ID: 906252444

View in Genome Browser
Species Human (GRCh38)
Location 1:44321128-44321150
Sequence TGTTTTGCCGGGAGGATACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906252444_906252449 -6 Left 906252444 1:44321128-44321150 CCAGGTATCCTCCCGGCAAAACA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 906252449 1:44321145-44321167 AAAACATACCCACTAATATTGGG 0: 1
1: 0
2: 1
3: 21
4: 314
906252444_906252448 -7 Left 906252444 1:44321128-44321150 CCAGGTATCCTCCCGGCAAAACA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 906252448 1:44321144-44321166 CAAAACATACCCACTAATATTGG 0: 1
1: 0
2: 3
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906252444 Original CRISPR TGTTTTGCCGGGAGGATACC TGG (reversed) Intronic