ID: 906248860

View in Genome Browser
Species Human (GRCh38)
Location 1:44296009-44296031
Sequence CTAGGTTTAGGGAGGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 259}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906248842_906248860 23 Left 906248842 1:44295963-44295985 CCTTGGCCCCATCAACCAAGCCT 0: 1
1: 0
2: 0
3: 14
4: 190
Right 906248860 1:44296009-44296031 CTAGGTTTAGGGAGGGGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 259
906248844_906248860 16 Left 906248844 1:44295970-44295992 CCCATCAACCAAGCCTACTGCGT 0: 1
1: 0
2: 0
3: 1
4: 57
Right 906248860 1:44296009-44296031 CTAGGTTTAGGGAGGGGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 259
906248851_906248860 -10 Left 906248851 1:44295996-44296018 CCTCCTTCTCCAGCTAGGTTTAG 0: 1
1: 0
2: 1
3: 23
4: 294
Right 906248860 1:44296009-44296031 CTAGGTTTAGGGAGGGGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 259
906248849_906248860 3 Left 906248849 1:44295983-44296005 CCTACTGCGTGGGCCTCCTTCTC 0: 1
1: 0
2: 3
3: 22
4: 201
Right 906248860 1:44296009-44296031 CTAGGTTTAGGGAGGGGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 259
906248848_906248860 8 Left 906248848 1:44295978-44296000 CCAAGCCTACTGCGTGGGCCTCC 0: 1
1: 0
2: 1
3: 31
4: 1572
Right 906248860 1:44296009-44296031 CTAGGTTTAGGGAGGGGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 259
906248841_906248860 24 Left 906248841 1:44295962-44295984 CCCTTGGCCCCATCAACCAAGCC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 906248860 1:44296009-44296031 CTAGGTTTAGGGAGGGGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 259
906248840_906248860 25 Left 906248840 1:44295961-44295983 CCCCTTGGCCCCATCAACCAAGC 0: 1
1: 0
2: 0
3: 9
4: 143
Right 906248860 1:44296009-44296031 CTAGGTTTAGGGAGGGGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 259
906248845_906248860 15 Left 906248845 1:44295971-44295993 CCATCAACCAAGCCTACTGCGTG 0: 1
1: 0
2: 0
3: 4
4: 62
Right 906248860 1:44296009-44296031 CTAGGTTTAGGGAGGGGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 259
906248843_906248860 17 Left 906248843 1:44295969-44295991 CCCCATCAACCAAGCCTACTGCG 0: 1
1: 0
2: 1
3: 2
4: 66
Right 906248860 1:44296009-44296031 CTAGGTTTAGGGAGGGGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906248860 Original CRISPR CTAGGTTTAGGGAGGGGGCC AGG Intronic
900310793 1:2032331-2032353 CTTGGTGTCGGGAGGTGGCCTGG - Intergenic
901606962 1:10466633-10466655 CTAGGTTTAGGGTGGATCCCAGG + Intronic
902741997 1:18445261-18445283 CAACGTTGAGGGATGGGGCCTGG + Intergenic
903805411 1:26001945-26001967 CTTGGACTTGGGAGGGGGCCGGG + Intergenic
903941812 1:26937160-26937182 CTAGGTATGGGGGTGGGGCCTGG + Intronic
905149658 1:35917839-35917861 CTAGGAGGAGGGAAGGGGCCAGG - Intronic
905196922 1:36287029-36287051 CTAGGTTTTGGCACGGGGCTAGG - Exonic
905876634 1:41435802-41435824 CTGGGAATGGGGAGGGGGCCTGG - Intergenic
906248860 1:44296009-44296031 CTAGGTTTAGGGAGGGGGCCAGG + Intronic
910840683 1:91558432-91558454 CTAGGATTGGGGAGGGGGAAGGG - Intergenic
915737926 1:158096258-158096280 ATAGGGTTACGGAGGGGGCCTGG + Intronic
915819452 1:159006269-159006291 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
915841735 1:159218633-159218655 CTGGGGTTTGGGAGGGGGCTCGG - Intergenic
915900369 1:159842426-159842448 CTTGGTTGAGGGAGGGGTCAAGG + Intronic
917188020 1:172383451-172383473 TTAGTTTTGGGGAGGGGGCTTGG - Intronic
917459905 1:175221022-175221044 CTAGGGTTATGCAAGGGGCCCGG - Intergenic
917788902 1:178487094-178487116 CTCGGCTTTGGGAGGGGTCCCGG - Intergenic
919817886 1:201453125-201453147 CTGGGCTCTGGGAGGGGGCCAGG - Intergenic
921182784 1:212644668-212644690 TAAGGTTTAGGGAGGGGACTTGG + Intergenic
922062207 1:222103698-222103720 CTGTGCTGAGGGAGGGGGCCCGG + Intergenic
922207997 1:223465784-223465806 TTTGCTTTTGGGAGGGGGCCTGG + Intergenic
923120392 1:230984641-230984663 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
1064146252 10:12828665-12828687 CTGGGTTTATGGTGGGGGGCGGG - Intronic
1064322850 10:14321822-14321844 CCAGTTTTGGGGAAGGGGCCTGG + Intronic
1067193489 10:44092501-44092523 CTAGGTTTAGGAAGGTCTCCTGG - Intergenic
1067451686 10:46385558-46385580 CTAGAGTTAGGGAGAGAGCCAGG + Intronic
1067585552 10:47474197-47474219 CTAGAGTTAGGGAGAGAGCCAGG - Intronic
1069627527 10:69877387-69877409 CAAGGTGGAGGGAGGGGGCGTGG - Intronic
1069729429 10:70601263-70601285 GCAGGTTTAGGGAGGGGTCTGGG + Intronic
1070508432 10:77137978-77138000 CTGGGTTAAGGTAGGGAGCCAGG - Intronic
1071517731 10:86310190-86310212 CTGGGCTTGGGGATGGGGCCAGG - Intronic
1071826433 10:89330447-89330469 CTCACTTTAGAGAGGGGGCCAGG + Intronic
1074049593 10:109869541-109869563 CTAGGGTCTGGGAGGGGCCCTGG + Intronic
1077592598 11:3504264-3504286 CTAGGTTTAGTGGGGGTGGCTGG + Intergenic
1081615253 11:44587071-44587093 CTTGGTTGGGGCAGGGGGCCTGG + Intronic
1082006586 11:47422704-47422726 CCAGCTTTAGGAAGGTGGCCTGG + Exonic
1082672800 11:56056228-56056250 CTAGGTTTAGGAAGGGGAGGGGG + Intergenic
1083174678 11:60942185-60942207 CTAGGAGTTGGGAGGGGGCATGG - Intronic
1083842978 11:65315211-65315233 CTGGGTCTCGGGAGGGGGGCGGG - Intronic
1084579614 11:70015011-70015033 CCAGGTCTAGGGTGGAGGCCGGG + Intergenic
1085032455 11:73281003-73281025 CTAGGTTGGGGGAGGGGCCGTGG + Intronic
1087398771 11:97637285-97637307 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
1088890135 11:114037691-114037713 GTAGGTTTAGGGTGGGGTTCAGG + Intergenic
1089572070 11:119417612-119417634 CTACTTTTAGGGAAGGAGCCAGG + Exonic
1091360664 11:134976554-134976576 CTGGGTGGAGGGAGGGTGCCCGG - Intergenic
1091588214 12:1827999-1828021 CAGGGGTTAGGGAGAGGGCCCGG - Intronic
1091801841 12:3329270-3329292 CTAATTTCAGGGAGGGGGGCTGG + Intergenic
1091961921 12:4702971-4702993 CTTTGATGAGGGAGGGGGCCAGG + Intronic
1093173281 12:15882600-15882622 CTAGTGTCAGGGCGGGGGCCTGG + Exonic
1093894463 12:24561801-24561823 CTAAGGTTAGGGGGTGGGCCAGG + Intergenic
1096474400 12:51899326-51899348 CTAGGTTTGGGGAGGATGCGGGG - Intergenic
1097174768 12:57136210-57136232 CCAGGCTCAGGGTGGGGGCCAGG + Intronic
1100284226 12:93149626-93149648 TTAGGATTATGGAAGGGGCCTGG - Intergenic
1101561094 12:105858960-105858982 CTAGGTCTGGGAAGGGGGCTGGG - Intergenic
1103904279 12:124319507-124319529 CTAGGTCCAGGGTGGGGCCCAGG - Intergenic
1103994350 12:124819551-124819573 CTGGGTTGAGGGTGGGGGTCAGG - Intronic
1104975016 12:132548422-132548444 CCGGGTTTAGGGTGGGGGCTGGG - Intronic
1108402961 13:50067116-50067138 AGAGGTTTTGGGTGGGGGCCAGG - Intergenic
1108536934 13:51392453-51392475 CTAGGTTTAGAGAGGTAGGCAGG - Intronic
1108707340 13:53001534-53001556 CTAGGTTAATGGAGGGGGCAGGG + Intergenic
1113714401 13:112492968-112492990 CTAGCTTTGGGAACGGGGCCTGG + Intronic
1113714443 13:112493158-112493180 CTAGCTTTGGGAACGGGGCCTGG + Intronic
1113714616 13:112494031-112494053 CTAGCTTTGGGAATGGGGCCTGG + Intronic
1113714641 13:112494145-112494167 CTAGGTATGGGAACGGGGCCTGG + Intronic
1114568083 14:23647076-23647098 CTGCCTTCAGGGAGGGGGCCAGG - Intergenic
1114659414 14:24335013-24335035 CTAGGTCCGGGGAGGGAGCCGGG + Exonic
1119076037 14:71640192-71640214 CAAGGTTTAGGCCGGGGGCCTGG - Intronic
1120023644 14:79557312-79557334 CTAGGTTTTTGCAGGGGGCAGGG - Intronic
1121101037 14:91250529-91250551 ATAGGTTTGGGCAGGTGGCCCGG - Intronic
1121781067 14:96622931-96622953 CTAGATTTAGGCAGAGGCCCAGG - Intergenic
1122123928 14:99569117-99569139 CTAGGTCTGGGGACGGGGCTTGG - Intronic
1122227001 14:100285870-100285892 CTGGGATTAGGGGGCGGGCCCGG + Intergenic
1122900699 14:104781236-104781258 CAGGGGTTAGGGAGGGGGCCAGG + Intronic
1123152578 14:106197128-106197150 CTAGGTTTAGGAAGGGGAGAGGG + Intergenic
1125814871 15:42575646-42575668 CTGGGCTTAGGGCGGGGGCCTGG + Exonic
1126484939 15:49169944-49169966 CTAGGTGTATGTAGGGCGCCAGG + Intronic
1131616464 15:94021655-94021677 CTAGGTTTGGGGAAGGGTCTTGG - Intergenic
1131870259 15:96756801-96756823 GTAGGTGGTGGGAGGGGGCCGGG + Intergenic
1132296633 15:100739915-100739937 CAAGGGTTAAGGAGGGGGCAGGG - Intergenic
1132813989 16:1817319-1817341 CTAGGACTCAGGAGGGGGCCAGG + Intronic
1133141574 16:3748519-3748541 CTAGGTTTCCAGAGGTGGCCTGG + Intronic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1134191223 16:12122510-12122532 CTGGAGTGAGGGAGGGGGCCAGG + Intronic
1134740646 16:16540634-16540656 CTCTGTCTAGGCAGGGGGCCAGG + Intergenic
1134926856 16:18171538-18171560 CTCTGTCTAGGCAGGGGGCCAGG - Intergenic
1137734605 16:50714375-50714397 GTAGGTTTGGGGTGGGGCCCAGG + Intronic
1140218277 16:73025312-73025334 CCAAGTTAAGAGAGGGGGCCCGG + Intronic
1140288287 16:73625719-73625741 CTAGGTCCAGGGTGGGGCCCAGG + Intergenic
1140761506 16:78113190-78113212 GTAGGTCTGGGGTGGGGGCCTGG - Intronic
1141815254 16:86405118-86405140 CTGGGTTTAGGGAAGTGGACAGG - Intergenic
1141931486 16:87207553-87207575 CTGGGTTTAAGGTGAGGGCCGGG - Intronic
1142952852 17:3497837-3497859 ATAGGTTGGGGGTGGGGGCCTGG - Intronic
1144666354 17:17104927-17104949 CTTGGTTTAGGGAGGGTGGTTGG + Intronic
1146381771 17:32335430-32335452 CTTGATTTAGGCAAGGGGCCTGG - Exonic
1146707452 17:35011649-35011671 CTAGGTTCAGGGAGGAAGACAGG + Exonic
1147401170 17:40180856-40180878 CAAGGTGCAGGGAGGGAGCCAGG - Intronic
1147576128 17:41600077-41600099 CTGGGTTTGGGGTGGGGGCAGGG - Intergenic
1148450934 17:47777528-47777550 CCAGCTTCAGGGAGGTGGCCTGG - Intergenic
1148732419 17:49845569-49845591 CTGGGAATAGGGAGGGGGCTGGG + Intronic
1148749975 17:49940087-49940109 CTGGGAGTAGGGAGGGGGCAGGG + Intergenic
1152237938 17:79148149-79148171 CTAGGTTTTGGGAGCGGTCATGG + Intronic
1153601101 18:6781967-6781989 ATGGGTTTAGGGATGGGGACAGG + Intronic
1156443672 18:37218044-37218066 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
1157013650 18:43682567-43682589 CTAGGTTTAGGAAGGGGAGGGGG + Intergenic
1157292999 18:46423264-46423286 CTTAGTCTAGGGAGGAGGCCTGG + Intronic
1158769276 18:60495102-60495124 CCAGTTTTAGAGAGGGGGCCTGG - Intergenic
1160566451 18:79788991-79789013 CCAGGCTTCGGGAGGGCGCCTGG + Intergenic
1161007237 19:1942668-1942690 CTCGGATTAGGGAGGGGGCTGGG + Intronic
1161029336 19:2050675-2050697 CCGGGTGTAGGGCGGGGGCCAGG + Intronic
1161584083 19:5095748-5095770 CTAGGAGGAGGGAGAGGGCCCGG + Intronic
1162135383 19:8552014-8552036 CCAGGTGCAGGGAAGGGGCCGGG - Exonic
1165329508 19:35133825-35133847 CTAGGCTGAGGGTGGAGGCCAGG - Intronic
1165823434 19:38691991-38692013 CTGGCTGCAGGGAGGGGGCCGGG + Intronic
1167105730 19:47429178-47429200 CCAGCTTTGGGGAGGAGGCCGGG - Exonic
1167234143 19:48303615-48303637 CTGGGTGGAGGGAGGAGGCCCGG - Intronic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
1167658399 19:50781230-50781252 CAAGGTCTGGGGATGGGGCCCGG - Intergenic
1168181136 19:54663750-54663772 GTGGGTTTGGGGAGGGGCCCTGG - Exonic
1168187327 19:54708598-54708620 CTGGGTTTGGGGAGGGTCCCTGG - Intergenic
1168316042 19:55485209-55485231 CAAGGTTTCGGGAGCGGGTCTGG - Exonic
1168673118 19:58256441-58256463 CTAGGTTTAGGAAGGGGAGAGGG + Intronic
927236822 2:20882388-20882410 CTAGTTTTGGGAAGTGGGCCAGG - Intergenic
928807413 2:35176517-35176539 CTAGGTTTAGGAAGGGGAGGGGG + Intergenic
929048837 2:37816807-37816829 CTAGTGTCAGGGCGGGGGCCTGG + Intergenic
929576412 2:43055489-43055511 CCAGGCTCAGGGTGGGGGCCGGG + Intergenic
930847290 2:55919383-55919405 GTAGGTCTGGGTAGGGGGCCTGG + Intronic
932471489 2:71962397-71962419 CAAGGGGTAGGGTGGGGGCCTGG - Intergenic
933484956 2:82909534-82909556 CCAGTTTTAGAGATGGGGCCTGG + Intergenic
934713451 2:96529948-96529970 CTGGGGTGAGGGAGGGGGGCTGG + Intergenic
934944122 2:98524449-98524471 CTGGGTTGGGGGAGGAGGCCAGG + Intronic
935181017 2:100691364-100691386 CTTGGTATTGGGAGGGGGCCTGG - Intergenic
936229579 2:110688454-110688476 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
936254103 2:110894660-110894682 CTAGGTTGAGGTAGGTGTCCAGG - Intronic
936735707 2:115440623-115440645 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
936976200 2:118224553-118224575 CCAGGTTTTGGGGGGTGGCCCGG + Intergenic
937408047 2:121649046-121649068 CTCGGGTTAGGAAGGGGGCCCGG + Intronic
938145668 2:128833165-128833187 CTAGCATGAGGGAGGGAGCCTGG + Intergenic
939659346 2:144868884-144868906 CTAGGGCTAGGGATGTGGCCAGG - Intergenic
942135844 2:172924437-172924459 CTAGTATTAGGGAGATGGCCTGG - Intronic
942813478 2:180023816-180023838 TTGGGTTTGGGGTGGGGGCCTGG + Intergenic
943713516 2:191124664-191124686 TTAGGTTTAGGGAGGGAGGTGGG - Intronic
945458744 2:210079973-210079995 CTTGGATTAGGGAGGAGGCCAGG - Intronic
946177080 2:217928584-217928606 CTGGGTTTGGGGAAAGGGCCAGG - Intronic
947766999 2:232644256-232644278 AGAGGTTTGGGGAGGGGGTCTGG - Intronic
948738588 2:240026982-240027004 CTTGGTTTAGGAAGGGGGGGGGG + Intergenic
948807647 2:240459887-240459909 CTTGGTGGAGGGAGGCGGCCCGG + Intronic
1169068880 20:2709645-2709667 ACAGGCTCAGGGAGGGGGCCTGG + Intronic
1169964093 20:11196166-11196188 CTTGGTTTGGGGGGGGGGCGGGG - Intergenic
1170775206 20:19369194-19369216 CTTGGTTAGGGGAGGCGGCCAGG - Intronic
1171983404 20:31642875-31642897 ACAGAATTAGGGAGGGGGCCAGG - Intronic
1172022644 20:31925189-31925211 CTAGGGATAGGGTGGGGGCAGGG + Intronic
1172355769 20:34278600-34278622 TCAGGTTTAGGAAGGGAGCCTGG - Intergenic
1173504566 20:43576643-43576665 TTAAGTTTGGGGTGGGGGCCGGG + Intronic
1173728547 20:45313267-45313289 TTAGGGTGAGGGAGGGGGTCAGG - Intronic
1174299416 20:49570658-49570680 ATATGTTTAGGAAGGTGGCCAGG + Intergenic
1175202879 20:57290119-57290141 CCTGGTTTAGGGAGGGGGCTTGG + Intergenic
1175516867 20:59575669-59575691 CTGGAATTAGGGAGGGGCCCTGG + Intergenic
1176089880 20:63314049-63314071 CTAGGAGAAGGGAGGGTGCCTGG - Intronic
1178365212 21:31984651-31984673 CCAGATCCAGGGAGGGGGCCAGG + Intronic
1178427135 21:32487770-32487792 CAAGGTTTGGGGACGGGGCATGG - Intronic
1179926954 21:44540015-44540037 CCAGGGTCAGGCAGGGGGCCGGG + Exonic
1179929621 21:44558580-44558602 CCAGGGTCAGGCAGGGGGCCGGG + Exonic
1179931507 21:44573902-44573924 CCAGGCTCAGGCAGGGGGCCGGG - Exonic
1179934245 21:44592319-44592341 CCAGGCTCAGGCAGGGGGCCGGG + Exonic
1179935389 21:44600765-44600787 CCAGGCTCAGGCAGGGGGCCGGG - Exonic
1179939185 21:44627285-44627307 CCAGGGTCAGGCAGGGGGCCGGG - Exonic
1179942032 21:44646572-44646594 CCAGGCTCAGGGAGGGGGCCGGG - Exonic
1179948623 21:44697330-44697352 CCAGGCTCAGGCAGGGGGCCGGG - Exonic
1179949589 21:44702309-44702331 CCAGGGTCAGGCAGGGGGCCGGG - Intronic
1180618153 22:17141992-17142014 GAAGGTTGTGGGAGGGGGCCAGG + Intronic
1181507203 22:23367677-23367699 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
1181967413 22:26666793-26666815 CTGGGCCTGGGGAGGGGGCCTGG + Intergenic
1182425090 22:30267458-30267480 CTGGCTTTGGGGAGTGGGCCTGG - Intergenic
1182561163 22:31160337-31160359 CAAAGTTTAGGGACGGGGGCGGG + Intronic
1182615289 22:31584447-31584469 TTACTTGTAGGGAGGGGGCCAGG - Intronic
1182880597 22:33729737-33729759 CAAGGCTTAGGGAAGGGGCTAGG - Intronic
1183329678 22:37212531-37212553 GCAGGTTAAGGGAGGAGGCCCGG + Intergenic
1183863801 22:40688423-40688445 CCAGTTTTAGGGAGAAGGCCTGG + Intergenic
1185317397 22:50185063-50185085 CTGGGTACAGCGAGGGGGCCGGG + Intergenic
949980892 3:9501110-9501132 CAAGGCTTAGGAAGGGGGACAGG + Exonic
952150756 3:30587870-30587892 CAAGGGTTAAGGAGGGGGCAAGG - Intergenic
952217223 3:31289730-31289752 GTAGGGGTAGGCAGGGGGCCTGG - Intergenic
952233240 3:31453616-31453638 CTAGGTTTTGGCACGGGGCTAGG - Intergenic
953005656 3:38976827-38976849 CTGGGTTTGGGTAGGGGGACGGG - Intergenic
953376428 3:42432065-42432087 CTTGGTCTAGGGAAGGGGGCAGG + Intergenic
954614788 3:51964128-51964150 CTGGGGCTGGGGAGGGGGCCTGG - Intronic
954701069 3:52451198-52451220 CTGGGGTTGGGGAGGGGGTCGGG - Exonic
955152299 3:56380030-56380052 TTATATTTAGTGAGGGGGCCCGG - Intronic
960027325 3:113023980-113024002 ATAGATTTAGGGAGGTGGCAAGG + Intergenic
960107029 3:113808914-113808936 CTAGGTTTAGTGAGGGACACTGG - Intronic
960639689 3:119813529-119813551 GTAGGATTAGGGATGGTGCCAGG + Intronic
963067036 3:141272105-141272127 CTTGGTATAGGGAGGTGACCTGG + Intronic
963835375 3:150053366-150053388 GTAGGAGTAGAGAGGGGGCCAGG - Intergenic
964691481 3:159454564-159454586 CTGGGTTTGGGAAGGGGGCATGG + Intronic
964851102 3:161097065-161097087 CTAGGTCTAGGGTGGGGCCTGGG - Intronic
966726572 3:183114297-183114319 CTTGGTTTAGGAAGGGGGGCGGG - Intronic
967012801 3:185452528-185452550 ATAAGTTTTGGGATGGGGCCAGG - Intronic
969474644 4:7414590-7414612 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
969566461 4:7981696-7981718 CTCGGTACAGGGAGGGGACCAGG - Intronic
972456788 4:39263115-39263137 CTTGGTTTATGGAGGGGGAAGGG + Intronic
974010840 4:56606007-56606029 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
979441655 4:120757493-120757515 CTAGGTTAAGGGATGTGGCCAGG + Intronic
980053610 4:128060886-128060908 CTAGGCTAAGGGAGGGGACGCGG - Intergenic
980875373 4:138657044-138657066 CCAGGTATAGGGAGAAGGCCAGG - Intergenic
981932765 4:150208636-150208658 CTGGGGTTAGGGAGGAGGCTGGG + Intronic
985340166 4:188942728-188942750 CTTGGGTTAGGGGAGGGGCCTGG + Intergenic
985968002 5:3352262-3352284 GTGGGTTGAGGGAGGGGGGCAGG + Intergenic
991713751 5:69432632-69432654 ATAGGTTTAGGAATGTGGCCTGG - Exonic
995933546 5:117481384-117481406 CCAGGTTTAGGGAGGAGGTGGGG + Intergenic
997880529 5:137585239-137585261 CTAGCTTTAGGGAGTAAGCCAGG + Intronic
998159257 5:139803838-139803860 CTGGGCTTAGGGAGGGGGCCTGG + Intronic
1001997740 5:176175352-176175374 CAGGGTTTAGGAAGGGAGCCCGG - Intergenic
1002173045 5:177385970-177385992 GTAGGACTAGGGAGGGAGCCTGG - Exonic
1002379699 5:178817823-178817845 CCAGGTTGAGGGAAGGGGCCAGG - Intergenic
1002431548 5:179206965-179206987 CGAGCTTTAAGGAGGGGCCCTGG + Intronic
1002526037 5:179816764-179816786 CAAGGAGTAGGGAGGGGGGCTGG - Intronic
1002527595 5:179823558-179823580 CTTGGGTTAGGGATGGGGTCTGG + Intronic
1004562343 6:16761876-16761898 CCAGGTTTGGGAAGGGGGCGGGG + Intergenic
1004921667 6:20381774-20381796 CTAGGATTATGGAAGGGGCCTGG - Intergenic
1006407727 6:33855054-33855076 TTAGATTTGGGGAGGGGACCAGG + Intergenic
1006438617 6:34039934-34039956 CCAGGCTAAGGGAGGGGGCAGGG + Intronic
1006843569 6:37047641-37047663 CTAGGGTTAGAGATGGGGTCCGG - Intergenic
1007763805 6:44149695-44149717 CTGGGGTGAGGGTGGGGGCCAGG - Intronic
1008510405 6:52270705-52270727 CTAGGTTCAATGAGAGGGCCTGG + Intronic
1009773983 6:68180868-68180890 CTAGGTTTAGGAAGGGGAGGGGG + Intergenic
1011614151 6:89182677-89182699 GTAGGTTTGGGGTGGGGCCCAGG - Intronic
1012723504 6:102779834-102779856 CCAGATTGAGGAAGGGGGCCAGG + Intergenic
1015940027 6:138440359-138440381 GTAGGTTGAGGGAAGGTGCCTGG + Intronic
1018744312 6:166750292-166750314 CTAGGGTTGGGGTGGGGCCCTGG - Intronic
1018916752 6:168137159-168137181 CTAGGTGTATAGAGGGGGGCTGG - Intergenic
1020979991 7:15054799-15054821 CTTGGTTTAGGAAGGGGAGCGGG - Intergenic
1023887961 7:44374498-44374520 GGAAGTTTAGGGAGGGGGCCTGG - Intergenic
1023990936 7:45127853-45127875 CTAGGTGTGGGGTGGGGGGCAGG - Intergenic
1026912148 7:74097197-74097219 CTAGGCTCAGGGAGGGGCCAAGG - Intronic
1029634827 7:101776804-101776826 CTTGGTATAGGAAGGGGACCAGG + Intergenic
1029657542 7:101936949-101936971 CTAAGTCTAGGGTGGGGCCCAGG - Intronic
1031839956 7:126725974-126725996 CTAGTGTTAGAGATGGGGCCTGG - Intronic
1033669511 7:143477811-143477833 CTAGGGGCAGGGAGGAGGCCAGG + Intergenic
1034462902 7:151208128-151208150 CTCGGTTAATGGAAGGGGCCAGG + Intronic
1034531755 7:151700368-151700390 GTAGGTCTGGGGTGGGGGCCTGG - Intronic
1035626777 8:1076816-1076838 CTTGGTCTTGGGGGGGGGCCTGG - Intergenic
1036146244 8:6257644-6257666 CAATGTTGGGGGAGGGGGCCTGG - Intergenic
1037787964 8:21913499-21913521 CTGGGGTTGGGCAGGGGGCCTGG - Intronic
1038020550 8:23548983-23549005 TTAGATTTGGGGAGGGGTCCTGG - Intronic
1039190415 8:34967458-34967480 CTAGGTTTTGGGAGGGATTCAGG + Intergenic
1041319961 8:56602780-56602802 CAAGGTTTAGGGAGGGGTTTGGG + Intergenic
1041354447 8:56985458-56985480 CTGGGTGTCGGGAGGGGGCAGGG - Intronic
1042786765 8:72556371-72556393 GTAGGTTGAGAGAGGGGGCAGGG + Intronic
1047720581 8:127635345-127635367 GTAGGTTGAGGGTGGGGCCCAGG - Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048807105 8:138250996-138251018 CTAGGTTGAGGGATGTGGCTGGG - Exonic
1048865686 8:138760147-138760169 CCAGGCTCAGGGAAGGGGCCTGG - Intronic
1048968811 8:139632676-139632698 CTATCTTTAGGGAGGGAGCGGGG - Intronic
1049551379 8:143261534-143261556 CTAGGTTTGCGGAGGAAGCCAGG - Intronic
1049580693 8:143409210-143409232 CCAGGTAGAGGGTGGGGGCCAGG + Intergenic
1050187766 9:2993054-2993076 CCAGCTTTATGGAGAGGGCCTGG - Intergenic
1053901550 9:42800439-42800461 CTAGGTCTTGGGAGGAGGGCAGG + Intergenic
1055259186 9:74412547-74412569 CTGTGTTGAGGGAGGGGGCAGGG + Intergenic
1057278155 9:93687138-93687160 CCAGCCTTAGGGATGGGGCCTGG + Intergenic
1057384981 9:94599036-94599058 CTAGGTGTTGGGAGGGGGAATGG - Intergenic
1058762561 9:108149289-108149311 CTATGTTTATGAAGGGGGCTGGG - Intergenic
1060150897 9:121287432-121287454 GTAGGTCTAGGGTGGGGCCCGGG - Intronic
1060531545 9:124349963-124349985 TTAGGCTGAGGGATGGGGCCTGG - Intronic
1060666891 9:125437009-125437031 CTAGGTATAGGGTGGGGGAGAGG + Intergenic
1061473311 9:130844508-130844530 TTTGGTTGAGGGAGGGGGACAGG + Intronic
1061903120 9:133683174-133683196 CTAGGCTTGGGGAGGCTGCCAGG + Intronic
1062160276 9:135075930-135075952 CCGGGGTTGGGGAGGGGGCCAGG + Intronic
1062367492 9:136218236-136218258 CCAGGTTCAGGGAGGGGTCCTGG - Intronic
1185576077 X:1173426-1173448 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
1186741112 X:12518640-12518662 CTAGGATTAGGAAGGTGGCAAGG + Intronic
1187842313 X:23501516-23501538 CTAGCTTTAGGGAGGAGTTCTGG - Intergenic
1195178172 X:102331040-102331062 CAAGTTTCAGGGAAGGGGCCTGG + Intergenic
1195180692 X:102356053-102356075 CAAGTTTCAGGGAAGGGGCCTGG - Intergenic
1195853605 X:109308217-109308239 ATAGGGATAGGGAGGAGGCCTGG - Intergenic
1196439090 X:115702238-115702260 CTAGGTTCCTGGAGGGTGCCAGG + Intergenic
1196826477 X:119744194-119744216 CTAAGTTTTGGGATGAGGCCGGG + Intergenic
1197221363 X:123916837-123916859 CTAGGTTTGAGGTGGGGCCCAGG - Intergenic
1199767516 X:150952123-150952145 CTAGGTCTAGGGCAGGGGGCAGG + Intergenic
1200845795 Y:7831408-7831430 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic