAAGG - Intronic
1062933935 10:1371818-1371840 TTGTGTGGATGCAGAGAAAAGGG + Intronic
1063383375 10:5600766-5600788 GAATGAGCATGAAGGGAAGACGG + Intergenic
1063775697 10:9261227-9261249 ATGTGGGCATGAAGTGAGGAGGG - Intergenic
1064091729 10:12391125-12391147 TTTTGGCCATGAAGGGTAGAGGG + Intronic
1064778876 10:18810846-18810868 TTGTGTCCATGAGAGGGAGAGGG - Intergenic
1067743498 10:48914716-48914738 CTGGGTCCATGAGGGGAAGAGGG - Intronic
1068045505 10:51881160-51881182 TAGTGCGCATGAAGGGGAGAGGG + Intronic
1068295502 10:55067220-55067242 TTGTGGGGATGAAGGGAGGTTGG - Intronic
1068506231 10:57902973-57902995 TTGTTGGCAGGAAGGTAAGATGG + Intergenic
1069044493 10:63728314-63728336 TTGTAATCATGAAGGGATGATGG - Intergenic
1069551634 10:69368354-69368376 TTGTGTGGATGATCGGGAGATGG + Intronic
1069882455 10:71602259-71602281 TAGTGTTCATGGAGGAAAGATGG + Intronic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1072543030 10:96412914-96412936 TTGTGTCCAGAAGGGGAAGAAGG - Intronic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1073722300 10:106186638-106186660 TTGTGTGTATACAGGGAATATGG + Intergenic
1073793223 10:106960808-106960830 TTCTGTGCAGGAATGGGAGAGGG + Intronic
1074360464 10:112821174-112821196 TTGTTTGGATGAAGGGAAGGAGG - Intergenic
1075879698 10:125840265-125840287 TTGTATGCCTGAAGGGCAGTGGG - Intronic
1075956048 10:126524235-126524257 ATGTGGTCATGAAGGGAGGAAGG - Intronic
1075959233 10:126552987-126553009 TTGTGTTTATGATGGGAAGCAGG - Intronic
1076349044 10:129801991-129802013 TGGTGTGCACGAGGGGAATAGGG + Intergenic
1076726342 10:132415931-132415953 GTGTGAGCATGAATGTAAGAGGG - Intronic
1078316541 11:10298020-10298042 ATGGGAGCAGGAAGGGAAGAAGG + Intergenic
1080053412 11:27880284-27880306 ATGTGTGCATGAGAGAAAGAAGG - Intergenic
1080198756 11:29643774-29643796 TGGTGTGGATGTAGGGAAAAGGG + Intergenic
1080262267 11:30362187-30362209 TTGTGTGAATGAAGGAGAGGTGG - Intergenic
1080738500 11:35041162-35041184 ATGTGTGCTTAAAGGGAAGTGGG + Intergenic
1081234961 11:40636175-40636197 TTGTGTGAATGAAGCCAAGGAGG + Intronic
1083602495 11:63957739-63957761 TTCTGTGAATGGATGGAAGAGGG - Intergenic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1088038877 11:105351884-105351906 TTGTGTATATGAAGGGAGGTAGG - Intergenic
1088824576 11:113483019-113483041 ATGTATGGATGCAGGGAAGAGGG - Intergenic
1090349781 11:126100636-126100658 TTGCATGCAGGAAGAGAAGAAGG - Intergenic
1090449758 11:126796164-126796186 TAGAGGTCATGAAGGGAAGAAGG + Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092855767 12:12672387-12672409 TTGTGTGAATGTAGGGAGGTAGG - Intronic
1093276608 12:17136751-17136773 TAGTGTACAGGAAGGGAAGTGGG - Intergenic
1093318024 12:17675688-17675710 TTGAGTGAATGAGGGGAATATGG + Intergenic
1093682065 12:22014139-22014161 TTCTGTGGGGGAAGGGAAGAGGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1095318901 12:40801483-40801505 TTGTGAGCATAAATTGAAGAAGG + Intronic
1095722151 12:45412559-45412581 ATGAGAGCATGAAGGGAAGAAGG - Intronic
1096796844 12:54083028-54083050 TTGTGTGCGTGTTGGGGAGAGGG + Intergenic
1097130268 12:56806350-56806372 TTCTGGGCATCAAGGGAAGGAGG - Intergenic
1097327763 12:58298114-58298136 TTGTTTGCATGAAGTGAACACGG - Intergenic
1097625421 12:61994243-61994265 TTGTCTGCATGAAGTTATGATGG - Intronic
1098195270 12:67993955-67993977 TTATTTGCATAAAGGGCAGAGGG + Intergenic
1098590698 12:72208175-72208197 GTGTGTGTATAAAGGGCAGAGGG - Intronic
1099096762 12:78383793-78383815 TTGTGAAGATGAATGGAAGAAGG + Intergenic
1099523349 12:83690393-83690415 CTGTGTGCTTGAGGGAAAGATGG - Intergenic
1099917682 12:88915510-88915532 TTGTGTGCATGCACCGTAGATGG + Intergenic
1100223971 12:92537898-92537920 TGCTGTGCATGAAGGGAAGCTGG - Intergenic
1101065439 12:101015833-101015855 TTGTGTGCATGAGGGGATGGGGG + Intronic
1101727042 12:107396291-107396313 TTCAGTGCAGGCAGGGAAGAAGG - Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102499994 12:113345411-113345433 TTGAGTCCATGATGGGAAGTGGG + Intronic
1103052357 12:117791158-117791180 TGGTGGGCATAAAGGAAAGAAGG - Intronic
1104724125 12:131065728-131065750 TTGTGCGCATGAAGGAGAGGGGG + Intronic
1105614470 13:21999785-21999807 CTGGGTGCAGGAAGGCAAGAGGG + Intergenic
1105708303 13:22982233-22982255 TTGTGTGCATGGTGGGCACATGG + Intergenic
1105932158 13:25062739-25062761 GAGAGTGCATGAGGGGAAGAAGG + Intergenic
1107185063 13:37508205-37508227 TTGTGTGGATGTGGTGAAGAGGG + Intergenic
1107385708 13:39906674-39906696 TTGTGTGCATGATGGGTAACGGG - Intergenic
1107389940 13:39953312-39953334 TTGAGTACTTAAAGGGAAGATGG + Intergenic
1109020538 13:57085327-57085349 TTGTGTGTATGAAAGGAAAGAGG + Intergenic
1109567553 13:64137193-64137215 TTGTGTGAATGCAGTGAAAAGGG + Intergenic
1109805090 13:67429263-67429285 TTCAGGCCATGAAGGGAAGAGGG + Intergenic
1109928422 13:69179950-69179972 TTGTCTTTATTAAGGGAAGATGG - Intergenic
1110470009 13:75848891-75848913 TGGTGTGAATGCAGGGAAAAGGG - Intronic
1111896627 13:94150163-94150185 ATTTGTGTAGGAAGGGAAGAGGG - Intronic
1113041055 13:106104232-106104254 TTGCCTGAATGAATGGAAGATGG - Intergenic
1113124275 13:106958997-106959019 TTGTGTTTGGGAAGGGAAGAAGG + Intergenic
1113808894 13:113125740-113125762 TTGAGGGAATGAAGGAAAGATGG - Intronic
1114731773 14:25000590-25000612 TTGGGTGGCTGTAGGGAAGAAGG - Intronic
1114975120 14:28086373-28086395 GTATATGCATAAAGGGAAGAAGG + Intergenic
1115975769 14:38995429-38995451 GGGTGGGCATAAAGGGAAGAGGG - Intergenic
1116621029 14:47203359-47203381 TTGTGGTCCTGAAAGGAAGAAGG + Intronic
1117327168 14:54679987-54680009 GTGTGTGCATCAAGAAAAGATGG + Intronic
1118382843 14:65231598-65231620 TTATGTGCATGAAAAGAAGGAGG + Intergenic
1119378467 14:74213899-74213921 TGGTGTCCATGAAGGGAGGAGGG - Intergenic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1122317107 14:100832489-100832511 CTGTGTTCATTAAGGGAAAAGGG - Intergenic
1122680382 14:103456411-103456433 AAGTGTGAATGAGGGGAAGAGGG - Intronic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1124162850 15:27289667-27289689 TTAAGTGAATGAATGGAAGATGG + Intronic
1124591419 15:31057103-31057125 TTGAGAGCATCCAGGGAAGATGG + Intronic
1125389191 15:39173151-39173173 ATGTGTGCCTGCAGGGAAGGAGG + Intergenic
1125513349 15:40304470-40304492 AGGTGTTCATGGAGGGAAGAAGG - Intronic
1126903531 15:53339430-53339452 TTGTGTGTATGTAGGCATGAAGG + Intergenic
1127464848 15:59234082-59234104 TTCTCTGAATGAAAGGAAGATGG - Intronic
1128094644 15:64944489-64944511 TTCTGGGCATGAAGGGGATATGG - Intronic
1129646020 15:77433863-77433885 TTGTGTACATGATGGAAGGAGGG + Intronic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1132794568 16:1713022-1713044 GTGTGTGGATAAAGGGAAGCCGG + Intronic
1133701186 16:8310636-8310658 GGGGGTGCATGAAGGGCAGAAGG + Intergenic
1133787879 16:8986979-8987001 GGGAGTGCATGAAGGGAAGTAGG - Intergenic
1134063011 16:11210394-11210416 TTGTGGGCACGAGGGGAGGAAGG - Intergenic
1134449117 16:14353103-14353125 TGGTGTGAATGAATGTAAGACGG - Intergenic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1135723839 16:24839236-24839258 TTGTGCCCAGGAAGGGAGGAGGG + Intergenic
1135948627 16:26890319-26890341 TGGTGTGAATGAGGGGAAAAGGG - Intergenic
1137631894 16:49952447-49952469 TTGGGTGCCTGGAGGGGAGAAGG - Intergenic
1137730384 16:50685311-50685333 TTGTGTGCATGAATGAATGGCGG + Intergenic
1138248919 16:55487699-55487721 TTGGGTGGATGAGGGGAGGATGG + Intronic
1140802696 16:78503214-78503236 CTGAGAGCATGATGGGAAGATGG + Intronic
1141854791 16:86673669-86673691 GTGGGTGCATGAAGGGAAGGAGG - Intergenic
1143397127 17:6609733-6609755 ATGTGTGATTGAATGGAAGATGG - Intronic
1143793471 17:9317054-9317076 TTGTGTAGATGAAAGGAATAAGG + Intronic
1143818588 17:9540998-9541020 TTATGGGCATGAAGAGCAGAAGG + Intronic
1144613676 17:16748290-16748312 TTTTTTTCATGAAGGGATGATGG + Intronic
1144899039 17:18567372-18567394 TTTTTTTCATGAAGGGATGATGG - Intergenic
1145133336 17:20378342-20378364 TTTTTTTCATGAAGGGATGATGG + Intergenic
1145830447 17:27911971-27911993 TTGAGTGCATGAGAGGCAGAGGG + Intergenic
1146338285 17:31994712-31994734 TTGTGTGCAGGTAGGTAAAAAGG + Exonic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1146468535 17:33106404-33106426 TGGAGTGCATGAAGGATAGAAGG + Intronic
1149043630 17:52219623-52219645 GTGTGTGGATGAAGACAAGAAGG + Intergenic
1149840907 17:59964419-59964441 GTCTGTGCATGAAGGAAAGTGGG - Intronic
1152556425 17:81055356-81055378 TTGTGGGCATGAATGGGACAGGG + Intronic
1154518709 18:15202485-15202507 TAGTGTGTTTGAAGGGGAGAGGG - Intergenic
1155098041 18:22579117-22579139 TTCTGTGAATGAAGTGAAGAGGG + Intergenic
1156061823 18:33086807-33086829 TGGTGTGTGTGAAGGGGAGAGGG + Intronic
1156107333 18:33679650-33679672 TTGTGTGTATGTGGGAAAGAGGG + Intronic
1156178735 18:34578100-34578122 TGGTGTGGATGCAGTGAAGAGGG - Intronic
1157513184 18:48293257-48293279 TTGTGTGCATGCAGTGAGGAAGG - Intronic
1158981888 18:62770882-62770904 TTTTGTGCATGAAACAAAGATGG + Intronic
1160179715 18:76623756-76623778 CTGTGTGCTTGGAGCGAAGAGGG + Intergenic
1160632368 18:80255524-80255546 TTGTGTGCCTGAAGGGCTGATGG + Intergenic
1160767917 19:816651-816673 TTGGGTGCATGAGTGGATGATGG - Intronic
1161426936 19:4208829-4208851 TAGTGTGGATGCAGGGAGGAGGG - Intronic
1163582468 19:18146749-18146771 TTGTGTGGATGAATGGATGCTGG + Intronic
1168105394 19:54162980-54163002 TTGGGTCCCTGAAGGAAAGATGG - Intronic
925271768 2:2614856-2614878 TTGTGTGCAAGGACAGAAGATGG + Intergenic
925947032 2:8874773-8874795 TTCTGTGCAGGAAGGGGAGGAGG - Intronic
926847670 2:17160050-17160072 TTTGGTCCATAAAGGGAAGATGG - Intergenic
927025782 2:19067681-19067703 TTCTGAGCCTGGAGGGAAGAGGG + Intergenic
927265050 2:21137004-21137026 TTGAGTGCTAGAAGGGCAGATGG - Intronic
928987056 2:37191930-37191952 GTGTCTGCATGAGGGGAACATGG - Intronic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
929299538 2:40287614-40287636 GTGTGTGCATGCAGGGACAAGGG + Intronic
929489230 2:42381806-42381828 TTGGGATCATGAAGGGAAAAAGG + Intronic
929787169 2:45001319-45001341 TGGTGAGCAGGAAGGGAAGAAGG - Intergenic
930241214 2:48937577-48937599 GTGTGTGCTGGAAGGGTAGATGG - Intergenic
931157270 2:59649470-59649492 TTGTGAGCAGGAATGGCAGATGG + Intergenic
932582368 2:73000183-73000205 CTGTTTACATGAAGTGAAGAAGG - Intronic
933059265 2:77716256-77716278 TTGTGAGCATCATGGGAAGAAGG + Intergenic
933529157 2:83484165-83484187 TTGTGTGTAAGAAGTAAAGAAGG - Intergenic
933548453 2:83743424-83743446 TGGAGTGCATGAAGGGACAAAGG - Intergenic
934900268 2:98154420-98154442 ATGTGTGCGCTAAGGGAAGAGGG - Intronic
935723599 2:106001585-106001607 TTTTGTGTATGAAGTGAAGAAGG + Intergenic
936522648 2:113220714-113220736 TTGTGTGCATGGGGGGCTGAGGG + Intronic
936965776 2:118126305-118126327 TTGTGTTCTTGAAGGAAAGCTGG + Intergenic
938308636 2:130270366-130270388 GTGAGTGCATGAAGTGGAGAGGG + Intergenic
938446697 2:131386471-131386493 GTGAGTGCATGAAGTGGAGAGGG - Intergenic
939024301 2:136993846-136993868 GTGTGTGCATGAAAGACAGAAGG + Intronic
940365102 2:152839562-152839584 TTGTGTGGATGTGGGGAAAAGGG - Intergenic
940657985 2:156511822-156511844 TTGGTTTCATGAAGGCAAGATGG + Intronic
941253012 2:163190178-163190200 CTGAGTGCTAGAAGGGAAGAAGG + Intergenic
942046996 2:172105438-172105460 TTGTGTACATGGGGGAAAGAGGG + Intergenic
942485252 2:176432521-176432543 GTGTGTGTATTATGGGAAGAAGG - Intergenic
942499484 2:176574108-176574130 TTCTGCACATGAAGGGACGAAGG + Intergenic
942730977 2:179060544-179060566 TTGGATAGATGAAGGGAAGAGGG - Intergenic
942831400 2:180240546-180240568 TTGAATGAATGAAGGAAAGAAGG - Intergenic
943432104 2:187816966-187816988 GTGTCTGGATGAAGGGAACATGG + Intergenic
943927149 2:193799657-193799679 TTGTGTCTATGCAGGGAGGAGGG - Intergenic
946193420 2:218019674-218019696 TTCTGTTGATGAAAGGAAGAAGG + Intergenic
946850399 2:223900777-223900799 TTGTGTGAAGGAAGGAAAAAAGG - Intronic
1168843931 20:929178-929200 TTCTGGCCATGATGGGAAGAGGG - Intergenic
1168998814 20:2151878-2151900 TTGGGTGCCTGCAGGGTAGAGGG + Intronic
1169087670 20:2837532-2837554 TTGTGTGCATGCAGGGACTAGGG + Intronic
1169898151 20:10526097-10526119 ATGTGCGCATGAAGGAAGGAGGG - Intronic
1170464659 20:16611661-16611683 GAGTGAGCAGGAAGGGAAGATGG + Intergenic
1170701727 20:18709804-18709826 TTCTGGGCATGAAGGTAAGTTGG - Intronic
1172687772 20:36769986-36770008 TGGGGTGCAGGGAGGGAAGAGGG + Intronic
1174601544 20:51728951-51728973 TTATGTGCATGTTGGGGAGAAGG + Intronic
1175473652 20:59253030-59253052 TTGTGGGAAGGAAGAGAAGAAGG + Exonic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176668279 21:9707674-9707696 TTCTGTGCATGGAGGGAAAAAGG + Intergenic
1177198956 21:17932313-17932335 TTGTGAGGATGAAGAGAAAAGGG + Intronic
1179110551 21:38441874-38441896 TGCTGTTCATGAAGGGAACAAGG - Intronic
1179777645 21:43676793-43676815 TTTTGTGCCTGAAGAGACGATGG + Exonic
1181537076 22:23551940-23551962 ATGGGTGGATGAATGGAAGATGG - Intergenic
1181855950 22:25781715-25781737 TTGTCTGCAGGGAGAGAAGAGGG - Exonic
1182623760 22:31631405-31631427 TTGCGTGCCTGGAGGGCAGAAGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1185171284 22:49296068-49296090 TGGTCTGCAAGAAGGCAAGATGG + Intergenic
950876762 3:16282569-16282591 TTGAGAGTATGAAGAGAAGAGGG + Intronic
952094949 3:29939672-29939694 ATCTGTGCAGGAAGAGAAGAAGG - Intronic
953520732 3:43640197-43640219 TTGTGTGCTTTGAGGGAACAGGG + Intronic
954624625 3:52015858-52015880 TCGTGAGCAGGAAGGGAACAGGG + Intergenic
954680958 3:52345709-52345731 TTGTGGGCATCAAGGGCACAGGG + Intronic
956407522 3:68943721-68943743 TTGAGTGCAAGAAGGAAAGAAGG - Intergenic
956763262 3:72462193-72462215 TTGTGTGGATAAAGCGAAGGTGG + Intergenic
958136883 3:89505250-89505272 CTGTTTGAATGAAGGTAAGATGG + Intergenic
958896793 3:99838454-99838476 TTGTGTCCATGTAGAGAAGTGGG + Intronic
959193041 3:103140314-103140336 TTGTGTGTGTGAAGGCAGGAAGG + Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
959886915 3:111513500-111513522 TTGTGTGAATGAAGTGTGGATGG - Intronic
960366836 3:116783105-116783127 TTGGCTGACTGAAGGGAAGAAGG - Intronic
961056655 3:123794389-123794411 TTGGCTGAATGAAGGGAAGGAGG + Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962490752 3:135891794-135891816 TGTGGTGCATGAGGGGAAGATGG - Intergenic
963113370 3:141705140-141705162 TTGTGTGGATGCAGTGAACAGGG + Intergenic
963226862 3:142871305-142871327 TAGGGTGCAAGAATGGAAGAAGG - Intronic
964083099 3:152784524-152784546 TTGTGTGCATGCAGGCAATAGGG - Intergenic
964808036 3:160633024-160633046 TTGGGTGCAGGAAAGGAAGCAGG - Intergenic
965372384 3:167879679-167879701 TTGTGTGCATGAGGGGAGAGAGG - Intergenic
965742124 3:171886520-171886542 ATGTGTGGCAGAAGGGAAGAAGG - Intronic
966585585 3:181620674-181620696 TTGGGAGCATGAGAGGAAGAGGG - Intergenic
967982391 3:195073478-195073500 TTGTGGGCATGAGGGGGGGAGGG - Intronic
968476422 4:811664-811686 ATGTGTGCCTGAAAAGAAGAAGG + Intronic
969566262 4:7980189-7980211 TTCAGGCCATGAAGGGAAGAGGG + Intronic
969892798 4:10275344-10275366 TTGTGAACCTGGAGGGAAGAGGG + Intergenic
970166009 4:13239212-13239234 TGGTGTGCATCAAGAGCAGAAGG - Intergenic
970289013 4:14551513-14551535 TTGTTTGTAGCAAGGGAAGAAGG - Intergenic
970451992 4:16178111-16178133 GGGTGTCCATGAAGGGCAGAGGG - Intronic
970516006 4:16830809-16830831 TTTGGTTCATGAAAGGAAGATGG + Intronic
970535440 4:17025600-17025622 TTGTGTGCATGTAGAGAGAATGG + Intergenic
970961793 4:21879943-21879965 TTCTTTGCATGACGGCAAGAAGG - Intronic
971700362 4:29965430-29965452 TTGTGTGCATATAGGCGAGAAGG - Intergenic
972184948 4:36517452-36517474 TTTTGTGCATTAGGGGAGGAAGG + Intergenic
972248050 4:37267086-37267108 ATGTGGTCATAAAGGGAAGAAGG + Intronic
972256354 4:37359862-37359884 TTTTGTCCATGAAGAGATGAAGG + Intronic
972312808 4:37896445-37896467 TTTTGTTCTTTAAGGGAAGAAGG + Intronic
974011406 4:56610945-56610967 TTGTGTGGATGCAGTGAAAAGGG + Intergenic
975459063 4:74629324-74629346 CTGTGTGCATGAAGGAATGAAGG - Intergenic
976662370 4:87552976-87552998 TTGAGTGCATGAAGGTTGGAAGG - Intergenic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
979663086 4:123281176-123281198 TTTTGTGGATAAAGGGAAAAAGG + Intronic
980082942 4:128363532-128363554 GAGTGTGCAAGAAGAGAAGAAGG + Intergenic
980570859 4:134618292-134618314 TTGTGTGGATAATGGGAATAAGG + Intergenic
981256587 4:142668301-142668323 TTGTTTGCATAAAAGGAAGTTGG - Intronic
981428239 4:144628786-144628808 TTATGTCCCAGAAGGGAAGAAGG + Intergenic
985406502 4:189643817-189643839 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
985640205 5:1060058-1060080 TCATGTGCAGGAAGGGACGAGGG - Intronic
986841926 5:11707331-11707353 CTGTGTGCATGAGAGGAGGATGG - Intronic
987588980 5:19897935-19897957 TTATCTGGATGAAGGGAACATGG + Intronic
988185901 5:27861612-27861634 GTGTGTGCATGAAGGGAAGGGGG - Intergenic
988414264 5:30926213-30926235 TTGTGAGGAAGTAGGGAAGAGGG - Intergenic
990130490 5:52576295-52576317 TTGTGTGGATGAAGAGAAAGTGG - Intergenic
990320473 5:54625145-54625167 TAGTGTGTATGAGGGGAAGGGGG + Intergenic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
992252398 5:74888446-74888468 TAGTGAGCAGGAAGGGAAGGAGG - Intergenic
992355318 5:75976117-75976139 TTGTATGCAAGAAAGGAAAATGG + Intergenic
992519450 5:77535263-77535285 TTCTGTGCAGAAGGGGAAGATGG - Intronic
992625015 5:78628787-78628809 TTGTGGCCATAAAGGGAAGAAGG + Intronic
995697569 5:114897722-114897744 TTCTGTGCCTGAAAGAAAGAGGG - Intergenic
996566218 5:124881891-124881913 TTGTGTGGCTGCAGGAAAGAGGG - Intergenic
996772687 5:127101620-127101642 TAGTGTACATGAAGGGGAGTGGG - Intergenic
997013738 5:129906027-129906049 TGGTCTTCAGGAAGGGAAGACGG + Intronic
997574457 5:134963314-134963336 TGGTGTGCAGGGAGAGAAGAGGG + Intronic
998773705 5:145574524-145574546 TTGTCAGCATGAAGAGAAGGTGG + Intronic
998844942 5:146299431-146299453 TGGTGTGGATGTAGGGAAAAGGG - Intronic
999550622 5:152683360-152683382 TGGTGTGGAAGAAGGGAACAGGG + Intergenic
999665202 5:153905573-153905595 TTGTTTCCCTGAAGGGAAGAAGG + Intergenic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000867388 5:166531801-166531823 TTGAGAGAAGGAAGGGAAGAAGG - Intergenic
1001876925 5:175209774-175209796 TGTTGTGCATGAGGAGAAGATGG - Intergenic
1002135559 5:177105583-177105605 TTTGCTGAATGAAGGGAAGAAGG + Intergenic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1003238372 6:4318907-4318929 TTGTCTCCCAGAAGGGAAGAAGG - Intergenic
1004075183 6:12338619-12338641 CTGTGTGCATGAAGGCATGTTGG - Intergenic
1004779870 6:18896369-18896391 TTTTTTGCATGAAGGGGACAGGG - Intergenic
1004882863 6:20025858-20025880 TTGTGAGCATGAAGAAATGAAGG - Intergenic
1005990588 6:30899465-30899487 GTGTGTCCAGGAAGGGGAGAAGG - Intronic
1007426186 6:41747673-41747695 ATGTGTGCATTTAGGGACGAGGG + Intronic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1010401104 6:75447181-75447203 TTGAGTGCAAGTAGGGAAAAAGG + Intronic
1010624749 6:78123807-78123829 TTGTGTATATGAATGGAAGAAGG - Intergenic
1010917405 6:81637234-81637256 TTGTGTCCCTAAAGGGCAGAGGG + Intronic
1011383687 6:86770297-86770319 TTTTTATCATGAAGGGAAGATGG - Intergenic
1011524736 6:88252281-88252303 TTGGGTGAATGGATGGAAGAAGG + Intergenic
1011889000 6:92133288-92133310 TTGTTTGCATATAGAGAAGATGG - Intergenic
1012033096 6:94098246-94098268 TTGTGTGCCTGCAGGAGAGAGGG - Intergenic
1012405792 6:98896271-98896293 GTGTGTGTATCAAAGGAAGAAGG + Intronic
1012815255 6:104016074-104016096 CTCTGTGCATGAAGGGAATATGG - Intergenic
1012841039 6:104329407-104329429 TTCTGACCATGAAGGGAAAAAGG - Intergenic
1013195239 6:107838867-107838889 TTGGGAGGATGAAGGGAAGAAGG + Intergenic
1013701204 6:112771747-112771769 TTTTGTGCATGAAGCAAAGATGG + Intergenic
1015419904 6:132995515-132995537 TTGTGTGCATTTAAGGAAGACGG + Intergenic
1017865738 6:158441760-158441782 GTGTGTGTGGGAAGGGAAGATGG - Intronic
1019537445 7:1536732-1536754 TTCTGTGCATGGTGGGGAGAGGG + Intronic
1020388067 7:7629541-7629563 TTGGCTGGATGATGGGAAGAGGG + Intergenic
1021435563 7:20610568-20610590 TTGTGTGCATGTGGGGAAAGGGG + Intergenic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024224475 7:47315168-47315190 TTGTGGGAATTAAGGGCAGAAGG - Intronic
1024349495 7:48349334-48349356 TTGAGGGGATGAAGGGCAGAAGG + Intronic
1024402375 7:48939765-48939787 TTGTGTGCATGAAGTTCACATGG + Intergenic
1024777758 7:52807790-52807812 TTTTGTGCATGAAAAGAACAAGG + Intergenic
1026645964 7:72169124-72169146 ATGTGTAAATGTAGGGAAGAAGG - Intronic
1027345247 7:77252981-77253003 GTGTGTCCAGGAAGGGAAAATGG + Intronic
1027425196 7:78054983-78055005 TTGTGTGAATGAATGAAATAAGG - Intronic
1027560653 7:79724820-79724842 TTGTGTACATGTAAGGTAGAGGG - Intergenic
1032502013 7:132406793-132406815 CTCTGTGAATGAAGGTAAGAAGG + Intronic
1032549062 7:132767351-132767373 TTGTGTGCATGAGAGGCATAGGG - Intergenic
1034735662 7:153427103-153427125 TTGTGTGGATGAGGCGAAGGAGG - Intergenic
1036563455 8:9917731-9917753 TTCAGTGCTTGAAGGGAGGATGG + Intergenic
1036636652 8:10555211-10555233 TTCGGGGCATGATGGGAAGAGGG + Intergenic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037885976 8:22596604-22596626 CTCAGTGCAGGAAGGGAAGAGGG - Intronic
1038040327 8:23718666-23718688 TGGAGTGAATGAGGGGAAGAGGG + Intergenic
1038452801 8:27650730-27650752 TTGTTGGCATGGAGGAAAGAGGG - Intronic
1038747030 8:30263499-30263521 ATGTGTGCCTGAGAGGAAGAGGG - Intergenic
1038922595 8:32101336-32101358 TTGTGTGCATGCAAGGCATAAGG - Intronic
1039010805 8:33090751-33090773 GTGTGGGCATGAAGGGATAAGGG + Intergenic
1039590144 8:38739335-38739357 TTGAGTGGATGAATGGCAGATGG - Intronic
1040975692 8:53191921-53191943 ATGTGTGCATGAGGGGGAGATGG - Intergenic
1043043355 8:75290049-75290071 TAGGGTGCATGTAGGGCAGAGGG + Intergenic
1043487724 8:80714897-80714919 TTGTATGCATGGAGGCAAAATGG - Intronic
1044200647 8:89431647-89431669 TTATGTGTTTGAAGGGAAAAGGG + Intergenic
1044396580 8:91720451-91720473 TTCAGTCCATGATGGGAAGAGGG - Intergenic
1045261332 8:100577630-100577652 TTGAATGCATGAAGGGATGTTGG + Intronic
1046578655 8:116064364-116064386 TTGTTTGGAGTAAGGGAAGAAGG + Intergenic
1047878840 8:129170312-129170334 TTATGTGAATGAATTGAAGATGG - Intergenic
1050585552 9:7108062-7108084 TTGTGTGCATAATGGAAAGCAGG + Intergenic
1050871283 9:10573478-10573500 TTGTATGGAGGAAGGCAAGATGG + Intronic
1052423692 9:28276238-28276260 CTGTGTACATGAAGAGAGGATGG - Intronic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1054847482 9:69811918-69811940 TAGTGACCATGAAGGGATGAAGG - Intergenic
1055123626 9:72692485-72692507 TTATGTCCATGGAGGGAAGGCGG + Intronic
1055227097 9:74012311-74012333 TTGAGTTCATGAAGAGAAGTAGG + Intergenic
1056521578 9:87406916-87406938 TTCTGTTCATGATGGGAAGAGGG + Intergenic
1057181132 9:93031081-93031103 ATGGGTGGATGAAGGGATGATGG + Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1061244707 9:129395492-129395514 ATGGGTGAATGAATGGAAGATGG + Intergenic
1061497921 9:130986271-130986293 TTTTGAGCATGAAAGGAATAAGG + Intergenic
1061765775 9:132880297-132880319 TAGTGTGGATGAAGGGCACAGGG - Intronic
1203657587 Un_KI270753v1:13281-13303 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
1187508111 X:19893557-19893579 TGGTGTGCATGAAGCAAAGGAGG - Intergenic
1191662195 X:63663540-63663562 TTGTGTGCCTGAGGTGAACAAGG + Intronic
1192863596 X:75106841-75106863 TGGTGTCCTTGAAGGGAAGGGGG - Intronic
1194858372 X:98962501-98962523 GTGTGTGCATCATGGGATGATGG + Intergenic
1194995344 X:100586149-100586171 TTGTGAGCATGAAGGGACTATGG - Intronic
1195246957 X:103003579-103003601 TCTTTTGCATGAGGGGAAGAGGG - Intergenic
1195614144 X:106899722-106899744 CTGTGTGCATGTGGGGAGGAGGG - Intronic
1196830093 X:119768979-119769001 TTGTCAGAATGAAGGGAAGGAGG - Intergenic
1197078377 X:122379979-122380001 TGGTGAGAATGCAGGGAAGAGGG - Intergenic
1197150304 X:123213420-123213442 TTGTACAGATGAAGGGAAGAAGG + Intronic
1198620221 X:138499644-138499666 TTTTGTGCATGAAAGGGACATGG + Intergenic
1199979505 X:152913245-152913267 TTGTGGGCATGACAGGAAGCAGG - Intergenic
1201850760 Y:18477232-18477254 TTTTGTGGGTGAAGGGAAGGTGG + Intergenic
1201882558 Y:18843145-18843167 TTTTGTGGGTGAAGGGAAGGTGG - Intergenic