ID: 906252441 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:44321118-44321140 |
| Sequence | GGAGGATACCTGGCTTTCCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 905 | |||
| Summary | {0: 1, 1: 5, 2: 459, 3: 149, 4: 291} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 906252441_906252449 | 4 | Left | 906252441 | 1:44321118-44321140 | CCCAGGAAAGCCAGGTATCCTCC | 0: 1 1: 5 2: 459 3: 149 4: 291 |
||
| Right | 906252449 | 1:44321145-44321167 | AAAACATACCCACTAATATTGGG | 0: 1 1: 0 2: 1 3: 21 4: 314 |
||||
| 906252441_906252448 | 3 | Left | 906252441 | 1:44321118-44321140 | CCCAGGAAAGCCAGGTATCCTCC | 0: 1 1: 5 2: 459 3: 149 4: 291 |
||
| Right | 906252448 | 1:44321144-44321166 | CAAAACATACCCACTAATATTGG | 0: 1 1: 0 2: 3 3: 9 4: 142 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 906252441 | Original CRISPR | GGAGGATACCTGGCTTTCCT GGG (reversed) | Intronic | ||