ID: 906252449

View in Genome Browser
Species Human (GRCh38)
Location 1:44321145-44321167
Sequence AAAACATACCCACTAATATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 314}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906252439_906252449 13 Left 906252439 1:44321109-44321131 CCTTGATGTCCCAGGAAAGCCAG 0: 1
1: 0
2: 2
3: 14
4: 273
Right 906252449 1:44321145-44321167 AAAACATACCCACTAATATTGGG 0: 1
1: 0
2: 1
3: 21
4: 314
906252442_906252449 3 Left 906252442 1:44321119-44321141 CCAGGAAAGCCAGGTATCCTCCC 0: 1
1: 0
2: 0
3: 55
4: 205
Right 906252449 1:44321145-44321167 AAAACATACCCACTAATATTGGG 0: 1
1: 0
2: 1
3: 21
4: 314
906252444_906252449 -6 Left 906252444 1:44321128-44321150 CCAGGTATCCTCCCGGCAAAACA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 906252449 1:44321145-44321167 AAAACATACCCACTAATATTGGG 0: 1
1: 0
2: 1
3: 21
4: 314
906252441_906252449 4 Left 906252441 1:44321118-44321140 CCCAGGAAAGCCAGGTATCCTCC 0: 1
1: 5
2: 459
3: 149
4: 291
Right 906252449 1:44321145-44321167 AAAACATACCCACTAATATTGGG 0: 1
1: 0
2: 1
3: 21
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906252449 Original CRISPR AAAACATACCCACTAATATT GGG Intronic