ID: 906246628

View in Genome Browser
Species Human (GRCh38)
Location 1:44280365-44280387
Sequence CAGTGGAAATGTAGAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 759
Summary {0: 1, 1: 2, 2: 7, 3: 69, 4: 680}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906246628_906246631 16 Left 906246628 1:44280365-44280387 CCCATTTCTCTACATTTCCACTG 0: 1
1: 2
2: 7
3: 69
4: 680
Right 906246631 1:44280404-44280426 AGTAATTACCATCTTTCACCTGG 0: 1
1: 0
2: 0
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906246628 Original CRISPR CAGTGGAAATGTAGAGAAAT GGG (reversed) Intronic
900015739 1:147921-147943 CAGTGAAGATGTGGAGGAATTGG + Intergenic
900046002 1:506519-506541 CAGTGAAGATGTGGAGGAATTGG + Intergenic
900068204 1:748230-748252 CAGTGAAGATGTGGAGGAATTGG + Intergenic
900989987 1:6094133-6094155 CTATGGAAATGTTGAAAAATGGG - Intronic
901712969 1:11130168-11130190 AAGTGGAAGTGGAGAGAAAAAGG + Intronic
902098514 1:13966134-13966156 CAGAGGAAGGGGAGAGAAATAGG - Intergenic
902491379 1:16784065-16784087 CAGTGGAAGTTAATAGAAATAGG - Intronic
902946081 1:19840356-19840378 TGGGGGAAATGTGGAGAAATTGG + Intergenic
902949813 1:19873570-19873592 CACTGGAAATGCAGAGGAAGAGG + Intergenic
902997801 1:20240487-20240509 GAGTGGATATGGAGAGAATTGGG + Intergenic
905129753 1:35745152-35745174 TAGTGAGAATGTGGAGAAATTGG - Intronic
905747040 1:40426979-40427001 CAGTTGTAAAGTAGAGAAACAGG + Intergenic
905972124 1:42150180-42150202 CAGTGGAGATGATGAGAAACGGG + Intergenic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906492021 1:46276097-46276119 AAGTGGAAATGTAGATTAAGTGG - Intronic
907048887 1:51316530-51316552 CAGTGGCAGTGTGGAGAAAGTGG - Intronic
907178402 1:52547385-52547407 TAGTGAGGATGTAGAGAAATTGG + Intronic
907209695 1:52809651-52809673 CGGTGAGAATGTGGAGAAATCGG - Intronic
907507558 1:54931516-54931538 CAATGGAAATGTTGAAGAATAGG + Intergenic
907853767 1:58281428-58281450 TAGTGGAGATGGAGAGATATAGG - Intronic
907931411 1:59004425-59004447 TAATGAAGATGTAGAGAAATTGG + Intergenic
908037068 1:60067297-60067319 TGGTGAAGATGTAGAGAAATAGG - Intronic
908346052 1:63234217-63234239 TGGTGAGAATGTAGAGAAATTGG - Intergenic
908471155 1:64445212-64445234 CAGTGGGTTTGTAGAGACATGGG - Intergenic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909441831 1:75704547-75704569 AAGAGGAAATGTAATGAAATAGG - Intergenic
909709413 1:78629191-78629213 AAGTGGAAATGAAGTCAAATTGG - Intronic
909997095 1:82294212-82294234 CAGTGGCAATCTAGAGACTTTGG + Intergenic
910520083 1:88110891-88110913 CAGTGGAAATGGACAGGAAGTGG - Intergenic
910570693 1:88699217-88699239 CAGAGAAAATTTAAAGAAATAGG - Intronic
910843054 1:91579137-91579159 CAGTGAAAACCCAGAGAAATGGG + Intergenic
911294212 1:96094124-96094146 CAGTGGAAAGGGAGAGGTATTGG + Intergenic
911855033 1:102865749-102865771 CAGTGGTAATGAAGATAAAGAGG + Intergenic
911922489 1:103783285-103783307 CATTGGAATTGTATAAAAATTGG - Intergenic
911981054 1:104567194-104567216 CAATGGAAAATTAAAGAAATAGG + Intergenic
912346154 1:108965137-108965159 CAGTGGAGATGTGGGGAAATTGG - Intergenic
912700039 1:111871047-111871069 CAATTGAAATGTGGAGGAATGGG + Intronic
912718174 1:111997133-111997155 AGGAGGAAATGGAGAGAAATGGG - Intergenic
913174090 1:116257942-116257964 CAGTGAGGATGTGGAGAAATTGG + Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913313680 1:117531496-117531518 TAGTGGAGATGTGGAGAAACTGG - Intergenic
913495695 1:119426309-119426331 CAATGGAAATGCTGAGATATGGG + Intergenic
913991702 1:143619060-143619082 GTGTGGGAATGTAGAGCAATGGG - Intergenic
914094003 1:144529368-144529390 CAATGGAAATGTTGAGACTTAGG + Intergenic
914199573 1:145472864-145472886 CAATGGAAATGTTGGGACATAGG + Intergenic
914312150 1:146476229-146476251 CAATGGAAATGTTGGGACATAGG + Intergenic
914478688 1:148045997-148046019 CAATGGAAATGTTGGGACATAGG + Intergenic
914515122 1:148367839-148367861 CAATGGAAATGTTGGGACATAGG + Intergenic
915408069 1:155676956-155676978 AAGAGGAATTGTAGAGGAATGGG - Intronic
915688050 1:157656167-157656189 CAGCAGAAAAGGAGAGAAATTGG + Intergenic
916306687 1:163343306-163343328 AAGAAGAAATGTAGAGAAAATGG + Intronic
916635822 1:166667487-166667509 CAGAGAGGATGTAGAGAAATAGG + Intergenic
916678558 1:167084304-167084326 CAGAGGAAATGGAGAAAAACGGG + Intronic
916808808 1:168286861-168286883 TGGTGAAGATGTAGAGAAATTGG - Intronic
917084422 1:171291732-171291754 CAATGGAAATGTTGAAATATGGG + Intergenic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917356930 1:174135438-174135460 GAATGGAAATGAAGAGAAAAGGG - Intergenic
917866373 1:179199506-179199528 CTGTGAAGATGTAGAGAGATTGG - Intronic
917873667 1:179265662-179265684 TGGTGAAGATGTAGAGAAATTGG - Intergenic
918297134 1:183167562-183167584 TAGTCCAAATGAAGAGAAATAGG + Intergenic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918706729 1:187672284-187672306 CAGCAGAAATGTAGAAAATTGGG + Intergenic
918743527 1:188168314-188168336 GAGTGGAAAAGTAGAGAAGAAGG + Intergenic
919072247 1:192771116-192771138 CTGTGAAAATGTAGAGAACTGGG + Intergenic
919186354 1:194156526-194156548 TAGTGAGAATGTGGAGAAATTGG - Intergenic
919598887 1:199599001-199599023 CAGGGGAGACGAAGAGAAATTGG + Intergenic
919697208 1:200589841-200589863 CAGGGGCAATGTAGGGAAACCGG - Intronic
919855260 1:201701738-201701760 CAGTGAAGATATGGAGAAATTGG + Intronic
920231764 1:204475426-204475448 CAGTGGAAATGATGGGAATTTGG - Intronic
920945499 1:210524695-210524717 AGGTGGGAATCTAGAGAAATTGG + Intronic
921363050 1:214347892-214347914 CAATGAAAATGGAGATAAATCGG - Intergenic
921436024 1:215123094-215123116 CTGGGGAAATGTTCAGAAATAGG + Intronic
922061490 1:222096862-222096884 CAGTGGTAATGCAGAGACAGAGG - Intergenic
922103568 1:222493617-222493639 CAGTGAAGATGTGGAGGAATTGG + Intergenic
922263882 1:223966132-223966154 CAGTGAAGATGTGGAGGAATTGG + Intergenic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
923230481 1:231981929-231981951 CAGTTGGTATGTAGAGAAGTGGG + Intronic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923529064 1:234798478-234798500 CAGTGGAAGTTAATAGAAATAGG + Intergenic
924121923 1:240808984-240809006 CAGTGGAAACCCAGTGAAATAGG - Intronic
924345729 1:243071128-243071150 CAGTGAAGATGTGGAGGAATTGG + Intergenic
924484744 1:244470521-244470543 TCGTGGGGATGTAGAGAAATGGG + Intronic
924678408 1:246204410-246204432 CACTGGAAATATAGAGACACAGG - Intronic
1062955437 10:1537320-1537342 CAGTGAGGATGTGGAGAAATTGG + Intronic
1064135171 10:12744459-12744481 CAATGAGAATGTAGAGAAAGTGG - Intronic
1064284118 10:13977660-13977682 TAGGGGGAATGAAGAGAAATGGG - Intronic
1064511636 10:16100388-16100410 CAGTGTGAATGTTGAGAAGTGGG + Intergenic
1064730798 10:18328843-18328865 CACTGGATATGTAGAGAATAAGG + Intronic
1064806825 10:19144411-19144433 CAGTTTGCATGTAGAGAAATCGG + Intronic
1065457362 10:25921085-25921107 TGGTGAAAATGTAGAGCAATTGG + Intergenic
1065506346 10:26433707-26433729 CAGCGGAAATGCGAAGAAATGGG - Intergenic
1065592739 10:27282347-27282369 CAGTTGAAATGTAGACATTTTGG + Intergenic
1065645294 10:27827630-27827652 CCCTGGAGATGAAGAGAAATGGG - Intronic
1065657626 10:27967937-27967959 CAGTTGAAATGTAGACATTTTGG - Intronic
1065675961 10:28174702-28174724 GAATGGAAATGTTGGGAAATAGG - Intronic
1065762552 10:28995774-28995796 CTGTGGAAAGGTAGAGAAGTGGG - Intergenic
1066036102 10:31486358-31486380 CTGTGGCCATGTAGAGAAAGTGG - Intronic
1066094820 10:32062039-32062061 CAGTTGAAATGACCAGAAATGGG + Intergenic
1066730611 10:38433687-38433709 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1067938129 10:50628431-50628453 CAGTGGGAATCTGGGGAAATAGG - Intergenic
1068249347 10:54416758-54416780 CTGTGAGACTGTAGAGAAATAGG - Intronic
1068379607 10:56234037-56234059 TAGTGGAAATGGAGATAACTGGG - Intergenic
1068493380 10:57753215-57753237 TGGTGAGAATGTAGAGAAATTGG + Intergenic
1068546053 10:58346793-58346815 CAGTGTATAGGTAGAAAAATAGG + Intronic
1068624915 10:59233044-59233066 GAGAGGAAATGTGGAGAAATGGG + Intronic
1069222256 10:65898948-65898970 CAGTGGAAAAGGTCAGAAATTGG + Intergenic
1069508376 10:69021800-69021822 TAGTGGAAATGTAAAAAAAATGG + Intergenic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070023408 10:72608603-72608625 CAGAGAAAATGTGGAGAAATTGG + Intronic
1070459796 10:76653229-76653251 CAGTGATGATGTGGAGAAATTGG - Intergenic
1071250625 10:83815413-83815435 CAGGGGACAGGTAAAGAAATTGG - Intergenic
1071818464 10:89255580-89255602 CAGTGAAAGTGGAGAAAAATAGG + Intronic
1071996972 10:91159035-91159057 AGCAGGAAATGTAGAGAAATTGG + Intergenic
1072339429 10:94432295-94432317 CAGTGAAAAGGTACATAAATAGG - Intronic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1073823747 10:107295711-107295733 CAGTGAACATGTAGAGAAAAAGG + Intergenic
1074185167 10:111094732-111094754 CAATGGAATTGTTGAGAAAGAGG + Intergenic
1074396916 10:113105558-113105580 GAGTGAAAAAGGAGAGAAATGGG - Intronic
1074426538 10:113356452-113356474 CAATGGAAATGTAGACAGATGGG - Intergenic
1074454246 10:113583523-113583545 ATGTGCAAATGTAGATAAATGGG + Intronic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1075295614 10:121272383-121272405 GAGTGGCAACTTAGAGAAATGGG + Intergenic
1076101846 10:127787859-127787881 CACTAGACATGTAAAGAAATAGG - Intergenic
1076972330 11:142991-143013 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1077826536 11:5815584-5815606 CAGTGAGAATGTAGAGAAATTGG + Intronic
1078150390 11:8754428-8754450 TAGTGAGACTGTAGAGAAATTGG + Intronic
1078286000 11:9956755-9956777 TAGCGGAAATGTAGAGATAAAGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078643385 11:13116293-13116315 CAGCGGGAATGAAGATAAATGGG - Intergenic
1079196733 11:18334578-18334600 GAGAAGAATTGTAGAGAAATTGG - Intronic
1079578538 11:22033056-22033078 GAGTGGAAATTTATAGAAAGGGG - Intergenic
1079582320 11:22080913-22080935 CAGTGGCAATGTAGTTAAAGAGG - Intergenic
1079688250 11:23389344-23389366 CAGTGAAAATGTGGAGCAATAGG - Intergenic
1079869145 11:25774280-25774302 CGGTGAGGATGTAGAGAAATTGG - Intergenic
1080154399 11:29091862-29091884 AAGTGAAAATGTATTGAAATAGG + Intergenic
1080310933 11:30891075-30891097 ACTTGGGAATGTAGAGAAATGGG - Intronic
1081020523 11:37942108-37942130 AAGAAGAAATGTAGACAAATGGG - Intergenic
1081394507 11:42569703-42569725 CAGAGTAAATGAAGGGAAATTGG - Intergenic
1081516360 11:43834340-43834362 AAGTGGAAATGTGAAGAATTGGG + Intronic
1082108614 11:48247248-48247270 CAGGGGAAGTGTGGAGAAGTAGG - Intergenic
1082263100 11:50092397-50092419 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1082575431 11:54797899-54797921 CATTGGAAATGTACAGTATTAGG - Intergenic
1082653847 11:55828016-55828038 CAGTGGAGATGTTGACAAAGTGG + Exonic
1082704812 11:56480312-56480334 CAGTGGCTATGTAGACAAAAAGG + Intergenic
1083069764 11:59965390-59965412 CAGTGGAAAAATATACAAATAGG + Intergenic
1083341094 11:61958929-61958951 CAGGGGGAATTTAGAGGAATAGG - Intronic
1084075153 11:66769355-66769377 GAAAGGAAAAGTAGAGAAATTGG + Intronic
1084998997 11:73011736-73011758 CAGTGGGAATGTGGACCAATGGG + Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1087248327 11:95867313-95867335 ATGTAGAAATGTAGAGAAAAAGG - Intronic
1088197243 11:107288282-107288304 GAGTGGAAATGTGAAGAAAATGG - Intergenic
1088291231 11:108239773-108239795 TAGTGAGAATGTAGAGAAACTGG - Intronic
1088937244 11:114415134-114415156 CAAGGCAAATGTAGAGAAACTGG + Intronic
1089768651 11:120786621-120786643 CAGTTGAAATGAAGAGATGTTGG - Intronic
1090840622 11:130484929-130484951 CAGTGAAAATTTTGAGAAAGTGG + Intergenic
1091773902 12:3171923-3171945 CCATGGAAATTTAAAGAAATAGG - Intronic
1091831135 12:3551910-3551932 CAGAGAAAAGCTAGAGAAATGGG + Intronic
1092269287 12:7009976-7009998 CTGTGGGAATATAAAGAAATGGG + Intronic
1092950071 12:13494083-13494105 CAGTGAGAATATAGAGAAAAGGG - Intergenic
1092991186 12:13901293-13901315 CAGTGGTAAAGTGGACAAATAGG - Intronic
1093569292 12:20647685-20647707 CTGTGGAAATGAACAGCAATGGG - Intronic
1094087772 12:26612629-26612651 CAGTAGAAATGTATGCAAATGGG - Intronic
1094140771 12:27179890-27179912 CAATGGAAATTATGAGAAATAGG + Intergenic
1094355859 12:29576631-29576653 GAGAGGAAATGAAGAGATATAGG + Intronic
1094645001 12:32314408-32314430 TAGTGAGAATGTGGAGAAATCGG - Intronic
1094661744 12:32475899-32475921 CAGAGGAAATATAAAGAAGTTGG - Intronic
1095135362 12:38594678-38594700 CAGTGGACAAGTAGAAGAATTGG - Intergenic
1095302784 12:40606145-40606167 CAGTGAAAATGTAGAGAAACTGG + Intergenic
1095790948 12:46166390-46166412 CAATGGAAAGGAAGAGAAATGGG + Intergenic
1096039166 12:48499542-48499564 GAGTGGAAGTGGTGAGAAATGGG - Intergenic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1097460977 12:59861466-59861488 CATAGGAAATGAAGAGACATTGG - Intergenic
1097652842 12:62323094-62323116 CAATGGACATTGAGAGAAATAGG - Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1098047892 12:66420837-66420859 CAGGGGAAATGTACAGTAAGGGG - Intronic
1098425425 12:70360571-70360593 CATTGCAAATGTAGGGAATTTGG - Intergenic
1098462226 12:70744304-70744326 GTGTGGAAAGGTAGAGAAAATGG - Intronic
1098771266 12:74556584-74556606 CACTAGAAATGTAGAAGAATAGG - Intergenic
1099168676 12:79338189-79338211 CAATGGAAATGGTGAAAAATGGG - Intronic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099461369 12:82925762-82925784 CCATGGAAAGGGAGAGAAATTGG - Intronic
1099801710 12:87465349-87465371 CAGTGAAGATGTGGAAAAATAGG - Intergenic
1100272202 12:93037230-93037252 TAGTGAGGATGTAGAGAAATTGG - Intergenic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1100631276 12:96391737-96391759 TAGTGAAAATGGAGAGAAAAGGG - Intronic
1101010208 12:100441566-100441588 GAGTGGAAGTGGTGAGAAATGGG + Intergenic
1103911749 12:124355829-124355851 CAGTGGAAATGGGGAGACAGGGG - Intronic
1104148503 12:126058676-126058698 GGGTGCAAAAGTAGAGAAATAGG + Intergenic
1104229784 12:126873505-126873527 CTGTGAAAATATAGAGAAAGAGG + Intergenic
1104501740 12:129292957-129292979 CAGTGGAGAAGTAGAGATATTGG + Intronic
1104746286 12:131212813-131212835 CAGTGAAGATGTGGAGAAACTGG + Intergenic
1105774713 13:23646920-23646942 TGGTGGAGATGTGGAGAAATTGG - Intronic
1106155536 13:27152011-27152033 CAATGGGGATGCAGAGAAATGGG + Intronic
1106653492 13:31717384-31717406 CATTGAAAATGAAGAGAAGTTGG - Intergenic
1106812498 13:33373798-33373820 TGGTGAGAATGTAGAGAAATTGG + Intergenic
1106895730 13:34300215-34300237 CAGAGGAAATATAGATATATAGG + Intergenic
1106905241 13:34401060-34401082 CAGAGGAAATTAAGTGAAATAGG + Intergenic
1107131507 13:36901308-36901330 CAGTGAGGATGTAGAGAAATTGG - Intronic
1107246105 13:38296471-38296493 TGGTGAAAATGTAGAGAAAAGGG + Intergenic
1108148148 13:47501327-47501349 CAGTGGCAGTGGGGAGAAATGGG - Intergenic
1108944802 13:56008800-56008822 AAGTGGAATTATAAAGAAATAGG + Intergenic
1108998721 13:56767771-56767793 CAGAGAGGATGTAGAGAAATAGG - Intergenic
1110505482 13:76280940-76280962 CTGTGGAAATGAAGAGAAAGAGG - Intergenic
1110920306 13:81076009-81076031 CAGTGGAAGAGTAGGGAAAGGGG + Intergenic
1110946792 13:81431535-81431557 CTGAGGAAAGGAAGAGAAATGGG - Intergenic
1111082656 13:83332215-83332237 TAGTGTAACTGTAGAAAAATTGG + Intergenic
1111723782 13:91978875-91978897 CAGTAGAAATGAAGAGGACTTGG + Intronic
1111937108 13:94568952-94568974 CAATGAGGATGTAGAGAAATTGG - Intergenic
1112101188 13:96191131-96191153 CAGTGATAATGTAGAGAGGTGGG - Intronic
1112159835 13:96855629-96855651 CAGTGCAAATCTATAGACATTGG + Intergenic
1112834700 13:103500109-103500131 CAAAAGAAATGGAGAGAAATGGG + Intergenic
1112914217 13:104526157-104526179 GAGTGGAAATTTATAGATATTGG - Intergenic
1112917000 13:104564093-104564115 AAGTGGAAATGTAGAGACCTGGG - Intergenic
1113070216 13:106412958-106412980 TAGTGGAAATGTAAAGAATCAGG - Intergenic
1114361019 14:21972801-21972823 CGGTGAGGATGTAGAGAAATAGG + Intergenic
1114409320 14:22485996-22486018 CAGAGGAAATGGAGAGAGATGGG + Intergenic
1115146442 14:30231835-30231857 CAGTGGAAATCTAGAGAGGAGGG - Intergenic
1115606629 14:35009547-35009569 TTGTGAAAATGTAGTGAAATAGG + Intronic
1115655100 14:35436011-35436033 CACTTGAAAAGTAGAGAAAGAGG - Intergenic
1115911149 14:38257210-38257232 CACTGGAATTCTAAAGAAATTGG - Intergenic
1116215767 14:42015288-42015310 CAAAGGAAATGCAGAAAAATAGG + Intergenic
1116260093 14:42613776-42613798 TAATGGAAATGTTGATAAATAGG + Intergenic
1116327291 14:43546573-43546595 CACTCGAAATTTAGAGAAACGGG - Intergenic
1117094575 14:52284147-52284169 CAATGGAAATGTTGAAATATGGG - Intergenic
1117201685 14:53396228-53396250 CAGAGGAGAGGGAGAGAAATGGG - Intergenic
1117637963 14:57766432-57766454 CAGTGGAAATGAAGATAGTTGGG + Intronic
1117762355 14:59042999-59043021 CAGTGGAGATGCAGAGCAACTGG - Intergenic
1118043970 14:61946651-61946673 CATTGGAAAGTTAGAGAAATGGG + Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118241374 14:64061920-64061942 AAATGGAAATATACAGAAATAGG - Intronic
1118855323 14:69616937-69616959 AGGTGGGATTGTAGAGAAATAGG - Intronic
1118936289 14:70291768-70291790 CAGTGCAAATGTCCTGAAATGGG - Intergenic
1119885001 14:78132837-78132859 CAGGGGAGATGCAGAGATATTGG + Intergenic
1120005703 14:79355315-79355337 CAGTGGAAAAGAAGTGAATTGGG - Intronic
1120524731 14:85564481-85564503 CAGTGGAAATGTAATGACTTAGG - Intronic
1120545769 14:85809406-85809428 AAGTGGAGATGTAGAGAGGTAGG + Intergenic
1120602434 14:86528104-86528126 CAGGAGAAATTTAGAGAATTGGG - Intergenic
1120841649 14:89090898-89090920 CAGTAGGAATGAAGAGAAACAGG - Intergenic
1120942746 14:89964423-89964445 AACTGGAAATGCAGAAAAATGGG + Intronic
1121766879 14:96495338-96495360 ATGTGGCAATGTAGAGAGATGGG - Intergenic
1123952490 15:25294958-25294980 CTGGGGGAATGTAGAGAAAAGGG + Intergenic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1124427381 15:29572995-29573017 TAGTGGAGATGTCGAGAATTGGG + Intergenic
1125211469 15:37220519-37220541 GAATGGAAATCAAGAGAAATAGG + Intergenic
1125803437 15:42471280-42471302 TACTGGAAATGCAGAGAACTGGG - Intronic
1125890681 15:43264142-43264164 TAGTGGGAATGCAGAGAAATTGG + Intronic
1126287690 15:47032919-47032941 CAGTGAGAATGTAGAGAAAAGGG - Intergenic
1126410456 15:48368132-48368154 CAGAGCAGATGTAGAGAAAGGGG - Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127337165 15:57999586-57999608 CAGTGGGAATGTAAACAAAGTGG - Intronic
1127697994 15:61470581-61470603 CAGTGGAAATGGAGTGGAATTGG - Intergenic
1127709707 15:61584124-61584146 CAGAGGGAATGTGGAGAAAGTGG + Intergenic
1129627951 15:77224877-77224899 CTGTGGAAATGGAAAGAGATGGG - Intronic
1130907610 15:88251587-88251609 CAGTGGAAATGCCGTGATATTGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131452788 15:92559980-92560002 TGGTGAAAATGTGGAGAAATTGG + Intergenic
1131878774 15:96839702-96839724 CAGTGAGGATGTGGAGAAATTGG + Intergenic
1132475051 16:130876-130898 CAGGGGAAATGAAGAGTTATTGG + Intronic
1133586984 16:7205215-7205237 GAGTGAAAATGTATGGAAATGGG + Intronic
1134088120 16:11372478-11372500 CAGTGGAAGTGTGGAGGAAGGGG + Exonic
1134371110 16:13625760-13625782 TAGTGAAGATTTAGAGAAATAGG - Intergenic
1134876836 16:17707976-17707998 CAGTGGAAGAGCAGAGTAATGGG - Intergenic
1134883108 16:17764772-17764794 CTGTGGCAAAGCAGAGAAATAGG - Intergenic
1135141401 16:19925191-19925213 CAGTGAGGATGTTGAGAAATAGG - Intergenic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135244426 16:20842976-20842998 CAGTGAAGATGTAGATAAGTTGG - Intronic
1137384877 16:48031981-48032003 CAGTATAAGTCTAGAGAAATAGG - Intergenic
1138624667 16:58240883-58240905 CAGTAAGAATGTGGAGAAATTGG - Intronic
1138672685 16:58628631-58628653 CTATCGAATTGTAGAGAAATCGG + Intronic
1139070824 16:63380404-63380426 CAATGAACATGAAGAGAAATTGG + Intergenic
1140237512 16:73172469-73172491 CAGTGGAAATTCAAACAAATTGG - Intergenic
1140734152 16:77883340-77883362 CACTGGAAACCTAGAGAAATGGG - Intronic
1142112012 16:88337995-88338017 CAGAGGAAAAATAGAGAAAGTGG - Intergenic
1142294759 16:89213288-89213310 CAGGGAAAATGTTGAGAAGTAGG + Intergenic
1142447920 16:90154531-90154553 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1142459569 17:80792-80814 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1143717520 17:8785649-8785671 CAGTGTAAATGTGAAGAAACAGG - Intergenic
1143724224 17:8834344-8834366 GAGAGGAAATGAAGAGAGATGGG + Intronic
1144051617 17:11501857-11501879 TAGTGGAAAAGGAGAGAAAAGGG + Intronic
1144505279 17:15824149-15824171 CAGTGAAGATGTGGAGAAATCGG - Intergenic
1144645239 17:16969056-16969078 CGGTGAAGATGTGGAGAAATTGG + Intronic
1145169456 17:20642023-20642045 CGGTGAAGATGTGGAGAAATCGG - Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146890547 17:36503835-36503857 ATGTGGAAATGAAGAGAAAGAGG - Intronic
1147062013 17:37887596-37887618 TAGTGGAGATGGAGAGAGATAGG - Intergenic
1147117548 17:38312936-38312958 CAGTGAGGATGTAGAGAAACTGG - Intronic
1147196037 17:38767227-38767249 CAGTTTGAATGTAGAGAAAGTGG - Exonic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1148412139 17:47476654-47476676 CAGTGAGGATGTAGAGAAACTGG + Intergenic
1148511469 17:48174105-48174127 CAGTGGAAATCAAGAGTAACTGG - Intronic
1148702816 17:49600524-49600546 TAGGAGAAATGTGGAGAAATGGG + Intronic
1148883681 17:50755227-50755249 CAGAGGAAAAACAGAGAAATAGG - Exonic
1149003987 17:51785526-51785548 CAGTGAAGATGTAGAGAAAAGGG + Intronic
1149354469 17:55825864-55825886 CAGTGAAAATGAGGAGAAATGGG - Intronic
1149635966 17:58169748-58169770 CAGTGGTGATGTAGACAAACAGG - Exonic
1149688253 17:58551433-58551455 CAATAGAAATGGAAAGAAATGGG + Intergenic
1150191634 17:63246946-63246968 CAAAGGAGATGTAGAGAAACAGG - Intronic
1150317740 17:64183735-64183757 TAGTGAGGATGTAGAGAAATTGG - Intronic
1150712447 17:67543449-67543471 CAGTGATTATGTGGAGAAATTGG - Intronic
1152630130 17:81407187-81407209 CAGTGGAAATTTCCAGAAATGGG + Intronic
1153410375 18:4785786-4785808 AAGGGGAAATGAAGAGATATAGG + Intergenic
1153546338 18:6209502-6209524 CAGTGAAGATGTGGAGAAATTGG + Intronic
1153734755 18:8054380-8054402 GAGGGGAAATGTAGAAAAACAGG - Intronic
1154473184 18:14724633-14724655 CAGTGAAGATGCAGAGGAATTGG - Intergenic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1155692277 18:28639787-28639809 CAGTGAAGATGTGGAGAAATTGG - Intergenic
1156134542 18:34021707-34021729 CAGTGGCAATGCAGAAAAAGAGG + Intronic
1156761028 18:40590705-40590727 AAGGCGAAATGTAGAGAAAATGG + Intergenic
1156920985 18:42522116-42522138 CAGTGGAGATGAAGAGTAATAGG - Intergenic
1157009773 18:43633193-43633215 CAGTAAAAATGGAGAGAAAAGGG - Intergenic
1157011694 18:43656840-43656862 CAATGGAAATGTTGAAGAATGGG + Intergenic
1157048919 18:44137066-44137088 CAGTCAAAATCTGGAGAAATAGG - Intergenic
1157305582 18:46514791-46514813 CAGTAGAAACCTAGTGAAATGGG - Intronic
1157417580 18:47518599-47518621 TGGTGAAAATGTGGAGAAATTGG + Intergenic
1158777876 18:60608047-60608069 CTGTGGAAATGGATAGAACTAGG - Intergenic
1158801039 18:60909657-60909679 CAGTGAGAATGTAGAGAAACAGG + Intergenic
1159046016 18:63368898-63368920 TAGTGAAGATGTAGAGAAATTGG - Intergenic
1159274005 18:66192231-66192253 CAGTGAAAATGAAAAGATATGGG - Intergenic
1160649285 19:213301-213323 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1162614186 19:11783764-11783786 AAGGGGAAATGAAGAGAAATTGG + Exonic
1165533990 19:36427990-36428012 TAGTGAGAATGTAGCGAAATTGG - Intergenic
1166559766 19:43724596-43724618 CAGTGGAAATGCTGAGAAATTGG + Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
926693212 2:15751655-15751677 CAGAGGGAATGTAGAGTAAAGGG + Intergenic
926803582 2:16684072-16684094 AAGTGGAGATGAAGAGAAACTGG - Intergenic
926899038 2:17729082-17729104 CACTAAAAATATAGAGAAATAGG + Intronic
926998559 2:18767447-18767469 CAATGAAAATATAGACAAATTGG - Intergenic
927034018 2:19153120-19153142 TGGTGAAAATTTAGAGAAATGGG + Intergenic
927727172 2:25434841-25434863 TGGTGAAGATGTAGAGAAATTGG - Intronic
927801491 2:26104215-26104237 TAGTGAGGATGTAGAGAAATTGG - Intronic
927919044 2:26957496-26957518 GAGAGGGAATATAGAGAAATAGG - Intergenic
928232079 2:29506882-29506904 CAGTGAGGATGTAGAGACATTGG + Intronic
928443905 2:31316118-31316140 CTGTGGAAATGAAGAGACATGGG - Intergenic
928616229 2:33042432-33042454 CAGAGCAAAGGGAGAGAAATAGG + Intronic
928761579 2:34589504-34589526 CAGTAAACATGTAGTGAAATTGG - Intergenic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
928836114 2:35547308-35547330 CAGTGTGAATGTAGAGATTTTGG + Intergenic
928867996 2:35941293-35941315 CAGTGTAGATCTGGAGAAATGGG + Intergenic
928947406 2:36783744-36783766 AAGTGGAAATGAAGATAAATGGG + Intronic
929241665 2:39659779-39659801 CAGTGGAAACAGAGAGAAATGGG - Intergenic
929290484 2:40185116-40185138 TGGTGACAATGTAGAGAAATTGG + Intronic
929317596 2:40498749-40498771 CATTGAAAATGTAGTGAAAATGG - Intronic
931423849 2:62152765-62152787 ATGTAGAAATGTAGAAAAATAGG + Intergenic
931852629 2:66267528-66267550 CAGTGAAGATGTGGAGAAAAGGG - Intergenic
932061779 2:68508581-68508603 CAAAGGAAAAGTAGATAAATGGG + Intronic
932324936 2:70852563-70852585 TGGTGGATATGCAGAGAAATTGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
933119315 2:78516639-78516661 CAGTGAGAATGTGAAGAAATTGG + Intergenic
933339179 2:81000006-81000028 CAAAGGAAAAGTGGAGAAATGGG - Intergenic
934313115 2:91888318-91888340 CAGTGTAAAGGAAGAGCAATAGG + Intergenic
934605134 2:95689334-95689356 CACTGCAAAAGCAGAGAAATAGG - Intergenic
935577169 2:104723096-104723118 CTCTGGAAATGTAGTGAAAGGGG - Intergenic
936013293 2:108939546-108939568 CAATGGAAAAGTAGAGAGAGAGG + Intronic
936674160 2:114695207-114695229 TATTGGAGATGTAGTGAAATGGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937878464 2:126846338-126846360 CAGTGAAAATGTGGAGAAAAGGG + Intergenic
938234407 2:129692140-129692162 AAGAGGAAATGGAGATAAATTGG + Intergenic
938558795 2:132451264-132451286 GAGTGGAAATAGAGAGTAATGGG - Intronic
938881768 2:135596916-135596938 AAGTGGAAATGTGGAGTCATAGG + Intronic
940295110 2:152114516-152114538 CAGTGAGGATGTGGAGAAATTGG + Intergenic
940943784 2:159593497-159593519 CAGTGAAAATGTGGATAAGTGGG - Intronic
941414432 2:165201750-165201772 AAGTGGTAAAATAGAGAAATAGG - Intronic
943063551 2:183063156-183063178 CAGTGGAAATCTACAAAAATGGG + Intergenic
943678307 2:190739862-190739884 TGGTGAAAATGTAGAGAAATTGG + Intergenic
943789743 2:191918668-191918690 CAATGTAAATGTACAGACATGGG + Intergenic
944162531 2:196679748-196679770 TAGTGAGAATGTAGAGAAACTGG - Intronic
944547074 2:200809705-200809727 CTCTGGAAATGTTGAGAAAGGGG + Intergenic
944770438 2:202909046-202909068 CAGTGAAAATATGGAGCAATTGG + Intronic
945071151 2:205990302-205990324 CAGTGCAAATGTTGAGAGGTGGG + Intergenic
945378438 2:209108946-209108968 CAGTGAGAATGTGGAGAAAAGGG + Intergenic
945526683 2:210896605-210896627 CTGTGGAAATGTAGAAATAGAGG - Intergenic
945712767 2:213320532-213320554 AAGGGGAGATGAAGAGAAATTGG - Intronic
945865817 2:215174166-215174188 CAGTGTGAATGTAGATAAAAAGG + Intergenic
945984680 2:216344053-216344075 CATTAGCAATGTAGAGAATTTGG + Intronic
946353244 2:219169152-219169174 GAGTGGGACTGTAGAGCAATGGG - Intronic
946826268 2:223681400-223681422 TAGCAAAAATGTAGAGAAATTGG + Intergenic
946920315 2:224573942-224573964 TAGTGGAAATGGAAAGGAATTGG + Intronic
947310130 2:228792787-228792809 TATTGGAAATATAGAAAAATTGG - Intergenic
947923057 2:233895023-233895045 CAGTGGAAAAATAGAAACATAGG + Intergenic
948371301 2:237490926-237490948 GAGTGGAAATGTTGACGAATGGG + Intronic
948397210 2:237654369-237654391 CACAGGAAATGTGGAGAAAAGGG + Intronic
948670633 2:239566472-239566494 CAGTGGAGATGAAGAGAGACAGG + Intergenic
1168971601 20:1935063-1935085 CTGGGCAAATGTAGAGAGATGGG - Intronic
1169259842 20:4128871-4128893 CAGTGGAAATGAGGAGAAACTGG + Intronic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1169742625 20:8911747-8911769 CAGTAAAGATGTAGAGCAATTGG + Intronic
1169742758 20:8913222-8913244 AAGTCCAAATGTAGAGAAATTGG - Intronic
1169764726 20:9136605-9136627 CAGTGGGAATGTGGAGGGATTGG + Intronic
1169843492 20:9965140-9965162 CAGAGGAGATGAGGAGAAATGGG + Intergenic
1170176065 20:13471389-13471411 CATTGGACATGTAGAGAGAATGG - Intronic
1170750189 20:19138448-19138470 CAGGGGAAATGTAGAGGCAGAGG + Intergenic
1171060849 20:21957606-21957628 CAGTGGAAATGTGGACCACTGGG + Intergenic
1174052865 20:47779418-47779440 CAATGGAGATGGAGTGAAATGGG - Intronic
1174747554 20:53078709-53078731 CAATAGAGATGTAGAGAAGTGGG + Intronic
1174921783 20:54711008-54711030 CAGTGGAGAGGTGGAGAATTTGG - Intergenic
1174951725 20:55049491-55049513 CAGTTGAAACCTAGAGATATTGG - Intergenic
1175195193 20:57238586-57238608 TGGTGGACATGTGGAGAAATTGG - Intronic
1176717126 21:10361946-10361968 TAGTGAGAATGTGGAGAAATGGG - Intergenic
1176801300 21:13433216-13433238 CAGTGAAGATGCAGAGGAATTGG + Intergenic
1177163828 21:17578257-17578279 TGGTGAAAATGTGGAGAAATTGG - Intronic
1177572629 21:22906960-22906982 CAGTGGGAATTTAGAGAATCAGG - Intergenic
1177968942 21:27764186-27764208 TAGTGAGAATGTGGAGAAATTGG + Intergenic
1178104604 21:29303924-29303946 CAGTGGGCATGCAGTGAAATTGG + Intronic
1178644397 21:34373571-34373593 AAGTGGAAATGCATAGAAAGTGG - Intergenic
1180601209 22:17018029-17018051 TAGTGAGAATGTGGAGAAATGGG + Intergenic
1181363104 22:22353985-22354007 CAGTGGAAATGTCAGGAGATGGG + Intergenic
1181498914 22:23304702-23304724 CGGTGAGGATGTAGAGAAATGGG - Intronic
1183842035 22:40506760-40506782 CAGTGAAAATGGTGATAAATGGG - Intronic
949288261 3:2431939-2431961 AAGTGGAAATTTTAAGAAATAGG + Intronic
949380557 3:3440793-3440815 TAGTGAGGATGTAGAGAAATTGG + Intergenic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950416127 3:12869834-12869856 CAGTGGAAATGAAAAAAAATAGG - Intronic
951245586 3:20337774-20337796 CAGTGGACTTGGAAAGAAATGGG + Intergenic
951433330 3:22633633-22633655 CAGTGAGGATGTGGAGAAATTGG - Intergenic
952552859 3:34498600-34498622 TGGTGGAGACGTAGAGAAATAGG + Intergenic
952914057 3:38218247-38218269 TGGTGGGAATGTGGAGAAATTGG - Intronic
953541651 3:43824382-43824404 CATGGGAAAGGTAGAGATATGGG - Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953655819 3:44853681-44853703 TGGTGAAAATGTGGAGAAATTGG - Intronic
953701857 3:45202350-45202372 CAGGGGAAATTTTGATAAATTGG + Intergenic
954741694 3:52757108-52757130 TGGTGAGAATGTAGAGAAATTGG + Intronic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
956176661 3:66479218-66479240 CAGAGGAAATGCAGAGAAAACGG + Intronic
957323780 3:78665856-78665878 TACTGGAAATATAGAGAAACAGG - Intronic
958133442 3:89458653-89458675 CAGCGAAGATGCAGAGAAATAGG - Intronic
958457239 3:94347334-94347356 CAGTGGGAAAGAACAGAAATTGG - Intergenic
958684015 3:97369372-97369394 CAGTGGACATATAGAAAAGTGGG + Intronic
959014281 3:101115072-101115094 TTGTGAAAATGTGGAGAAATTGG + Intergenic
959107148 3:102077436-102077458 CAGTGGTCATGGAAAGAAATGGG + Intergenic
959492750 3:107011224-107011246 CAGTGAGAATGTATAGAAAATGG + Intergenic
960100461 3:113737080-113737102 CAATGGAAATTAAGAGACATAGG - Intronic
960601866 3:119467101-119467123 AAGTGGAAATCTGGAGAAAGGGG - Intronic
960691912 3:120355196-120355218 TGGTGCAGATGTAGAGAAATTGG + Intergenic
960773791 3:121225791-121225813 CAATGGAGATGTTGATAAATAGG + Intronic
962024234 3:131530115-131530137 CAGTGTCAATATAGAGAAAAAGG - Intergenic
962875112 3:139530031-139530053 CAGTGGGAATGAAGAAAAACAGG + Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963089229 3:141466709-141466731 GAGGGAAAATGTAGAGAAATTGG + Intergenic
963460928 3:145614158-145614180 TAGTGAGACTGTAGAGAAATAGG - Intergenic
963496544 3:146070312-146070334 TAGAGGAAATGTAGACAAAATGG - Exonic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
964184066 3:153921367-153921389 AAGGGGAAATGTAGAAATATAGG + Intergenic
964373608 3:156028030-156028052 CAGTGGAAATGCATATAAAGTGG + Intergenic
964397503 3:156260878-156260900 TAGTGAAAATGTGGAGAAACTGG - Intronic
965377695 3:167946418-167946440 CAGGGGAAAAGTAGGTAAATTGG + Intergenic
965773439 3:172204980-172205002 TAGTGGAAATGGAGAGAGACGGG + Intronic
966087143 3:176081576-176081598 CAGTGTAAATTTAGAAAAAAAGG + Intergenic
966115991 3:176461525-176461547 CAGCAAAAATGTAGAGAAACTGG + Intergenic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967180182 3:186896664-186896686 AAGTGGCAATGGTGAGAAATGGG - Intergenic
967423700 3:189301940-189301962 CAGAAGAAATCTACAGAAATTGG - Intronic
968368561 3:198206831-198206853 CAGTGAAGATGTGGAGGAATTGG - Intergenic
969045636 4:4334626-4334648 TGGTGAAAATGTGGAGAAATCGG + Intergenic
970105318 4:12575992-12576014 TAGTGGAAAAGGAGAGAAAAGGG + Intergenic
970186987 4:13466552-13466574 CAGTGAGAATATAGAGAAAAGGG + Intronic
970258173 4:14191664-14191686 CAGAGAGAATGTGGAGAAATAGG - Intergenic
970693236 4:18643987-18644009 TGGTGGAAATATAGAGAAGTTGG - Intergenic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971147019 4:23988418-23988440 CTGGGGGAATGTGGAGAAATAGG - Intergenic
971441266 4:26689768-26689790 CTGAGGAAAGGGAGAGAAATGGG - Intronic
971628295 4:28953433-28953455 CTGTGGAACTGTAGACAAATAGG + Intergenic
971883693 4:32414461-32414483 CAGAGAAGATGTGGAGAAATAGG + Intergenic
972351279 4:38238304-38238326 CTGTAGAAATGTAGGGAATTTGG - Intergenic
972393335 4:38634052-38634074 GAGTGGAAATGAAGAGAAATGGG - Intergenic
973336167 4:48958912-48958934 CAGTGGAAATGGAGAAGAAGAGG + Intergenic
973653317 4:53019205-53019227 CAGCTGAAATGTACAAAAATAGG + Intronic
974831257 4:67192431-67192453 CAGTAGAAATGGAGAGATAAAGG - Intergenic
975584300 4:75935132-75935154 TAGTGGCAAAGTAAAGAAATGGG + Intronic
975602525 4:76117552-76117574 TAGTGAGAATGTGGAGAAATTGG - Intronic
975641737 4:76507377-76507399 TGGTGAAGATGTAGAGAAATTGG - Intronic
975837025 4:78434107-78434129 CAGTGAACATGTAGAAAGATTGG + Intronic
975884259 4:78945461-78945483 CAGTGAGACTGTGGAGAAATGGG - Intergenic
976227012 4:82802333-82802355 CAGTGGGGATTTGGAGAAATTGG - Intergenic
976857568 4:89623062-89623084 AAGAGGAAATGGAAAGAAATAGG - Intergenic
977017689 4:91713576-91713598 TGGTGAGAATGTAGAGAAATGGG + Intergenic
977114445 4:93005352-93005374 CAGTGGAAAGTCAGAGAATTTGG - Intronic
977145488 4:93434657-93434679 GAGTGGAAAGGGAGAGTAATTGG - Intronic
977356195 4:95950338-95950360 CAGTGGAAATGGAAAGATACGGG + Intergenic
977971045 4:103214803-103214825 TAGTGAAAATGTGGAGAAAAGGG + Intergenic
977971116 4:103215641-103215663 TACTGGAAATGTAGTGAAAATGG + Intergenic
978017734 4:103767975-103767997 CAGTGAGGATGTGGAGAAATTGG - Intergenic
978755088 4:112293160-112293182 CAGTGTCAATGAAGTGAAATTGG - Intronic
979256985 4:118616554-118616576 CAGTGAAGATGTGGAGGAATTGG - Intergenic
979331365 4:119423992-119424014 CAGTGAAGATGTGGAGGAATTGG + Intergenic
979995156 4:127423551-127423573 TAGTGGAAATGAAGAGAAATAGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980091689 4:128449481-128449503 AAGAGGAAATGTAGAGAAGAGGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981445722 4:144836199-144836221 TTGTGGTAATGTAGAGAAAAGGG - Intergenic
981582493 4:146263881-146263903 CAGTGTACTTGTAGAGCAATGGG - Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981703413 4:147633127-147633149 CAGGGGAACCCTAGAGAAATTGG + Intronic
981840476 4:149105885-149105907 CAATGAAAATGTTGGGAAATAGG - Intergenic
982029829 4:151289607-151289629 ATATGCAAATGTAGAGAAATTGG + Intronic
983454379 4:167944237-167944259 AATGGGAAATGTAGAGAATTGGG + Intergenic
983672143 4:170250116-170250138 CATGGCAAATGGAGAGAAATGGG + Intergenic
983827200 4:172278152-172278174 AAGTAGAAATGTGGAGAAATGGG - Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984462127 4:180051854-180051876 CACTGAGAATGTAGAGAAACTGG + Intergenic
985143085 4:186863176-186863198 CAGGTGCAATGTAGAGAAGTGGG - Intergenic
986184794 5:5425158-5425180 CAGTGGAGATGTTGAAAAGTGGG - Intronic
986189679 5:5483622-5483644 CAGTGGAAAGGTAGCAAAGTTGG + Intronic
986554765 5:9000118-9000140 AGGAGGAAATGTAGGGAAATGGG + Intergenic
986913567 5:12587710-12587732 CATTGGAAATCAAGATAAATGGG - Intergenic
987453764 5:18118934-18118956 CAGTGGAAAGTGAGAAAAATAGG - Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
987946688 5:24619034-24619056 CATTTCAAAAGTAGAGAAATAGG - Intronic
988005204 5:25401797-25401819 CAGTGGAAATGTAAATAATTAGG - Intergenic
988143919 5:27279362-27279384 AAATGGAAATTTAGAAAAATTGG - Intergenic
988260876 5:28884528-28884550 CAGTGGAAAGGTTTAAAAATAGG + Intergenic
988285999 5:29217133-29217155 CAGTGGAAATGAAGAGCAGCTGG - Intergenic
988367093 5:30314266-30314288 CAGTGGAATTAAAAAGAAATAGG - Intergenic
988376852 5:30447298-30447320 CAGTGGAAATGTAAACACACAGG + Intergenic
988727428 5:33938479-33938501 CAGCAAAAATGTAGAGAAATTGG + Intergenic
989380836 5:40808141-40808163 GAGTGGAAAGGCAGAGAAAGAGG + Intergenic
989470464 5:41811462-41811484 AAGAGGCAATGTAGAGAAAGAGG + Intronic
989993134 5:50792779-50792801 CAGTGGAAGTGGTGAGAAAAGGG - Intronic
990059546 5:51630400-51630422 CTGTGGAGATGTGGAGAAATAGG + Intergenic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991126273 5:63073181-63073203 CAGTGGAAGTGGAAAGATATGGG - Intergenic
991670288 5:69040526-69040548 CAGTGGAACTGTATAGGAATAGG + Intergenic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
992270671 5:75059629-75059651 TGGGGAAAATGTAGAGAAATGGG + Intergenic
992591152 5:78296772-78296794 CAGTGTAAAAGTGGATAAATAGG - Intergenic
992717782 5:79528148-79528170 TAGTCGCCATGTAGAGAAATGGG + Intergenic
995289621 5:110436467-110436489 CAAAGGAAATGTGGACAAATGGG - Intronic
995401627 5:111748667-111748689 TAATGAAATTGTAGAGAAATTGG - Intronic
995940970 5:117583357-117583379 TAGTGGAGACATAGAGAAATGGG - Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996562939 5:124850339-124850361 TAGTGGTAGTGCAGAGAAATTGG - Intergenic
996788018 5:127261733-127261755 CAGTGATAATGTGGAGAAATTGG - Intergenic
997847302 5:137298871-137298893 TACTTGAAATATAGAGAAATGGG - Intronic
998925359 5:147117848-147117870 CAGTGAGAATGCAGAGAAATGGG - Intergenic
999590735 5:153143003-153143025 CAGTGGAAATGTGGACCACTGGG - Intergenic
1000141568 5:158409468-158409490 CAGTGGAAGTGATGAGAGATGGG - Intergenic
1000216929 5:159167375-159167397 CAGAGGAGATTTAGAGAAAAAGG - Intronic
1000521981 5:162306654-162306676 TAGAGAGAATGTAGAGAAATAGG + Intergenic
1000790205 5:165597381-165597403 CAGTCGGGATGTTGAGAAATGGG - Intergenic
1001054790 5:168440314-168440336 TGGTGAAGATGTAGAGAAATTGG + Intronic
1001068444 5:168560111-168560133 CAGTGGAAATTTAGACATAAAGG + Intronic
1001351979 5:170977353-170977375 GAGTGAGAATGTGGAGAAATAGG + Intronic
1001969443 5:175942608-175942630 CAGTGAGGATGTAGAGAAAAGGG + Intronic
1002247992 5:177901145-177901167 CAGTGAGGATGTAGAGAAAAGGG - Intergenic
1002727782 5:181312058-181312080 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1003223350 6:4181558-4181580 GAGTGGAAATGTGGAGAGAGTGG - Intergenic
1003755324 6:9113100-9113122 AAGTGGAAATGTTTACAAATGGG + Intergenic
1004136621 6:12973477-12973499 ATGTGGAAATGTGGACAAATGGG + Intronic
1004308560 6:14523332-14523354 AATTGGAAATGTAGACAAAGTGG - Intergenic
1004958166 6:20753916-20753938 TGGTGAAAATGTGGAGAAATTGG - Intronic
1005120233 6:22381478-22381500 CAGGGGAAAAGAAGTGAAATAGG - Intergenic
1005390928 6:25332419-25332441 CAGTGAAGGTGTAGAGAAGTGGG + Intronic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005633863 6:27734711-27734733 CTGGGGAAGTGAAGAGAAATGGG - Intergenic
1006609570 6:35286098-35286120 GAGTGGAAATAGAGAGAAATGGG - Intronic
1006880899 6:37338816-37338838 CAGAGAGGATGTAGAGAAATAGG - Intergenic
1006898961 6:37487816-37487838 CAGTGGAACTGCAGATAAATTGG - Intronic
1007809084 6:44473806-44473828 AAATGCAAATATAGAGAAATAGG + Intergenic
1008237487 6:49067821-49067843 CAGTGAAGATGTAGAGGAAAGGG + Intergenic
1008595729 6:53039876-53039898 CAGTGGGAATATACAGAAGTAGG + Intronic
1009181852 6:60527264-60527286 ATGTGGAAATCCAGAGAAATGGG - Intergenic
1009537057 6:64900749-64900771 CGGAGAAAATGTGGAGAAATAGG + Intronic
1009707473 6:67271674-67271696 TGGTGAAAATGTAGAGAAAGGGG + Intergenic
1010026791 6:71227977-71227999 CATTTGAAATGAAGAGAAACAGG - Intergenic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1010515898 6:76772220-76772242 CAGTGAAAATGTAGCAAGATAGG - Intergenic
1011229568 6:85145149-85145171 CAGAGCAAATGTAGAGGAAAGGG - Intergenic
1011637789 6:89390520-89390542 TAGTGAAGATGTAGAGAAACTGG + Intronic
1012300130 6:97577060-97577082 AAGTATAAATGAAGAGAAATGGG + Intergenic
1012355628 6:98310525-98310547 CATTCCAAATGTAGAGAACTAGG - Intergenic
1012394664 6:98782481-98782503 CATTGGAAATGCACAGAAAGTGG + Intergenic
1012464734 6:99504536-99504558 CAGAGGATCTGGAGAGAAATGGG + Intronic
1012570638 6:100723568-100723590 GTGTGGAAATGTAAAGAAGTAGG - Intronic
1012633570 6:101505655-101505677 CAGTTAAAGTGAAGAGAAATTGG + Intronic
1013708806 6:112873111-112873133 TAGTGAGGATGTAGAGAAATAGG + Intergenic
1013837645 6:114351348-114351370 CAGTGCAAATGTAGACTAACAGG + Intergenic
1013971679 6:116027521-116027543 CAATGTAAATTTAGAAAAATTGG + Intronic
1014137321 6:117905433-117905455 CAGAGGAGATGTAGAGCATTTGG + Intergenic
1015058270 6:128930246-128930268 CAGTAGGAATGAAAAGAAATAGG - Intronic
1015337383 6:132055729-132055751 CAGTGAGTATGTTGAGAAATGGG + Intergenic
1015873466 6:137799948-137799970 CAGCTGAGATGTAGAGAAAAGGG - Intergenic
1016403855 6:143709628-143709650 CAGAGGACAGGTGGAGAAATGGG - Intronic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016883879 6:148939846-148939868 CAGAGAAAATTTAGATAAATTGG + Intronic
1016951446 6:149584565-149584587 CAGTGGAAATGTAAACTAAGAGG - Intronic
1017242107 6:152181906-152181928 TGGTGAAGATGTAGAGAAATTGG - Intronic
1017308210 6:152945353-152945375 CTTTGGAAATGTAGTCAAATTGG - Intergenic
1017583353 6:155892266-155892288 GAGTAGAGATGTGGAGAAATTGG + Intergenic
1018353599 6:162989096-162989118 CAGTGAGAATGTAGAGAAGGGGG + Intronic
1019087495 6:169493543-169493565 TAGTGGAAATGGAGAAAAACAGG - Intronic
1019818562 7:3220375-3220397 CAGTGGAAATTTTGAGCAAGTGG + Intergenic
1020409597 7:7876280-7876302 CAGTGGGATTGAAGAGGAATAGG + Intronic
1020456808 7:8382982-8383004 CATTAGAAATATTGAGAAATGGG - Intergenic
1021333099 7:19363589-19363611 CTGGGGAAATGTAGATAAATTGG - Intergenic
1021354221 7:19634273-19634295 TAGAGAAGATGTAGAGAAATGGG + Intergenic
1021525627 7:21583936-21583958 TAGAGGGAATGTGGAGAAATAGG + Intronic
1021606800 7:22416225-22416247 CAGAGAAAATGTAGAGAAAATGG - Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1022355651 7:29612123-29612145 AAGGGGAAATGCAGAGAAAAAGG + Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023016581 7:35974139-35974161 CAATGGAAATGTCAAAAAATAGG - Intergenic
1023384502 7:39642315-39642337 CGGTGGAAAGGTAAAGATATAGG + Intronic
1023707141 7:42952986-42953008 CAATGGAAATGCTGAAAAATAGG - Intergenic
1023714881 7:43033757-43033779 CAGTGAGAATGTAAAGAAATTGG + Intergenic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1024071910 7:45793627-45793649 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1024316544 7:48024514-48024536 TAGTGGAAATGTAGAGAAATTGG + Intronic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1025185282 7:56852871-56852893 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1025649888 7:63456753-63456775 CACTGCAAATGTAGAGAATGTGG + Intergenic
1025686649 7:63724088-63724110 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1025872261 7:65446186-65446208 CAGTAGATATGTGGGGAAATGGG - Intergenic
1025980689 7:66402881-66402903 TGGTGAAAATGTGGAGAAATTGG + Intronic
1027205582 7:76095245-76095267 TGGTGAAAATGTGGAGAAATTGG + Intergenic
1027536047 7:79403398-79403420 CAGTTGAAATGTAGACATCTTGG + Intronic
1027589736 7:80102612-80102634 CGGTGAGAATGTAGAGAAATTGG - Intergenic
1028191112 7:87853334-87853356 TAGTGAAGATGTGGAGAAATTGG + Intronic
1028800236 7:94955472-94955494 CAGTGGGAATAAAAAGAAATAGG - Intronic
1028831106 7:95327422-95327444 CAGTGGAAATGGGGAAAATTGGG - Intergenic
1029314799 7:99701581-99701603 CAGTGAGAATGTGGAGAAAAGGG - Intronic
1029526488 7:101097782-101097804 CCATGGCAATGTAGAGAAATGGG - Intergenic
1030218120 7:107067332-107067354 AAGTGGAAATGGAGGGATATGGG + Intronic
1030582123 7:111370660-111370682 CAGTGTGAATTTAGAGAAACGGG - Intronic
1030674665 7:112371806-112371828 GAATGAAAATGTAGAGCAATTGG + Intergenic
1031150117 7:118044467-118044489 TATTGGTAATGGAGAGAAATAGG + Intergenic
1031367212 7:120917447-120917469 AATTGGAAATGAAGGGAAATGGG + Intergenic
1031753208 7:125604564-125604586 CAGTGGTTAGGTGGAGAAATCGG + Intergenic
1031813500 7:126402686-126402708 CCATGGAAAAGCAGAGAAATAGG + Intergenic
1031815286 7:126426156-126426178 CTGAGGAAAGGGAGAGAAATGGG + Intergenic
1032049294 7:128637334-128637356 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1032440896 7:131942215-131942237 TAGTGAAGATGTGGAGAAATTGG + Intergenic
1033154398 7:138944411-138944433 TGGTGAAAATATAGAGAAATTGG + Intronic
1034325888 7:150232246-150232268 CATTGGAAATATAGAGACATAGG - Intergenic
1034970417 7:155415761-155415783 AAGTGGAAATTTATAGAAAAAGG - Intergenic
1035721300 8:1795398-1795420 AAGTGGAAATGTACAGATAATGG - Intergenic
1036118234 8:5985004-5985026 CAATGAGAATGTAGAGAAATTGG + Intergenic
1036414503 8:8534687-8534709 CAGTGAAAATGAAAGGAAATGGG - Intergenic
1037690941 8:21181128-21181150 CCATGGAAATGTTGAGAGATGGG - Intergenic
1038157324 8:25001974-25001996 AAGTGAAAAAGTGGAGAAATTGG - Intergenic
1038991026 8:32868536-32868558 CAGTGGAAATCCAGAGGAAGGGG + Intergenic
1039200696 8:35090190-35090212 CTGTGTCAATGAAGAGAAATAGG + Intergenic
1039289226 8:36076180-36076202 CAGTGTCAAGGTAGATAAATGGG - Intergenic
1039529819 8:38250769-38250791 CAATGGAAATGTGCTGAAATTGG - Intronic
1040756911 8:50787353-50787375 TAGTGAGGATGTAGAGAAATTGG + Intronic
1040967184 8:53094709-53094731 CTGGGGAAATGTACACAAATAGG + Intergenic
1042070971 8:64933164-64933186 TGGTAGAAATGTAGAGAAAGAGG - Intergenic
1042259516 8:66843322-66843344 CACTGGAAATCTAGATAATTTGG + Intronic
1042408099 8:68429399-68429421 TGGTGAAGATGTAGAGAAATGGG + Intronic
1042658243 8:71125230-71125252 CAGTGGAAATATCTAGAACTTGG + Intergenic
1042686334 8:71445043-71445065 TAGTGGCAATGTAAAAAAATTGG - Intronic
1043294083 8:78642850-78642872 AAGTGAAGATGTAGAGAAAAGGG - Intergenic
1043387095 8:79759161-79759183 TAGTGGGAATGTAGGGATATTGG - Intergenic
1043689553 8:83133026-83133048 CTGATGAGATGTAGAGAAATGGG + Intergenic
1043919846 8:85968802-85968824 CTGTGGAAATATAGAAAAAGGGG + Intergenic
1044133409 8:88555508-88555530 TGGTGAAGATGTAGAGAAATTGG - Intergenic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045337962 8:101224966-101224988 GAGGGGAACTGTAGAGAGATTGG + Intergenic
1046001631 8:108427248-108427270 CAGGAGCAATGTAGAGGAATGGG - Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047032099 8:120893225-120893247 TAGTGAGAATGTAGTGAAATTGG - Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047880212 8:129184584-129184606 TGGTGAAGATGTAGAGAAATTGG + Intergenic
1047973444 8:130106914-130106936 CACTGGAAATGTAAAGAAGAAGG - Intronic
1047976602 8:130136780-130136802 CAGTGGAAATTAAGAGACCTGGG + Intronic
1048001992 8:130386205-130386227 CAGTGGTGATGCAGAGAAAAGGG + Intronic
1048039667 8:130713810-130713832 TAGGGAAAATGTGGAGAAATTGG - Intergenic
1048065140 8:130960114-130960136 CAGTGGAGATGGAGAAACATGGG + Intronic
1048358425 8:133673387-133673409 CAGTCGAATTGTTGGGAAATTGG + Intergenic
1048587213 8:135785481-135785503 TGGTGAAACTGTAGAGAAATAGG - Intergenic
1048798683 8:138175723-138175745 CATAGAAAATGAAGAGAAATGGG - Intronic
1049075649 8:140394239-140394261 CAGTGGAATTGCAGACAATTTGG - Intronic
1049405652 8:142450831-142450853 CAGTGGAAAGGTAGACAAGGAGG - Intronic
1050242293 9:3649719-3649741 CAGTAAAACTGTAGAGAAAGTGG - Intergenic
1050641389 9:7671314-7671336 CAGAGAAAATGAAGAGAAAAGGG + Intergenic
1051046544 9:12882286-12882308 CAGTCTATATGTAGAGAAAGAGG - Intergenic
1051294575 9:15582288-15582310 GAGAGGAGATGTGGAGAAATAGG + Intronic
1051444021 9:17121257-17121279 AAGTGGAAATCTAGAGAATTTGG + Intergenic
1051716103 9:19986278-19986300 AAGTGAAAATGTGGAGAAATTGG + Intergenic
1051810668 9:21046043-21046065 TAGGGGAAATGAAGAGAGATAGG - Intergenic
1051851851 9:21518655-21518677 GTGTGGAAATGTAGAGAATTTGG + Intergenic
1052114379 9:24631792-24631814 TAGGGGAAATGAAGAGATATTGG - Intergenic
1052323858 9:27196257-27196279 CAGTGGAAAAATAGATAACTAGG - Intronic
1052541193 9:29813201-29813223 GAGAGGAAATGGACAGAAATAGG + Intergenic
1052842499 9:33304820-33304842 CAGTGGAAATTTGGGCAAATAGG + Intronic
1053588145 9:39482084-39482106 AAGGAAAAATGTAGAGAAATTGG + Intergenic
1054578160 9:66883198-66883220 AAGGAAAAATGTAGAGAAATTGG - Intronic
1054752981 9:68927404-68927426 CAGTGAGGATGTAGAGAAACTGG - Intronic
1054803172 9:69372809-69372831 CAGTGAAGATGTGCAGAAATTGG - Intronic
1055495435 9:76849983-76850005 CAGAGGACATGCAGAGAAAAGGG - Intronic
1055940438 9:81644099-81644121 CAGAGATCATGTAGAGAAATTGG + Intronic
1056242135 9:84658408-84658430 CAGGGGCAAAGTAGAGAAAATGG - Intergenic
1056578825 9:87875735-87875757 AAGAGGAAAGGGAGAGAAATTGG + Intergenic
1056749972 9:89342292-89342314 CAGTGAAGATGTGGAAAAATTGG + Intronic
1056838473 9:89977777-89977799 CAGTTGACATGTACAGAAAAAGG - Intergenic
1057594736 9:96405461-96405483 TATTAAAAATGTAGAGAAATTGG + Intronic
1058880827 9:109284832-109284854 CAGTGGCAATGGATAGTAATAGG - Intronic
1058917614 9:109582823-109582845 CAGTGGTAATATTGACAAATGGG + Intergenic
1059853404 9:118368357-118368379 CAGTGTAAAAGTAAAGTAATGGG + Intergenic
1060001915 9:119966590-119966612 CAGTGGAAAGGTAGAGGACATGG - Intergenic
1061414902 9:130442337-130442359 AAGTGGAAGTGGAGAGAAAGGGG + Intergenic
1061784316 9:133017005-133017027 CTGTGGAAAGGGAGAGAGATGGG - Intergenic
1062752902 9:138269536-138269558 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1203575418 Un_KI270745v1:4310-4332 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1185922675 X:4111707-4111729 ATGTGGAAATGAAGACAAATGGG + Intergenic
1186717207 X:12264980-12265002 CAGTGGTAATGTACAGCATTAGG - Intronic
1187290353 X:17947529-17947551 TAATGGAATTGTAGAAAAATGGG - Intergenic
1187423909 X:19160384-19160406 CAGTGCAATTGGAGAGAACTAGG - Intergenic
1187872618 X:23777094-23777116 TGGTGTAGATGTAGAGAAATTGG + Intergenic
1188459554 X:30408284-30408306 CAGGGGAAAGGAAGAGAACTTGG - Intergenic
1189701196 X:43717259-43717281 CAGAGGAATAGTAGGGAAATAGG + Intronic
1189859019 X:45252959-45252981 CAGTGGAAATGTGGACCATTGGG + Intergenic
1190414609 X:50168457-50168479 CGGTGAAGATGTGGAGAAATGGG + Intergenic
1190842026 X:54154185-54154207 CAGTGCAAATGTTAAGAAGTAGG + Intronic
1191042234 X:56095447-56095469 CAATAGAAAAGTAGACAAATGGG + Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191130326 X:57001216-57001238 GAGTGAAGATGTGGAGAAATTGG - Intergenic
1192104923 X:68306210-68306232 GAGTGGAAAAGAAGTGAAATGGG - Intronic
1193491143 X:82149423-82149445 AAGAGGAAATGGAGAGATATTGG + Intergenic
1194029697 X:88796861-88796883 CAGTGAAATTGCAGAGAAAAGGG + Intergenic
1194149625 X:90307930-90307952 ATGTGGCACTGTAGAGAAATTGG + Intergenic
1195017915 X:100796868-100796890 CAATGGAAATGTTGAAATATGGG - Intergenic
1195177510 X:102325289-102325311 CGGTGAGAATGCAGAGAAATTGG + Intronic
1195181354 X:102361804-102361826 CGGTGAGAATGCAGAGAAATTGG - Intronic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195598918 X:106724254-106724276 TAGTGGACATGAAGAGAAGTGGG - Intronic
1195714150 X:107802193-107802215 CGATGAGAATGTAGAGAAATTGG + Intergenic
1195840304 X:109168606-109168628 CAGTGCCAATGCAGAGAAAGAGG - Intergenic
1196063906 X:111441804-111441826 CTCTGGAAAGGGAGAGAAATGGG + Intergenic
1196850824 X:119937015-119937037 CAGGGAAAAAGTAGAGAAACAGG + Intronic
1196924703 X:120621954-120621976 CAGTAGAAACCTAAAGAAATGGG + Intergenic
1197006195 X:121501765-121501787 CAGTGAAGATTTAGAGAAACAGG - Intergenic
1197105265 X:122706584-122706606 CCGGAGAAATGTGGAGAAATAGG + Intergenic
1197490240 X:127107397-127107419 CAGAGAAGATGTAGAGAAACAGG + Intergenic
1197961803 X:132014869-132014891 CTATGCAAATATAGAGAAATGGG - Intergenic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1198681287 X:139185429-139185451 AAGGGGAAATGTATAGGAATTGG - Intronic
1199136101 X:144254981-144255003 CAGTGAAAATATAGAGCACTGGG - Intergenic
1199345130 X:146730303-146730325 CAGTAAAAATGTGGGGAAATTGG - Intergenic
1199409775 X:147507983-147508005 CAGAGAAAATGCTGAGAAATTGG + Intergenic
1199450528 X:147973888-147973910 CAAAGTAAATGTAGATAAATCGG + Intergenic
1199641467 X:149866568-149866590 CAGTATAAATATAGAAAAATAGG + Intergenic
1199784112 X:151089140-151089162 TAGTGGATATTGAGAGAAATTGG - Intergenic
1200496002 Y:3884665-3884687 ATGTGGCACTGTAGAGAAATTGG + Intergenic
1201938475 Y:19433185-19433207 CAGTGCAAAAGGAGAGAATTAGG + Intergenic
1202370231 Y:24191255-24191277 CAGTGGTGCTGCAGAGAAATTGG + Intergenic
1202500553 Y:25478862-25478884 CAGTGGTGCTGCAGAGAAATTGG - Intergenic