ID: 906247973

View in Genome Browser
Species Human (GRCh38)
Location 1:44290378-44290400
Sequence TGCCACAGGGACACCTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906247965_906247973 4 Left 906247965 1:44290351-44290373 CCAACCAACCAGCCAGTTGGAAG 0: 1
1: 0
2: 0
3: 15
4: 158
Right 906247973 1:44290378-44290400 TGCCACAGGGACACCTGTGAGGG 0: 1
1: 0
2: 3
3: 25
4: 216
906247966_906247973 0 Left 906247966 1:44290355-44290377 CCAACCAGCCAGTTGGAAGATCC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 906247973 1:44290378-44290400 TGCCACAGGGACACCTGTGAGGG 0: 1
1: 0
2: 3
3: 25
4: 216
906247968_906247973 -8 Left 906247968 1:44290363-44290385 CCAGTTGGAAGATCCTGCCACAG 0: 1
1: 1
2: 9
3: 10
4: 131
Right 906247973 1:44290378-44290400 TGCCACAGGGACACCTGTGAGGG 0: 1
1: 0
2: 3
3: 25
4: 216
906247963_906247973 14 Left 906247963 1:44290341-44290363 CCAGTAGAAGCCAACCAACCAGC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 906247973 1:44290378-44290400 TGCCACAGGGACACCTGTGAGGG 0: 1
1: 0
2: 3
3: 25
4: 216
906247967_906247973 -4 Left 906247967 1:44290359-44290381 CCAGCCAGTTGGAAGATCCTGCC 0: 1
1: 0
2: 0
3: 13
4: 131
Right 906247973 1:44290378-44290400 TGCCACAGGGACACCTGTGAGGG 0: 1
1: 0
2: 3
3: 25
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906247973 Original CRISPR TGCCACAGGGACACCTGTGA GGG Intronic
900119391 1:1042024-1042046 TGCGACCGCGTCACCTGTGACGG + Exonic
900122178 1:1053485-1053507 TGCCACGTGCTCACCTGTGAAGG - Intronic
900155805 1:1202874-1202896 TGGCACAGGGACACTGGGGAAGG - Intergenic
900323723 1:2097255-2097277 GGCCACATGGCCACCTGGGAAGG + Intronic
900653787 1:3745070-3745092 GGACGCAGGGACACCAGTGAGGG - Intergenic
900673521 1:3870157-3870179 TGCAGCAGGGACACCTGGGAAGG - Intronic
901923242 1:12550571-12550593 TGACCCAGGGCCGCCTGTGATGG + Intergenic
902139451 1:14340580-14340602 TGTCACAGAGACACCTCTGCAGG + Intergenic
905327778 1:37170013-37170035 TGCCTCAGGGACAGCTGTGGGGG + Intergenic
906247973 1:44290378-44290400 TGCCACAGGGACACCTGTGAGGG + Intronic
908501084 1:64744831-64744853 CGCCACCCGGACACCTGTGAGGG - Intergenic
911314590 1:96340663-96340685 TGGCACAGGGAATCATGTGAGGG - Intergenic
915450807 1:156003642-156003664 TGCCCCAGGGAAAGCAGTGAAGG - Intronic
915584746 1:156838293-156838315 GGCCACAGGGACAGTTTTGAGGG + Intronic
920851990 1:209634360-209634382 AGCCACACGGACTCCTGAGAAGG - Intronic
922673872 1:227538372-227538394 TGCTACAGCAACACCAGTGAAGG + Intergenic
922746448 1:228047041-228047063 GGCCCCAGGGCCACCTGGGAAGG + Intronic
923407573 1:233678088-233678110 TGCCCCAGGGACCCCTGTCTTGG + Intergenic
923665250 1:235993346-235993368 TGCCACAGCGGTACCTGTAATGG - Intronic
923750500 1:236742133-236742155 TGCCACAGGGACCACCCTGACGG + Intronic
1063544834 10:6970826-6970848 TGCAACACGAACACCTGTCAGGG + Intergenic
1063857653 10:10272714-10272736 GGGCACAGGGACCCATGTGAAGG + Intergenic
1063938848 10:11107186-11107208 GGCCTCAGGGACACCTGAGTTGG - Intronic
1063947601 10:11192559-11192581 TGCCATGGGGACAGCTGTTATGG - Intronic
1063967511 10:11358244-11358266 TACCACAGGGATCCCTGTGTTGG - Intergenic
1064138018 10:12767065-12767087 TGCAGCAGAGGCACCTGTGAGGG - Intronic
1065571333 10:27073215-27073237 TGCCCCAGGGCTACCTGTTAAGG - Intronic
1067103811 10:43351574-43351596 TGTGACAGGGAAAGCTGTGAGGG - Intergenic
1075038706 10:119090524-119090546 TGCCACTGGGAGTCCTTTGAAGG + Intergenic
1075641992 10:124071310-124071332 GGCCACAAGGCCACCTGTGATGG - Intronic
1076228954 10:128803999-128804021 TGCCTCTGGGAAACCCGTGATGG - Intergenic
1077541684 11:3149504-3149526 TGCCACAGGCACACATGGGCAGG - Intronic
1079087111 11:17454424-17454446 AGCCACAGGGAGACCACTGAGGG + Intronic
1081756605 11:45549286-45549308 GGTCCCAGGGACGCCTGTGATGG - Intergenic
1088360153 11:108981035-108981057 AGCCACAGGGACACGAGTGAGGG - Intergenic
1088579812 11:111303751-111303773 AGCCACAGGGAGAGCTGTGCAGG - Intronic
1089163894 11:116460137-116460159 TGCCACAGGGAACCCTTAGAAGG + Intergenic
1092256643 12:6929460-6929482 TGCCAGATGGACACCTGGGATGG + Intronic
1093031632 12:14294293-14294315 TGCCACCTGGACACCAGGGAGGG - Intergenic
1093823170 12:23647039-23647061 TGCCACAGTGATTCCTCTGATGG - Intronic
1097076349 12:56397479-56397501 AGCCACAGTGGCACCTGGGAAGG + Intergenic
1101327321 12:103727497-103727519 TGGCACAGGGACCCCTGTCAGGG + Intronic
1103513947 12:121494603-121494625 CACCACAGGGACCCCAGTGATGG + Exonic
1105554948 13:21438235-21438257 TGCCACAGTGATTCCTCTGATGG + Intronic
1108967269 13:56324845-56324867 TGCCACAGGGATCAGTGTGAGGG + Intergenic
1112212671 13:97396057-97396079 TGCCACAGGGACACCTCAAATGG - Intergenic
1115627812 14:35212377-35212399 TGCCATAGTGACTCCTCTGATGG - Intronic
1115705405 14:35993448-35993470 TGGTACAGTGACTCCTGTGAGGG + Intergenic
1116805142 14:49486978-49487000 TGCTACAGGGACACTTGTGCAGG - Intergenic
1118336921 14:64861396-64861418 TGCCACAGGGCCACCTATCATGG + Intronic
1119618515 14:76114212-76114234 GGCCACTGGGCCATCTGTGATGG - Intergenic
1119853266 14:77881278-77881300 TGCCACATGGACCCCTCTGCAGG + Intronic
1121332473 14:93058226-93058248 GGCCACAGGGGCATCTGGGAGGG + Intronic
1124369249 15:29094079-29094101 CGCTCCAGGGACACCTGTGTGGG + Intronic
1124924691 15:34059815-34059837 TGCCATAGGGGCACCTGTGAAGG - Intronic
1126070066 15:44858523-44858545 TGCCTCAGGAACTCCTATGAAGG - Intergenic
1126087967 15:45026591-45026613 TGCCTCAGGAACTCCTATGAAGG + Intronic
1126174938 15:45727526-45727548 GGCCACAGGTTTACCTGTGATGG - Intergenic
1128740379 15:70079490-70079512 TGGCACAGTGACAGCTGGGAGGG - Intronic
1128756413 15:70186600-70186622 GGCCAGAGGGGCATCTGTGATGG - Intergenic
1129413579 15:75362620-75362642 GGTCAGAGGGACAGCTGTGAGGG - Exonic
1129448911 15:75638663-75638685 TGCAACAGGGCCACATGTGGAGG - Intergenic
1133921064 16:10153769-10153791 TGCCACTTGGACAACTGAGACGG + Intronic
1135125725 16:19807782-19807804 TGTCACAGGGTCATATGTGAGGG + Intronic
1139149201 16:64360129-64360151 TGCCACAGGGTCCCTTGAGATGG + Intergenic
1140596865 16:76426076-76426098 TAACACAGGCACAGCTGTGATGG - Intronic
1141176953 16:81727082-81727104 TGCCCCAGGCACATCTCTGATGG - Intergenic
1141971798 16:87489591-87489613 TGCAACAGGGACAACACTGAGGG + Intronic
1142442269 16:90106522-90106544 CCCTACAGGGACACCTGAGAGGG + Intergenic
1142734335 17:1885805-1885827 TGCCACAGTGATTCCTCTGATGG - Intronic
1142868236 17:2804224-2804246 GGCCTCAGGGACACCTGGGGAGG - Intronic
1143092541 17:4457620-4457642 TGGTACAGGGACAGCTTTGATGG - Intronic
1143798616 17:9358981-9359003 TGCTACAGGGAAACCTGGGTGGG + Intronic
1144726485 17:17505006-17505028 TGCCACTGGGACTCCTGAGGTGG - Intergenic
1144867662 17:18347271-18347293 GGCCACAGGGAAACCAGTGAGGG - Intronic
1145760064 17:27420734-27420756 TCCCAGAGGGACTCCTGTCAGGG + Intergenic
1146822232 17:35992763-35992785 TGCCAAAGGGCCACTTATGAAGG - Intronic
1151435123 17:74090572-74090594 TGCCACAGCCACACCTGTGTTGG + Intergenic
1152560500 17:81076289-81076311 TGGCAGATGGACACCTGGGAGGG + Intronic
1154927824 18:20955974-20955996 TAGCACAGGGACACTTGTGATGG + Intronic
1156577802 18:38338770-38338792 TGACGCACTGACACCTGTGATGG + Intergenic
1157375587 18:47161409-47161431 TGCGATAGTGACAACTGTGATGG - Intronic
1158558315 18:58493097-58493119 TGCCACAGGGTCATCTGTCCTGG - Intronic
1158639310 18:59189629-59189651 TCACTCAGGGACAACTGTGAAGG - Intergenic
1159919169 18:74212407-74212429 TGTCACGGGGCCACCTGTGCGGG - Intergenic
1160856503 19:1220307-1220329 TGCAAAGGGGACCCCTGTGAGGG + Intronic
1161086556 19:2338226-2338248 AGCCACAGGCAGAGCTGTGAGGG - Intronic
1163646973 19:18495128-18495150 TGACACAGGGACCCCTGGCAGGG + Intronic
1164255193 19:23522107-23522129 TGTCACAATGTCACCTGTGATGG + Intergenic
1164558505 19:29271459-29271481 TCCCACAGGGATGCCTGTGGTGG - Intergenic
1164809749 19:31146887-31146909 TGCCACATGGAACCCTGAGAAGG + Intergenic
1164914105 19:32036710-32036732 TGCCACAGGGAGAATTATGATGG - Intergenic
1166250872 19:41570080-41570102 TGCCACAGCGACAGCGCTGATGG + Intronic
1168536840 19:57177893-57177915 AGCGACAGTGACACCAGTGAAGG + Intergenic
930236726 2:48895653-48895675 TGCCACTGGGACACATATGTGGG - Intergenic
931053591 2:58441809-58441831 TGCCCCAAGTACACCAGTGAGGG - Intergenic
932101856 2:68908519-68908541 TGACTCAGGGACACCTGCGGAGG - Intergenic
933255212 2:80072798-80072820 GGCCACTGAGAAACCTGTGATGG + Intronic
933537514 2:83595039-83595061 TGCCACAGGAAGTCTTGTGAAGG - Intergenic
933823532 2:86137530-86137552 AGCGACAGTGACACCAGTGAAGG + Exonic
933992280 2:87642401-87642423 CCCCACCGGGACCCCTGTGAAGG - Intergenic
934525994 2:95052087-95052109 TGCCAAAGGGACCCCAGGGATGG + Intronic
936301570 2:111308438-111308460 CCCCACCGGGACCCCTGTGAAGG + Intergenic
937324093 2:120978667-120978689 GGCCACAGGCACACCTGGGTGGG + Intronic
937459846 2:122076219-122076241 GGCCCCAGGGACACCTTAGATGG - Intergenic
938292275 2:130156549-130156571 GGACACAGGCACACGTGTGACGG + Intronic
938324490 2:130389317-130389339 TGTGACAGGGACATCTCTGAGGG + Intergenic
938464275 2:131516418-131516440 GGACACAGGCACACGTGTGACGG - Intergenic
938590231 2:132728809-132728831 TGCCACCGGGACCCAGGTGAGGG - Exonic
940642526 2:156361307-156361329 TGGCACAGGGCCAGGTGTGATGG - Intergenic
941871442 2:170389931-170389953 GGCTACAGGGAAACCAGTGAGGG - Intronic
946281460 2:218668707-218668729 TTCCACAGGGAGAGCTGTAATGG - Intronic
946691603 2:222312446-222312468 TGCCACTGGGACACCGGGGGAGG - Intergenic
946873990 2:224110251-224110273 TTCCACAGTGTCCCCTGTGATGG - Intergenic
947744571 2:232500908-232500930 GGCCACTGGGACATCTGGGAAGG + Intergenic
948213295 2:236210785-236210807 TCCCAAAGGAACACCTGTGAAGG + Intronic
948217928 2:236245445-236245467 TGCTCCAGGGACAACGGTGAGGG - Intronic
948398915 2:237668343-237668365 AGGCACAGGGACAGCTGTGACGG - Intronic
1171147251 20:22795680-22795702 TGCTACAGAGACACCAGTGAAGG + Intergenic
1171374446 20:24682597-24682619 TGCCTCTGATACACCTGTGAGGG - Intergenic
1171869415 20:30513487-30513509 TGCCCCAGGGACGCCTGTCGTGG - Intergenic
1171968836 20:31550445-31550467 TGCCAAGGGGACCCCAGTGAGGG - Intronic
1173734062 20:45347447-45347469 TGGCCCAGGGACAGCTATGACGG + Intronic
1173734168 20:45347994-45348016 TGCCCCAGGGTCACCAGGGAAGG + Intronic
1176090291 20:63315571-63315593 AGCCACAGGGACGTCTGTGGAGG - Intronic
1176244327 20:64090308-64090330 AGACTCAGGGACACGTGTGAAGG - Intronic
1179581473 21:42347256-42347278 TGCCACTGCGTCATCTGTGATGG - Intronic
1179780855 21:43700024-43700046 TGTCACAGGGACCCCTGTGTGGG + Intergenic
1180241422 21:46509248-46509270 GTTCACAGGGACACCTGTCACGG - Exonic
1180968749 22:19803919-19803941 TGCCAGAAGGACATCGGTGATGG - Intronic
1181111781 22:20606697-20606719 AGACACAGGCACACATGTGATGG + Intergenic
1182667831 22:31972246-31972268 TGCTCCAGGGACAGCTGTGCTGG - Intergenic
1182953317 22:34397531-34397553 TGCAACAGGGCCAGGTGTGATGG - Intergenic
1185394903 22:50581900-50581922 TGGCACAGGGACACACATGAGGG + Intronic
1185406750 22:50656509-50656531 TGCTAGAGGGACACATCTGACGG + Intergenic
949544608 3:5061761-5061783 TGCAAAAGGGACAACTCTGAAGG - Intergenic
949778162 3:7655104-7655126 AACCACAGGGACATCTGTGGTGG + Intronic
952325279 3:32314979-32315001 GGAAACAGGGACAACTGTGATGG - Intronic
953468048 3:43141741-43141763 TGTCACTGGGATACCTGAGAAGG - Intergenic
955340042 3:58118153-58118175 TGCCACCCGGCCACCCGTGAGGG + Intronic
956025288 3:64976911-64976933 TGCCACAGGAACCTCAGTGAGGG - Intergenic
956619510 3:71207040-71207062 TGCCACAAGGAAGCCTCTGAAGG + Intronic
957643742 3:82891195-82891217 TGCCCCAGGGATGTCTGTGAGGG - Intergenic
957736531 3:84210975-84210997 TGGAACAGGGACACCTCTTAGGG - Intergenic
958064786 3:88529150-88529172 TGGCACAGGAACAGCTGTAATGG - Intergenic
958499370 3:94886352-94886374 AGCCATAAGGACATCTGTGATGG + Intergenic
961087901 3:124084918-124084940 AGCCACAGCTCCACCTGTGAGGG + Intronic
961356812 3:126344623-126344645 CTCCACAGGGGCATCTGTGAAGG + Intronic
962314314 3:134349659-134349681 TGTAGGAGGGACACCTGTGAAGG - Intergenic
963929959 3:150993387-150993409 TGCCACAGTGATTCCTCTGATGG - Intergenic
966311316 3:178597016-178597038 AGCAGCAGGCACACCTGTGAAGG - Intronic
967530484 3:190543894-190543916 TGCCATGGGAACACCTGTAAAGG - Intronic
968362540 3:198157486-198157508 CCCTACAGGGACACCTGAGAGGG + Intergenic
969370626 4:6729017-6729039 TGCCACAGGGCCATCTCTGCAGG - Intergenic
969627762 4:8316453-8316475 TGCAACCAGGACACCTGTGACGG + Intergenic
970136666 4:12932669-12932691 TGCCAAAATGACCCCTGTGATGG + Intergenic
976324220 4:83752539-83752561 TGCCCCAGGTATATCTGTGAGGG + Intergenic
982247751 4:153370889-153370911 TGCCACAGTGACTCCTCTGACGG - Intronic
982314986 4:154023111-154023133 TGCCACAGGAACATCTGTGATGG + Intergenic
982497770 4:156112095-156112117 TGCCACAGTGTCCCCTGTGCTGG + Intergenic
984033105 4:174629797-174629819 AGCCAGAGGGACACCTGTGAGGG - Intergenic
985232528 4:187836418-187836440 GGACACATGGACACCTGGGAGGG - Intergenic
985682712 5:1264881-1264903 TGCCATGGGGACACATGAGATGG - Intronic
985862747 5:2487342-2487364 AGAGACAGGGACACCTGTGGTGG + Intergenic
987068147 5:14309380-14309402 TGGCACAGGGACACCTCTTTTGG + Intronic
988322452 5:29716424-29716446 TGCCTCAAGGTCACCTTTGAGGG - Intergenic
988998273 5:36735214-36735236 AGTCACAGGGAGACATGTGAAGG - Intergenic
989338696 5:40349320-40349342 TGCCCCAGTGGCACCTGTGTTGG - Intergenic
989609090 5:43274257-43274279 TGCTAAAGGGACATTTGTGATGG + Intronic
990532088 5:56684287-56684309 TGCCTCAGGACCTCCTGTGAAGG + Intergenic
996194222 5:120583672-120583694 TGACACAAGGACACCTCTGGAGG + Intronic
996678301 5:126202004-126202026 TGGCAAAGGGACACCTTGGAGGG + Intergenic
997714371 5:136030831-136030853 TGCAACAGTGTCACCTGTAAGGG + Intronic
997816936 5:137028175-137028197 TTCCCCAGGGACACAGGTGAAGG + Intronic
998443498 5:142181000-142181022 TACCATGGAGACACCTGTGAAGG - Intergenic
998939737 5:147268391-147268413 TGCCATAGGGAGACCTGTAATGG - Intronic
998994114 5:147851852-147851874 AGCCACAGGGACACTTGCAAGGG + Intergenic
999312306 5:150559295-150559317 TACCACAGTGCCACCTCTGATGG + Intergenic
999948039 5:156618766-156618788 TGCCAAAGGGAAAACTGTGTGGG - Intronic
1002092286 5:176812606-176812628 TGCCACAGGGACTCCTCAGGAGG + Intronic
1002473255 5:179450120-179450142 TCCCACAGAGACCCCAGTGAAGG - Intergenic
1002480967 5:179500533-179500555 TCCCACAGAGACCCCAGTGAAGG + Intergenic
1003540402 6:7013409-7013431 TGCCTCTGGGCCGCCTGTGAAGG - Intergenic
1004077125 6:12353941-12353963 TGCCAAAGGAAATCCTGTGAAGG - Intergenic
1006294161 6:33162483-33162505 TGCCCCAGGGACACCAGGTAGGG - Intergenic
1007113331 6:39326357-39326379 GGCCACAGGGACGTCTGAGATGG + Intergenic
1007226190 6:40316520-40316542 TAGCACAGGGACAGCTTTGAAGG + Intergenic
1010183332 6:73113759-73113781 CTCCACAGGGTTACCTGTGAGGG - Intronic
1010422727 6:75692746-75692768 AGCCACAGGGCCAGGTGTGAGGG - Intronic
1013159027 6:107523565-107523587 TGTCAAAGGGACACCTGGGAGGG - Intronic
1013592588 6:111631929-111631951 TGCCACAAGGAAACCTGCCAAGG - Intergenic
1016359279 6:143250579-143250601 TTATACAAGGACACCTGTGATGG - Intronic
1016429097 6:143964244-143964266 TGCCCCAGGGCCGCCAGTGAGGG - Intronic
1018258601 6:161947580-161947602 TCCCACAGTGATACCTGTCATGG + Intronic
1019062027 6:169263489-169263511 AACCACAGGGACATCTGTGACGG + Intergenic
1019253142 7:31221-31243 CCCTACAGGGACACCTGAGAGGG - Intergenic
1020186405 7:5962557-5962579 TGCCCCAGGGGCACCTGCCAGGG + Intronic
1020296509 7:6762217-6762239 TGCCCCAGGGGCACCTGCCAGGG - Intronic
1021579501 7:22138158-22138180 TGCCACTGGGACATTTGTGAGGG - Intronic
1023135049 7:37043077-37043099 TGCCACAGTGAACACTGTGAGGG - Intronic
1024524402 7:50336308-50336330 TGCCACAGGCACGCATGTGCTGG + Intronic
1025290203 7:57712623-57712645 TTCTACAAGGACACTTGTGATGG - Intergenic
1027990115 7:85347741-85347763 TGCCAAAGGGACAGTTGAGAAGG - Intergenic
1028380263 7:90192159-90192181 TGTCAAAGGGAAACCTGTGAGGG - Intronic
1029034074 7:97500182-97500204 AGTCACAGGGTCACTTGTGAAGG - Intergenic
1032203136 7:129837563-129837585 TGAAACAGGGAGACCTCTGATGG + Intronic
1032335939 7:131024720-131024742 AGCTACAGGGACAGCTGAGATGG - Intergenic
1034268747 7:149793311-149793333 TGCCAGACGGAGCCCTGTGAGGG + Intergenic
1034595472 7:152186435-152186457 TGATGCAGGGAGACCTGTGAAGG - Intronic
1035822770 8:2612242-2612264 GGCCACAGGGACACAGATGAGGG - Intergenic
1036211003 8:6841427-6841449 AGCCCCAGGGACACCTGGGCCGG - Intergenic
1037754104 8:21700397-21700419 GGCCACAGGGCCAACTGGGAGGG + Intronic
1039639959 8:39208502-39208524 TGCAACAAGAACACATGTGAAGG - Intronic
1039886861 8:41659715-41659737 AGGCACAGGGACAAGTGTGAGGG - Intronic
1040283772 8:46089186-46089208 GGCCACAGGCAGGCCTGTGAAGG + Intergenic
1040325809 8:46340940-46340962 GGCCACAGGGTGACCTGGGAGGG + Intergenic
1042810742 8:72822893-72822915 TCCCACAGTGACACCTGTCATGG - Intronic
1044931346 8:97254558-97254580 TGTCACACGGACACCTCTGTAGG + Intergenic
1045670389 8:104544930-104544952 TGCCACAGCGAGTCCTCTGATGG + Intronic
1046130971 8:109968445-109968467 TGCACAAGGGACACTTGTGAAGG + Exonic
1048625293 8:136178596-136178618 AGCCACAGGGACACCTGGAGAGG - Intergenic
1048848334 8:138620596-138620618 TGCCTCAGAGTCAACTGTGATGG + Intronic
1049181874 8:141227052-141227074 TGCCACTGGGACGGCTCTGACGG + Intronic
1049315754 8:141966452-141966474 TGCTACAGGCACATCTGTGGAGG + Intergenic
1051944380 9:22549344-22549366 TTCCACAGGGACACTCGTGGGGG + Intergenic
1054765819 9:69041656-69041678 TGACAAGGGGACACCTGGGAAGG + Intronic
1055794366 9:79959008-79959030 TTGCACAGGTACACCTGTGCAGG + Intergenic
1056716906 9:89038872-89038894 TTCCACAGGGAAACAAGTGAAGG - Intronic
1056780129 9:89543057-89543079 TGACACAGGGAAATCTGTCAGGG - Intergenic
1059912155 9:119056482-119056504 TCTCACAGGTACTCCTGTGAAGG + Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060662825 9:125414363-125414385 GGCCACGGGGCCACCTGCGAGGG - Intergenic
1061645103 9:131994796-131994818 GGCCACTGGGACTACTGTGATGG - Intronic
1061681714 9:132245713-132245735 TGCCACATGGAAGCCAGTGATGG - Intergenic
1061840990 9:133358496-133358518 TGAAACAGGGACACCCGTGCTGG + Intronic
1062051125 9:134447626-134447648 TGCCACAAGCAGCCCTGTGATGG - Intergenic
1062572107 9:137190501-137190523 AGCCTCAGGGACACCGCTGAGGG + Intergenic
1062747228 9:138221145-138221167 CCCTACAGGGACACCTGAGAGGG + Intergenic
1185790584 X:2925913-2925935 TGGCCCAGGGACACCAGTGCAGG - Intronic
1187744380 X:22392232-22392254 TGCCACAGAGTCCCCCGTGAGGG - Intergenic
1189249296 X:39587621-39587643 CCCCACTGGGACACCTCTGAAGG - Intergenic
1191946410 X:66539450-66539472 TCCCTGAGGGACAGCTGTGAAGG + Intergenic
1196100119 X:111839044-111839066 TACCAAAGGGTCACCTGTGTTGG - Intronic
1196545518 X:116960414-116960436 TGCCACAGGGGCACGTGGAAAGG + Intergenic
1198505657 X:137298656-137298678 TTTCACAGGGACTGCTGTGAAGG - Intergenic