ID: 906251241

View in Genome Browser
Species Human (GRCh38)
Location 1:44312459-44312481
Sequence CGCTGTAGCCCGAGGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906251241_906251244 15 Left 906251241 1:44312459-44312481 CCTTATTCCCTCGGGCTACAGCG 0: 1
1: 0
2: 0
3: 3
4: 44
Right 906251244 1:44312497-44312519 TAACCTTTTCTAGCTCCCCGAGG 0: 1
1: 0
2: 1
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906251241 Original CRISPR CGCTGTAGCCCGAGGGAATA AGG (reversed) Intronic
905272195 1:36794369-36794391 AGCTGTGGCCCGAGGGAGAAAGG - Intergenic
906251241 1:44312459-44312481 CGCTGTAGCCCGAGGGAATAAGG - Intronic
1076196559 10:128522679-128522701 GGCTGTGGCCCCAGAGAATAAGG - Intergenic
1077219046 11:1407327-1407349 CGGTGTTGCCAGAGGGCATAGGG - Intronic
1077510128 11:2955231-2955253 CTCTGTCGCCCAATGGAATACGG + Intronic
1079023076 11:16924888-16924910 CCCTGAAGCCCGCGGGCATAGGG - Intronic
1079469409 11:20764022-20764044 CACTGTTGCCTGTGGGAATATGG + Intronic
1080180735 11:29422905-29422927 TGGTGTAGACAGAGGGAATATGG - Intergenic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1092173432 12:6387575-6387597 ATCTGTAGCCTAAGGGAATATGG - Intronic
1092354394 12:7782592-7782614 ACCTGTAGCCCTAGGGACTAGGG + Intergenic
1096960753 12:55574719-55574741 CTCTGTAGCCCCAAGGAACATGG - Exonic
1104915973 12:132264720-132264742 CGCTGTGGCCAGAGGAAATAGGG + Intronic
1107171925 13:37353159-37353181 GGCTGGAGCCAGAGGGGATAGGG - Intergenic
1111895135 13:94132463-94132485 CGCTGTAGCCTCATGGAACAGGG + Intronic
1121782257 14:96629538-96629560 AGCTGTAGCAGGAGGAAATAGGG + Intergenic
1150646479 17:66981199-66981221 GGCAGAAGCGCGAGGGAATATGG + Intronic
1156139111 18:34083912-34083934 CGCAGTAGCCCTAAGGAAGAAGG - Intronic
1162559165 19:11406122-11406144 GGCTGGAGCCCGAGGGAGGAGGG - Intronic
1163830917 19:19546842-19546864 TGCTGTAGCCCCGGGGCATACGG - Intergenic
926773288 2:16397210-16397232 CACTGCAGCCCCAGGGAGTAGGG - Intergenic
928001023 2:27523225-27523247 CACTGAAGCCTGAGGGAATGAGG - Intronic
931707474 2:64959195-64959217 GGCTGGAGCCGGGGGGAATAGGG - Intergenic
1173831550 20:46092143-46092165 CGCAGGAGCCCGAGGGAGGAGGG - Intergenic
1174983258 20:55421215-55421237 CGTTGCAGCCTGAGGGAACAAGG + Intergenic
1176178042 20:63737830-63737852 CGCTGTAGCCCCCAGGAAGAGGG + Exonic
1177081861 21:16649629-16649651 CTCTGTAGCCAGAGGGGTTAAGG - Intergenic
1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG + Exonic
960926577 3:122800454-122800476 GGCAGTAGCCAGAGGGAATGTGG + Intronic
961007319 3:123413681-123413703 AGCTGTAGCCTGAGGGATTTAGG - Intronic
966209836 3:177441921-177441943 CGGTGTAGCACGATGGAATCTGG + Intergenic
970887267 4:21000776-21000798 CGCTGTAGCTGGAGTGAGTAAGG - Intronic
971372081 4:26027861-26027883 CGCAGTAGCCAGAGTTAATAAGG + Intergenic
1008649213 6:53546046-53546068 CTCTGTAGTGCGAGGGAAGAGGG - Intronic
1013149353 6:107429213-107429235 AGCTGTAGCCACAGGAAATAAGG - Intronic
1013596217 6:111663266-111663288 GGCTGTAGCCCTGGGAAATAGGG - Intronic
1024284622 7:47746604-47746626 AGCTGTAGCCCAAGTGAAGATGG + Intronic
1032252900 7:130272975-130272997 CGCTGTGTCCCAAGGGAATGGGG + Intronic
1042123585 8:65514176-65514198 CTCTGTAGCCCAAGGGCATTTGG - Intergenic
1049600202 8:143504067-143504089 CCCTGCAGCCCGAGGGAAGGAGG - Intronic
1053785583 9:41650452-41650474 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054174302 9:61864418-61864440 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054449160 9:65393463-65393485 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054663236 9:67716373-67716395 CTCTGTACCCAGAGGGAATTAGG - Intergenic
1058147856 9:101431415-101431437 CTCTGTAGCCCGAGGCCAAATGG - Intronic
1192656871 X:73002592-73002614 CGCTGTAGACCGAAGGGATAAGG - Intergenic
1192665249 X:73080409-73080431 CGCTGTAGACCGAAGGGATAAGG + Intergenic
1202112376 Y:21436062-21436084 CACTGTAGCCTGGGGTAATAGGG - Intergenic