ID: 906255914

View in Genome Browser
Species Human (GRCh38)
Location 1:44350044-44350066
Sequence CCTTGCTTGTAGAAGACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906255914_906255919 13 Left 906255914 1:44350044-44350066 CCATCAGTCTTCTACAAGCAAGG 0: 1
1: 0
2: 2
3: 8
4: 125
Right 906255919 1:44350080-44350102 AATAGGACATATATAGAATGAGG 0: 1
1: 0
2: 3
3: 30
4: 302
906255914_906255920 25 Left 906255914 1:44350044-44350066 CCATCAGTCTTCTACAAGCAAGG 0: 1
1: 0
2: 2
3: 8
4: 125
Right 906255920 1:44350092-44350114 ATAGAATGAGGACAATTTCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
906255914_906255917 -4 Left 906255914 1:44350044-44350066 CCATCAGTCTTCTACAAGCAAGG 0: 1
1: 0
2: 2
3: 8
4: 125
Right 906255917 1:44350063-44350085 AAGGAAAGGAGAAACCAAATAGG 0: 1
1: 0
2: 5
3: 88
4: 867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906255914 Original CRISPR CCTTGCTTGTAGAAGACTGA TGG (reversed) Intronic
901954483 1:12774446-12774468 ACATGCTTGCAGAAGACTAAAGG - Intergenic
905926259 1:41751996-41752018 CCTTCTTTATAGAAGACTGCTGG + Intronic
906255914 1:44350044-44350066 CCTTGCTTGTAGAAGACTGATGG - Intronic
908782171 1:67700656-67700678 CCTTTCTAGTAAAAGACTGAAGG - Intergenic
909651215 1:77978383-77978405 CCTTCCTTGTAGAGGTGTGACGG + Intronic
910498369 1:87859552-87859574 CCTTAATTTTAGAAGAATGATGG + Intergenic
913017082 1:114748906-114748928 CCTTGCTTATAGACATCTGATGG + Intronic
915955365 1:160216210-160216232 CCTTCTTTATAGAAGAGTGAAGG - Exonic
917456067 1:175187050-175187072 CCTTTCTTGTAAATGACTGATGG - Intronic
918569805 1:185976311-185976333 CCTTGCTTGGAGAAGAACAAGGG + Intronic
922168331 1:223134295-223134317 CCTTCCCTTTAGAACACTGAAGG + Intronic
922274586 1:224065609-224065631 CCTTTCTGGCAGAAGAGTGAAGG + Intergenic
922628124 1:227073755-227073777 GCTTGCTTTTAGAAAAATGATGG - Intronic
924633338 1:245762853-245762875 CCTTGTGTGCAGAAGAGTGACGG - Intronic
1065579659 10:27157463-27157485 CCTTTCTTTAAGAAAACTGAGGG - Intronic
1070993770 10:80756744-80756766 TATTTCTTGTAGAAGACTGGAGG - Intergenic
1071434777 10:85637533-85637555 GCTTCCTTGTAGGAGAATGAGGG - Intronic
1081874005 11:46396737-46396759 CCTTGCGGGGAGAAGACTGGTGG + Exonic
1083053778 11:59800451-59800473 CCTTTCTTTTAGAAAACAGAAGG - Intronic
1085739055 11:79063695-79063717 CCTTGCTGGCAGAATTCTGAGGG - Intronic
1086012893 11:82126529-82126551 CCATTCGTGTAGGAGACTGAGGG - Intergenic
1089776720 11:120842775-120842797 CCTTTGTTGTGCAAGACTGATGG + Intronic
1090523813 11:127507072-127507094 CCTTGCTTTCAGAAGCCAGAGGG - Intergenic
1093532741 12:20186724-20186746 ATTTGGTAGTAGAAGACTGAGGG - Intergenic
1095096221 12:38150793-38150815 CTTGGCTTCTAGAAGATTGATGG + Intergenic
1095992831 12:48049385-48049407 CCAGGCTTGTAGAAGACTGAAGG + Intronic
1098780022 12:74675532-74675554 CCTTACTTTAAGAATACTGATGG - Intergenic
1099893730 12:88619697-88619719 CATTGCATATAAAAGACTGAAGG + Intergenic
1100372647 12:93982603-93982625 ACTTGGGTGTAGAAGACTGAGGG - Intergenic
1101006399 12:100405217-100405239 ACTTTCTTGTAGAGGACTGAGGG + Intronic
1101289899 12:103357496-103357518 CCTTGCCTGCAGCAGACAGATGG - Intronic
1102841478 12:116129387-116129409 CCTTGCTTTTTCTAGACTGAAGG - Intronic
1102976855 12:117213052-117213074 CCTTTCTAGTAGCAGACAGATGG - Exonic
1105016995 12:132792300-132792322 CCTTTCTTGGAGATGCCTGATGG + Intronic
1107711857 13:43158398-43158420 CTTTGCCTGTCGAAGAATGATGG + Intergenic
1107995907 13:45860853-45860875 TCTTGCTGGTAGAAGCTTGAGGG - Intergenic
1108085599 13:46788320-46788342 CTTTTCTTGTTGATGACTGACGG + Intronic
1110546379 13:76760525-76760547 ACTTGCTGGTAGAATACAGAAGG + Intergenic
1113046078 13:106156760-106156782 CCTTCCTTGGAGAACACGGAGGG + Intergenic
1114859828 14:26503010-26503032 CATTGCTGGTAGGAGACTAAAGG - Intronic
1114985770 14:28226742-28226764 CCTTGGCTTTAGAAGATTGATGG - Intergenic
1118651019 14:67894520-67894542 CCTTATTTGTAGAAGCCTTAAGG - Intronic
1122403873 14:101485917-101485939 CATAGATTGTAGAAGACTAAGGG - Intergenic
1125533169 15:40427167-40427189 CCTTGCTGGCAGAAGAAGGAAGG + Intronic
1125630813 15:41145586-41145608 CCTTTCTTTTAGAAGAGTGAAGG + Intergenic
1129705859 15:77793824-77793846 CATGTTTTGTAGAAGACTGACGG + Intronic
1130449680 15:84038395-84038417 CCTTGCTTTTAGAACACCCATGG + Exonic
1130576181 15:85095117-85095139 CATAGCTTGTAGCAGACAGAAGG + Intronic
1131069338 15:89455605-89455627 CCTTGCATTTACAGGACTGAAGG + Intergenic
1132198065 15:99928690-99928712 CCTTCCTTGTGGCAGACGGAAGG + Intergenic
1139097707 16:63725486-63725508 CCCTAATTGAAGAAGACTGAAGG + Intergenic
1139870075 16:70100623-70100645 CCTTCATTGTAGAAGCCTGCAGG + Intergenic
1140385371 16:74531937-74531959 CCTTCATTGTAGAAGCCTGCAGG - Intronic
1140707545 16:77644596-77644618 CATTGTTTGTGGGAGACTGATGG - Intergenic
1142029646 16:87832134-87832156 CTCTGTTTCTAGAAGACTGAAGG + Exonic
1148995590 17:51706635-51706657 CCCTGCTTGAAGATGTCTGATGG + Intronic
1150662122 17:67091841-67091863 CCTTGATTATAGAACACTTAGGG + Intronic
1151401079 17:73856571-73856593 CCTGGCTTGTAGAGGCCGGAAGG + Intergenic
1151518279 17:74611430-74611452 GCTTGCTTGTGGCAGACTGTGGG + Exonic
1152756682 17:82089962-82089984 CCTTGGCTGCAGAGGACTGAGGG - Intronic
1156031990 18:32723420-32723442 ATTTGCTTTCAGAAGACTGAGGG + Intronic
1161152187 19:2715452-2715474 CCTTGCTGTTGCAAGACTGAAGG - Exonic
1164697203 19:30254288-30254310 CCTTGCTAGAAGATGACAGATGG - Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165287274 19:34852585-34852607 CCTTGCTTAAAAGAGACTGAGGG - Intergenic
932093619 2:68827935-68827957 GCCTGCTTGCAGAAGATTGAGGG + Intergenic
935738837 2:106128640-106128662 TCTTGCTTGCAGAAGGCAGACGG + Intronic
938942378 2:136180564-136180586 CCTTGCTGGTACAATACTTAAGG - Intergenic
939198729 2:139006799-139006821 CCCTAGTTGAAGAAGACTGATGG + Intergenic
939653732 2:144796399-144796421 GCTTGCTTGAAGAAGGCAGACGG - Intergenic
939931405 2:148238677-148238699 CCTTGCTTTTTGAAGCCTGGTGG + Intronic
942690432 2:178579270-178579292 CCTTTCTTCCAGGAGACTGATGG + Exonic
944016180 2:195041816-195041838 TCTTTCTTGTAGAAGAATGCAGG - Intergenic
945895421 2:215475868-215475890 CCTAGCGAGGAGAAGACTGATGG + Intergenic
947322660 2:228939315-228939337 CCTTCCTTGGAGGAGACTAACGG - Intronic
948615533 2:239196474-239196496 CTTTGCTTTCTGAAGACTGAAGG + Intronic
948918305 2:241049579-241049601 CCTGCCTCGTAGAAGACGGAAGG + Intronic
1173108008 20:40156255-40156277 CTATGCTTCTGGAAGACTGAAGG - Intergenic
1175480403 20:59306695-59306717 CCTTTCTTGAAGAACACAGAAGG - Intronic
1177578689 21:22992076-22992098 TTTTGCTTGTAGAAGGTTGAAGG + Intergenic
1178632586 21:34275518-34275540 CCTTGCTTACAGATGACTGGAGG - Intergenic
1181440612 22:22933544-22933566 CCTTGCTTGAAGAAGACAAGGGG + Intergenic
1181821216 22:25477133-25477155 CCTGGCTGGTAAGAGACTGAGGG + Intergenic
1183802599 22:40179902-40179924 CCTTGCTTGTTAGAGACAGAGGG - Intronic
955998247 3:64700413-64700435 ACTGGGTTGGAGAAGACTGAGGG + Intergenic
957839685 3:85652263-85652285 CCCTGCTTCTAGAAGGCTCATGG - Intronic
958912972 3:100015577-100015599 CATTGCTTCTAGAATTCTGATGG + Intronic
960221484 3:115115204-115115226 GCTTGTCTGTAAAAGACTGAAGG + Intronic
963771350 3:149389362-149389384 CATCGCTTGTAGTAGACTAAGGG - Intergenic
970822723 4:20237689-20237711 TGTTCCTTGTAGAAGACTGAGGG - Intergenic
973298757 4:48556446-48556468 CCTTGCTTCCAGCAGCCTGAAGG + Intronic
977027397 4:91836264-91836286 CCCTGCTTTTAGATGACTAATGG - Intergenic
984306288 4:177996143-177996165 CCTTTCCTGTAGAATCCTGAGGG - Intergenic
986428875 5:7662289-7662311 CCTTGCTTCCAGAACACTGATGG - Intronic
987938948 5:24507303-24507325 CCTTGCTTATCAATGACTGAGGG - Intronic
992160897 5:74000746-74000768 CCCTGCTAGTTGAAGACTGTGGG + Intergenic
994256407 5:97601354-97601376 CCTTGCTTGAAGAAAAAAGAAGG - Intergenic
997035899 5:130190851-130190873 CCGTGTTTGTGGGAGACTGAGGG - Intergenic
997592451 5:135083927-135083949 CCCTGCTGATAGAAGACTGGAGG - Intronic
997763673 5:136476692-136476714 CCATGCTTGCAGAAGAAAGATGG - Intergenic
998148690 5:139745064-139745086 CCTTGTTTGCAGAAGACCCAAGG - Intergenic
1000537217 5:162493727-162493749 CTTTGCTGGTAGAAGGCAGAGGG - Intergenic
1003572231 6:7263242-7263264 CCCTGGGTATAGAAGACTGAGGG - Intergenic
1004491538 6:16121500-16121522 TCTTGCTAGCAGATGACTGATGG - Intergenic
1004588773 6:17028810-17028832 ACTTACGTGTAGAAGACTGTAGG - Intergenic
1009737256 6:67691960-67691982 CCTTGCTTGATGAAGTCTCAGGG - Intergenic
1010038194 6:71350978-71351000 CTTTCCTTGTAGAAGAGTTAGGG - Intergenic
1010654478 6:78496043-78496065 CCTGGCTTTTAAAAAACTGAAGG - Intergenic
1012263744 6:97116612-97116634 CCTAGCTTGTAAAAGAATGCTGG + Intronic
1013252377 6:108347120-108347142 CCTTGCTGGTAACAGATTGAGGG - Intronic
1014180771 6:118381859-118381881 ACTTGCTCATAGAAGACTCAGGG + Intergenic
1015927288 6:138323047-138323069 TTTTGCTTGTAGAGGAGTGATGG + Intronic
1018757852 6:166864926-166864948 CCTTGCATGTAAAAAGCTGATGG - Intronic
1018860216 6:167705772-167705794 CCTTTCTTCTAGAAGCATGAAGG + Intergenic
1019549632 7:1595472-1595494 CCTTGCTTGTCTAGGACTGTAGG + Intergenic
1021394435 7:20129906-20129928 CCTGGTTTGTCCAAGACTGAGGG - Intergenic
1021463075 7:20911067-20911089 CCTTTTTTGTTGAAAACTGAAGG - Intergenic
1025718196 7:63983352-63983374 CCTTGCTTGAAGAAGAGAGAGGG + Intergenic
1027594165 7:80152062-80152084 CCTTAGTTCTAGAAAACTGAAGG - Intronic
1029611833 7:101630704-101630726 CCTTGCTTGCAGAGGCCTCAGGG - Intergenic
1032642650 7:133786771-133786793 CCTGGCTATTAGAAGACTTATGG + Intronic
1033588652 7:142792685-142792707 CCTTGCTGGTAGGACACTGTTGG - Intergenic
1034074613 7:148219717-148219739 CCTAGCTACTAGAAGGCTGAGGG + Intronic
1035039944 7:155920214-155920236 CTTTGCTTGTTCAGGACTGAGGG + Intergenic
1035314195 7:157988049-157988071 CCTGGCTTGGAGAAGACAAAAGG - Intronic
1036073260 8:5465770-5465792 CCTGGATTGGAGAAGACTTAGGG + Intergenic
1043645689 8:82515663-82515685 TCTTTCTAGTTGAAGACTGATGG - Intergenic
1048116106 8:131524885-131524907 CCTTGCTTGAAAAAAAATGAAGG + Intergenic
1048297068 8:133222245-133222267 CATTGCTTGAGTAAGACTGAAGG + Intronic
1052380304 9:27763641-27763663 CCTTGCTTTAGGAAGAATGAAGG - Intergenic
1057614007 9:96571979-96572001 CATTGCTTGTCCATGACTGAAGG - Intronic
1057973726 9:99581636-99581658 ACTTGCTTGTAGAAGACAGAAGG + Intergenic
1186225524 X:7395267-7395289 CTTTGCTAGTAGAAAAGTGAAGG - Intergenic
1188462480 X:30444816-30444838 CCTTGTTTGTTACAGACTGAAGG + Intergenic
1192222782 X:69208688-69208710 TTTTGCTTGGAGAAGACTCAGGG - Intergenic
1200877528 Y:8173810-8173832 CTTTGCTTGCAAAAGAATGAGGG + Intergenic