ID: 906252448

View in Genome Browser
Species Human (GRCh38)
Location 1:44321144-44321166
Sequence CAAAACATACCCACTAATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906252444_906252448 -7 Left 906252444 1:44321128-44321150 CCAGGTATCCTCCCGGCAAAACA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 906252448 1:44321144-44321166 CAAAACATACCCACTAATATTGG 0: 1
1: 0
2: 3
3: 9
4: 142
906252439_906252448 12 Left 906252439 1:44321109-44321131 CCTTGATGTCCCAGGAAAGCCAG 0: 1
1: 0
2: 2
3: 14
4: 273
Right 906252448 1:44321144-44321166 CAAAACATACCCACTAATATTGG 0: 1
1: 0
2: 3
3: 9
4: 142
906252442_906252448 2 Left 906252442 1:44321119-44321141 CCAGGAAAGCCAGGTATCCTCCC 0: 1
1: 0
2: 0
3: 55
4: 205
Right 906252448 1:44321144-44321166 CAAAACATACCCACTAATATTGG 0: 1
1: 0
2: 3
3: 9
4: 142
906252441_906252448 3 Left 906252441 1:44321118-44321140 CCCAGGAAAGCCAGGTATCCTCC 0: 1
1: 5
2: 459
3: 149
4: 291
Right 906252448 1:44321144-44321166 CAAAACATACCCACTAATATTGG 0: 1
1: 0
2: 3
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906252448 Original CRISPR CAAAACATACCCACTAATAT TGG Intronic