ID: 906253897

View in Genome Browser
Species Human (GRCh38)
Location 1:44332736-44332758
Sequence TGGCTCCTCACTAGTATTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906253897_906253905 12 Left 906253897 1:44332736-44332758 CCGGGAATACTAGTGAGGAGCCA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 906253905 1:44332771-44332793 GGCGGAGGCCCATCCTTATGAGG 0: 1
1: 0
2: 0
3: 4
4: 54
906253897_906253909 22 Left 906253897 1:44332736-44332758 CCGGGAATACTAGTGAGGAGCCA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 906253909 1:44332781-44332803 CATCCTTATGAGGGACCACCAGG 0: 1
1: 0
2: 0
3: 4
4: 79
906253897_906253903 -3 Left 906253897 1:44332736-44332758 CCGGGAATACTAGTGAGGAGCCA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 906253903 1:44332756-44332778 CCATAGTGGGAGCCAGGCGGAGG 0: 1
1: 0
2: 2
3: 13
4: 172
906253897_906253906 13 Left 906253897 1:44332736-44332758 CCGGGAATACTAGTGAGGAGCCA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 906253906 1:44332772-44332794 GCGGAGGCCCATCCTTATGAGGG 0: 1
1: 0
2: 0
3: 2
4: 60
906253897_906253900 -9 Left 906253897 1:44332736-44332758 CCGGGAATACTAGTGAGGAGCCA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 906253900 1:44332750-44332772 GAGGAGCCATAGTGGGAGCCAGG 0: 1
1: 0
2: 0
3: 28
4: 221
906253897_906253901 -6 Left 906253897 1:44332736-44332758 CCGGGAATACTAGTGAGGAGCCA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 906253901 1:44332753-44332775 GAGCCATAGTGGGAGCCAGGCGG 0: 1
1: 0
2: 1
3: 44
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906253897 Original CRISPR TGGCTCCTCACTAGTATTCC CGG (reversed) Intronic
902862224 1:19254581-19254603 TGCCTACTCATTAGCATTCCTGG - Intronic
906253897 1:44332736-44332758 TGGCTCCTCACTAGTATTCCCGG - Intronic
913205939 1:116538807-116538829 TGGCTCCTCACAAGCAGTACAGG + Intronic
917972651 1:180218889-180218911 CATCTCCTCACTTGTATTCCTGG + Intergenic
918877483 1:190067392-190067414 TTGCTCCAGACTAGAATTCCAGG - Intergenic
919176412 1:194024725-194024747 ATGCTCCTCACTTGTTTTCCAGG + Intergenic
919806953 1:201386033-201386055 AGGCTCCCCACTAGTCTGCCGGG + Intronic
1064028637 10:11869468-11869490 AGGCTCCTCCCTTGTCTTCCAGG + Exonic
1067166517 10:43869939-43869961 TGGCTCCTGGCTGGTATTACTGG + Intergenic
1068422134 10:56808051-56808073 TGGCTCTTGAATAGTATTTCTGG - Intergenic
1069379843 10:67831705-67831727 TGGCTCCTCAATTGGATACCAGG + Intronic
1070484807 10:76919952-76919974 TGCCTTCTCATTAGTATTCTAGG - Intronic
1073419692 10:103414629-103414651 TGGCTTCTCACTAATATCCCAGG - Intronic
1075569627 10:123530469-123530491 TTCCTCCCCACTAGTGTTCCTGG + Intergenic
1077698516 11:4418099-4418121 TTCCTCCTCACTGGTTTTCCAGG + Intergenic
1085828629 11:79875308-79875330 TTACTCCTCACTAATATTCCTGG - Intergenic
1088288181 11:108208397-108208419 TGGGTTCTCACTAGGTTTCCCGG - Intronic
1088780679 11:113131372-113131394 TGCCTCCTCACTGGGCTTCCAGG + Intronic
1089453494 11:118612478-118612500 TGGCACCTCCCCAGAATTCCTGG - Intronic
1092202493 12:6594719-6594741 TTCCTCCTCACTAGTCTTCACGG + Intronic
1092248522 12:6877771-6877793 TGGGGTCTCACTAGTCTTCCAGG - Intronic
1092527757 12:9319595-9319617 TGGGTCCTCATGAGTATTCAAGG - Intergenic
1092539503 12:9412163-9412185 TGGGTCCTCATGAGTATTCGAGG + Intergenic
1094500005 12:31012642-31012664 TGGGTCCTCATGAGTATTCGAGG - Intergenic
1096589660 12:52649189-52649211 TGGCTCCTCTCTAAAATCCCAGG + Intronic
1096806192 12:54142664-54142686 TGGCTCCTCACTTGTATTGTGGG + Intergenic
1098063375 12:66586325-66586347 TGGCTCATAACTTGGATTCCAGG + Intronic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1108552886 13:51564086-51564108 TGGCTGCACACCAGAATTCCTGG - Intergenic
1113423689 13:110189838-110189860 TGTCTCTCCACTAGTATTTCAGG + Intronic
1115015420 14:28606242-28606264 TGGCTCCTGAGTAGTACTCCAGG - Intergenic
1118186527 14:63543082-63543104 TGGCTCCTCGCTCACATTCCTGG + Exonic
1122538479 14:102482806-102482828 TGGCTTCTCAGTAGCAATCCTGG - Intronic
1129109476 15:73329228-73329250 TGGCTGCTCACTCGTTCTCCAGG - Intronic
1129543363 15:76369987-76370009 TGGCTCCTCACTATTAGTAGAGG - Intronic
1132053990 15:98635241-98635263 TGGCTCCTCAGTGGTGTCCCTGG - Intergenic
1132353768 15:101156580-101156602 TGGCTCCTTCCCAGCATTCCTGG - Intergenic
1133422161 16:5655028-5655050 TGCGTCCTCACTAGGACTCCTGG - Intergenic
1135650534 16:24202564-24202586 TGGCTCCTAGCTAGGCTTCCTGG + Intronic
1139817920 16:69691393-69691415 TGGCTCCTCAGTAACATTACAGG - Intronic
1140914491 16:79482331-79482353 TGGCACCTCTCCAGTGTTCCAGG + Intergenic
1141432282 16:83976453-83976475 TGACTCCACACTGGGATTCCTGG + Intronic
1142707810 17:1707760-1707782 TGGCTTCTCTCTAGTCTTTCAGG + Exonic
1146132747 17:30292327-30292349 TGGCTTCTCACAAGGCTTCCTGG - Intergenic
1149180628 17:53932119-53932141 TGGCTCTTGGATAGTATTCCCGG - Intergenic
1149488413 17:57063793-57063815 TGGTTCCTGTCAAGTATTCCAGG - Intergenic
1152783000 17:82234662-82234684 TGGCTCCTCACTCCTCCTCCCGG - Exonic
1157416508 18:47507873-47507895 TGTCACCTCACTATTAGTCCTGG + Intergenic
1158846583 18:61449472-61449494 TGGCTCCTCATTAATAGACCAGG + Intronic
1159225141 18:65523669-65523691 TGGCTCCTGAATAGCATTTCTGG + Intergenic
1165090294 19:33383881-33383903 TGGCTCCTCGTTGGTGTTCCTGG + Intergenic
1166731085 19:45059412-45059434 TGGCATCTCACTATTACTCCCGG + Intronic
928387666 2:30883997-30884019 TGACTCCTCCCTAGCATACCTGG - Intergenic
933002483 2:76943103-76943125 TGCCTTCACACTAGAATTCCGGG + Intronic
936787368 2:116110211-116110233 AGGCTCCTCAGTATTTTTCCTGG - Intergenic
938813347 2:134873970-134873992 TACCTCCTTACTAGTATTCTTGG + Intronic
945062720 2:205923228-205923250 TGGCTCCTCACCAGCATGGCGGG + Intergenic
946160896 2:217835285-217835307 TGGCTCCTCACTGGTGCTCAGGG + Intronic
946201044 2:218070922-218070944 TGGCTCCTCCCTGATTTTCCAGG - Intronic
946342752 2:219082048-219082070 TGGCTCCAAACTAGTATTGATGG + Intronic
947039725 2:225903263-225903285 TGGCTCATGACTTGTAATCCTGG + Intergenic
947841516 2:233210786-233210808 TGGCTTCAAACTAGTCTTCCTGG - Intronic
1170059228 20:12242072-12242094 TGGCACCTTATTAGTATTCAAGG - Intergenic
1170745256 20:19093222-19093244 TGGCTGCACACTGGCATTCCAGG + Intergenic
1173923710 20:46765002-46765024 TGGCCCCTCGCTGGTTTTCCTGG - Intergenic
1177395052 21:20523389-20523411 TGGCTTCTCTCTAGTAAGCCTGG + Intergenic
1182702741 22:32253672-32253694 TGGCTCCTCTCTGTAATTCCAGG - Intronic
1184832908 22:47001221-47001243 TTGCTTCTCACTAGCATTCTGGG - Intronic
950006607 3:9695569-9695591 TGGCTCCCCTCAAGGATTCCAGG - Intronic
954331008 3:49890267-49890289 TGGCTCCTCACAGATAATCCAGG - Intronic
956357341 3:68408680-68408702 TGACTGCCCACTATTATTCCAGG + Intronic
956704697 3:71989284-71989306 TGGCTCCTCCCTCTAATTCCAGG + Intergenic
959509882 3:107198783-107198805 TTGCTGCTCAGTATTATTCCTGG - Intergenic
962312612 3:134337107-134337129 TGGCTCCTCACCAGCTATCCGGG - Intergenic
964437680 3:156671849-156671871 TGTCTCCTAACTAGTCTTCTAGG - Intergenic
978965153 4:114731780-114731802 AGGCTGCTCATTAGTATTTCTGG + Intergenic
979892729 4:126119829-126119851 TGGCTCCCCAGTGGCATTCCTGG - Intergenic
982708226 4:158733807-158733829 TTGCTCCTCACTAGTATCCAGGG - Intergenic
982779013 4:159470909-159470931 TGGAGCCTCACCAGTATTACTGG + Intergenic
984774591 4:183469916-183469938 TGGCTCTTCACTTCTTTTCCAGG + Intergenic
988278606 5:29114773-29114795 TGGCCCCTCCCCAGTTTTCCTGG + Intergenic
988403269 5:30790784-30790806 TGGCTCTTAACTAGACTTCCTGG + Intergenic
990643921 5:57822169-57822191 TGTGTCCTGACTAGTATTCAAGG - Intergenic
995019576 5:107351969-107351991 TGGCTCCTAGATAGTATTTCTGG - Intergenic
995783086 5:115798421-115798443 TGGCACCAGACCAGTATTCCAGG - Intergenic
996586997 5:125100562-125100584 TGGCTCCTCACTAGTCTCCATGG + Intergenic
996666629 5:126067109-126067131 TGGCTCCTCGCCAGTATCTCTGG + Intergenic
999532837 5:152480992-152481014 TGGCTTCTGACGAGTACTCCAGG + Intergenic
1000433549 5:161180166-161180188 TGGCTCCTGCATAGCATTCCTGG + Intergenic
1001481455 5:172091889-172091911 TGGCTCCTCACTCCTCTTTCAGG - Intronic
1002967949 6:1986048-1986070 TGGTCCCTCACTAGTTTTCTAGG - Intronic
1013902295 6:115171708-115171730 TGGCTCGTCCCTAATATTCTGGG - Intergenic
1014998625 6:128186304-128186326 TAACTCCTCACAAGTATTCATGG + Intronic
1018095250 6:160381397-160381419 TGACTCCTCTCCAGTATTCAAGG + Intronic
1023039053 7:36156250-36156272 TTTCTCCTCACTAATTTTCCTGG - Intronic
1025718215 7:63983472-63983494 TGGCTCCTCAATGGCATTTCTGG + Intergenic
1027437373 7:78178291-78178313 CGGCTAGTCACTATTATTCCAGG - Intronic
1033764008 7:144467581-144467603 TGGCTCCTCAGAAGTATTTTTGG + Intronic
1038745745 8:30253296-30253318 TGGCTCCCTACTGATATTCCTGG - Intergenic
1040809238 8:51432208-51432230 TGGCTTCTCAGTAATAGTCCTGG - Intronic
1040847451 8:51858768-51858790 TGGCTCCTGGATACTATTCCAGG - Intronic
1052398767 9:27974270-27974292 TGGGTCCTCTCTACTCTTCCTGG + Intronic
1056918464 9:90764692-90764714 TTGCTCCTTTCTGGTATTCCTGG + Intergenic
1188663608 X:32791048-32791070 TGGCATCTGACTAGTCTTCCTGG + Intronic
1188736231 X:33719887-33719909 TGGCTGCTCATTAGGATTCTTGG + Intergenic
1195789993 X:108573643-108573665 TGGATACTTACTTGTATTCCAGG - Exonic
1196461361 X:115935332-115935354 TGCCTCTTCAATGGTATTCCTGG - Intergenic
1197378158 X:125707869-125707891 TGGCTTGTCACTGGTACTCCTGG + Intergenic
1199316072 X:146379551-146379573 TGGCTCTTGAATAGTATTTCTGG + Intergenic
1199822019 X:151458993-151459015 TGCCTTCTCACAAGCATTCCAGG + Intergenic