ID: 906252441

View in Genome Browser
Species Human (GRCh38)
Location 1:44321118-44321140
Sequence GGAGGATACCTGGCTTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 905
Summary {0: 1, 1: 5, 2: 459, 3: 149, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906252441_906252449 4 Left 906252441 1:44321118-44321140 CCCAGGAAAGCCAGGTATCCTCC 0: 1
1: 5
2: 459
3: 149
4: 291
Right 906252449 1:44321145-44321167 AAAACATACCCACTAATATTGGG 0: 1
1: 0
2: 1
3: 21
4: 314
906252441_906252448 3 Left 906252441 1:44321118-44321140 CCCAGGAAAGCCAGGTATCCTCC 0: 1
1: 5
2: 459
3: 149
4: 291
Right 906252448 1:44321144-44321166 CAAAACATACCCACTAATATTGG 0: 1
1: 0
2: 3
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906252441 Original CRISPR GGAGGATACCTGGCTTTCCT GGG (reversed) Intronic