ID: 906252439

View in Genome Browser
Species Human (GRCh38)
Location 1:44321109-44321131
Sequence CTGGCTTTCCTGGGACATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906252439_906252448 12 Left 906252439 1:44321109-44321131 CCTTGATGTCCCAGGAAAGCCAG 0: 1
1: 0
2: 2
3: 14
4: 273
Right 906252448 1:44321144-44321166 CAAAACATACCCACTAATATTGG 0: 1
1: 0
2: 3
3: 9
4: 142
906252439_906252449 13 Left 906252439 1:44321109-44321131 CCTTGATGTCCCAGGAAAGCCAG 0: 1
1: 0
2: 2
3: 14
4: 273
Right 906252449 1:44321145-44321167 AAAACATACCCACTAATATTGGG 0: 1
1: 0
2: 1
3: 21
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906252439 Original CRISPR CTGGCTTTCCTGGGACATCA AGG (reversed) Intronic