ID: 906256681

View in Genome Browser
Species Human (GRCh38)
Location 1:44355737-44355759
Sequence CCTTGTCTCAGGTCTCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906256681_906256688 18 Left 906256681 1:44355737-44355759 CCTGGGGGAGACCTGAGACAAGG 0: 1
1: 0
2: 3
3: 25
4: 186
Right 906256688 1:44355778-44355800 AAAATGCTTAGATTTGTGAAGGG 0: 1
1: 0
2: 4
3: 49
4: 464
906256681_906256689 29 Left 906256681 1:44355737-44355759 CCTGGGGGAGACCTGAGACAAGG 0: 1
1: 0
2: 3
3: 25
4: 186
Right 906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG 0: 1
1: 0
2: 1
3: 8
4: 49
906256681_906256686 -5 Left 906256681 1:44355737-44355759 CCTGGGGGAGACCTGAGACAAGG 0: 1
1: 0
2: 3
3: 25
4: 186
Right 906256686 1:44355755-44355777 CAAGGAGGGATTAAGCTAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 131
906256681_906256687 17 Left 906256681 1:44355737-44355759 CCTGGGGGAGACCTGAGACAAGG 0: 1
1: 0
2: 3
3: 25
4: 186
Right 906256687 1:44355777-44355799 GAAAATGCTTAGATTTGTGAAGG 0: 1
1: 0
2: 2
3: 25
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906256681 Original CRISPR CCTTGTCTCAGGTCTCCCCC AGG (reversed) Intergenic
900252436 1:1678140-1678162 CCTCGTCTCACTTCTCCCCCGGG + Intronic
900392073 1:2438085-2438107 CCTGGGCTGAGGCCTCCCCCAGG + Intronic
900473271 1:2864726-2864748 CCTTGTCTTAGGGCTCCCTGGGG + Intergenic
902701388 1:18174860-18174882 CCTTGCCTCAGGTCTGCTTCTGG + Intronic
903085477 1:20853750-20853772 CCTGGTCTCAGGCCTCACCTAGG - Intronic
903363812 1:22793676-22793698 CCCTGTCTCGGGCCTCCTCCAGG - Intronic
904410942 1:30324632-30324654 CCCTGTCTAAGGTGTCCCACTGG - Intergenic
904935346 1:34126211-34126233 CCTTGTCTCAGGTCTGCCTCCGG + Intronic
905253352 1:36664401-36664423 CCTTGTGTCTGGCTTCCCCCTGG - Intergenic
905692846 1:39955522-39955544 CCCTGTCCCAGGGCACCCCCAGG - Intronic
906166551 1:43690615-43690637 CCTTTTCTCAGTTGTCCCCTAGG + Intronic
906256681 1:44355737-44355759 CCTTGTCTCAGGTCTCCCCCAGG - Intergenic
907190677 1:52645363-52645385 AGTTGTCTCTGGTCTCCACCAGG - Intronic
907201028 1:52726768-52726790 CCCTGTCTCTGGTGTCCCCTCGG + Intronic
911309759 1:96277983-96278005 CCTGGACTCAGGTCTGCCCCTGG - Intergenic
912448890 1:109757852-109757874 CCTTCTCCCAGGTCTCACCCAGG - Exonic
915056926 1:153141622-153141644 CCTGTTCTGAGGTCTCCCGCTGG + Intergenic
915623199 1:157098666-157098688 CCCTGTCTCAGGGCTCCACCAGG - Intronic
916905533 1:169279165-169279187 CCCGTTCTCAGATCTCCCCCTGG + Intronic
917147255 1:171905536-171905558 CCTTGAGACAGGTCTCCCTCAGG - Intronic
917925514 1:179786315-179786337 CAGGGTCTCAGGTCTCCCCAGGG + Intronic
919910777 1:202109342-202109364 CCCTTTCCCAGGTCTCCCTCTGG - Intergenic
920499544 1:206477563-206477585 CCTTGCCTCAGCACTCCTCCTGG - Intronic
924044070 1:240010290-240010312 CCTTGTGTCATGTCCTCCCCTGG + Intergenic
1066613862 10:37277223-37277245 CCTGTTATCAGGTCTGCCCCTGG - Intronic
1067053330 10:43037631-43037653 CCTTGCCTCAGGTTTCCCTCTGG - Intergenic
1067187736 10:44044589-44044611 CCCTGCCTCATTTCTCCCCCTGG + Intergenic
1067423868 10:46186196-46186218 CCTTATCTCAGTTCTCCCAGTGG - Intergenic
1068346334 10:55783836-55783858 CCTTATCTCAGTTCTCCCAATGG + Intergenic
1069563422 10:69447860-69447882 CATTGTGTCTGGACTCCCCCAGG - Intergenic
1070860271 10:79651440-79651462 CCTTATCTCAGTTCTCCCAGTGG - Intergenic
1070876998 10:79824096-79824118 CCTTATCTCAGTTCTCCCAGTGG + Intergenic
1072806143 10:98425063-98425085 CCTGGTCTCAGCTCCCCACCTGG + Intronic
1073111165 10:101063788-101063810 CCTTGCCGCAGGACTCCCCCAGG + Intronic
1074473310 10:113746733-113746755 CTTTGTGTCAGGCCTCTCCCTGG + Intergenic
1076619285 10:131776732-131776754 GCCTCTCTCAAGTCTCCCCCTGG - Intergenic
1077672428 11:4168114-4168136 CTTTGTCTCAGGTCATCTCCAGG + Intergenic
1077888729 11:6404009-6404031 ACATGGCTCAGGTCTCCTCCTGG + Intronic
1078085987 11:8233294-8233316 CCCTGGCTCAGGCTTCCCCCAGG - Intronic
1078098096 11:8312768-8312790 CCCAGTCTCAGGACTCACCCAGG + Intergenic
1078520117 11:12056129-12056151 ACTCGCCTCAGGACTCCCCCTGG - Intergenic
1082284108 11:50301406-50301428 CCTTGCCTCAGTTCTTCCCCAGG + Intergenic
1083307233 11:61767500-61767522 CCTAGACTCAGGTCTGGCCCTGG - Intronic
1083356307 11:62068870-62068892 GCTTGTCCCAGGTCTCCGCATGG - Intergenic
1083682283 11:64357191-64357213 CCTTGTCCAAGGACTCCCCTTGG - Exonic
1083717129 11:64583894-64583916 CCGTGTCCCAGCTCTCCACCTGG + Intergenic
1084478495 11:69402397-69402419 CCTTGCCTGAGGTCTCCCTGTGG + Intergenic
1084570883 11:69959239-69959261 CCTGGTCTCAGCTCTGCCCCAGG + Intergenic
1088493022 11:110405114-110405136 CCTGTTATCAGGTCTGCCCCTGG + Intergenic
1088908963 11:114176218-114176240 CCTCCTCCCAGGTCTCCCCTTGG - Intronic
1089322849 11:117638126-117638148 ACTGGTTTGAGGTCTCCCCCTGG - Intronic
1096817929 12:54213381-54213403 TCGTGTCTCATGTCTGCCCCGGG - Intergenic
1100044249 12:90359071-90359093 CCTTGTGTCAGATCTACCCATGG + Intergenic
1103324053 12:120108703-120108725 CCCTTTCTCATCTCTCCCCCAGG - Intronic
1103557585 12:121775587-121775609 CCTCCTCTCTGGACTCCCCCAGG + Exonic
1103569070 12:121832204-121832226 CCTTGCCTCACCCCTCCCCCTGG + Exonic
1104398174 12:128453353-128453375 CCCTGTGTCTGGTCTCCCACGGG + Intronic
1104461185 12:128957523-128957545 CCTTTTCTCCTGTCTCCTCCAGG + Exonic
1112196020 13:97227190-97227212 TCCTCTCTCAGCTCTCCCCCAGG - Intronic
1112303191 13:98248736-98248758 TCTTGTCTCAGCTCTCGCGCTGG + Intronic
1113634920 13:111912864-111912886 CCTTGTCTAGGGTCCCCTCCTGG + Intergenic
1113887014 13:113666321-113666343 CCAGGTCTCAGGTGTGCCCCAGG + Intergenic
1113887027 13:113666379-113666401 CCAGGTCTCAGGTGTGCCCCAGG + Intergenic
1113955442 13:114097992-114098014 CTTTGTCTGAGGTCTCCATCTGG - Intronic
1114680882 14:24482582-24482604 TCTTCTCTCAGGTCTCCATCTGG - Intergenic
1115134833 14:30095847-30095869 CCTTTTCTCACAGCTCCCCCAGG - Intronic
1119265394 14:73261027-73261049 CCTGGCCTCTGGTCTCCCCTGGG + Intronic
1120488687 14:85148767-85148789 TCTTGTCTCCTGTCTCTCCCTGG + Intergenic
1120537049 14:85709666-85709688 CCTTGTCTCAGAAATCCCTCAGG + Intergenic
1121737346 14:96227874-96227896 CCGTGTCTCTTCTCTCCCCCAGG - Intronic
1122371050 14:101229214-101229236 CCTTGGCCCTGGTCTCCCTCTGG + Intergenic
1122715792 14:103696230-103696252 CCATGTCACAGGACTTCCCCAGG - Intergenic
1122901597 14:104784401-104784423 CCTGGTCTCCGCTGTCCCCCCGG - Intronic
1124695610 15:31862039-31862061 CCTGGTGTCATGCCTCCCCCAGG + Intronic
1126362610 15:47861731-47861753 CCTTTTCTCAGGTCTGCAGCTGG - Intergenic
1128308198 15:66613807-66613829 CCCTGCCTCAGGTCCCACCCTGG - Intronic
1128548325 15:68581923-68581945 CCTTGTATCAGGTCCCCTCAGGG + Intronic
1129131423 15:73500930-73500952 CTTTGTGTCAGGTGTCCCCATGG + Intronic
1129958585 15:79662349-79662371 CCTTGCATCTGGTCTCACCCTGG + Intergenic
1130322119 15:82850193-82850215 CCCTGTGTGAGGTCTCCCTCAGG - Intronic
1131756354 15:95567047-95567069 CATTGGCTCAGGTCTTCCACTGG - Intergenic
1133324867 16:4936522-4936544 CCCTGCCTCAGGGCGCCCCCTGG + Intronic
1137978239 16:53048840-53048862 CCCTGCCTCTGGTCTCTCCCAGG + Intergenic
1138963042 16:62050669-62050691 CCTTGTCTCACCTCTCTCACTGG + Intergenic
1142210541 16:88806438-88806460 CCTTGTCTCAGATGTGCCCAGGG + Intronic
1142743978 17:1945989-1946011 CCTAGTCTCTGCTCTCACCCTGG - Intronic
1143557968 17:7674328-7674350 GCTTGCCACAGGTCTCCCCAAGG - Intronic
1145787673 17:27604589-27604611 CTTTGTCTCAGATCTCTCCCGGG + Intronic
1146271764 17:31489484-31489506 CTTTGACTGGGGTCTCCCCCAGG + Intronic
1147695037 17:42345541-42345563 TTTTGTCTCAGGTCTCACCTGGG + Exonic
1148193014 17:45692906-45692928 CCCTGGCTCAGGCCTCCCTCTGG - Intergenic
1148482830 17:47971203-47971225 CTGTGTCTCCGGTCTCCCTCCGG + Intronic
1152615218 17:81334699-81334721 GCTTGTCTCAGTTCTCCAGCTGG + Intergenic
1156300518 18:35832444-35832466 CAGTGTGACAGGTCTCCCCCTGG - Intergenic
1158487258 18:57878593-57878615 CCTTCTCTCAGGTGCCCACCTGG - Intergenic
1161068310 19:2248778-2248800 CCATCTCTCAGGCCTCCCACAGG - Intergenic
1161484737 19:4529235-4529257 CCTTGGCTGAGGTCACCACCTGG + Exonic
1162309885 19:9899977-9899999 CCTTGTCTCACGTGTCCCCCTGG + Intronic
1166345039 19:42160235-42160257 CCTCGTCTCTGGCCTCACCCTGG - Intronic
1166980923 19:46631639-46631661 CCCTGTCCCCCGTCTCCCCCGGG + Intergenic
1167671621 19:50856849-50856871 CCTTTTCTCAGGGTCCCCCCAGG - Intronic
929509970 2:42558927-42558949 CCTTGTCTCAGTAGTTCCCCTGG + Intronic
932466459 2:71927315-71927337 CCTTGTCTCAGGCTTCCTCCCGG - Intergenic
932816734 2:74867792-74867814 CCTTCTCTCAGGGCAGCCCCTGG + Intronic
933088554 2:78089071-78089093 CCTTGTCTGAGGCCTTCCTCAGG - Intergenic
934775441 2:96934280-96934302 CCTGGCCTCAGGTCTCTGCCAGG - Intronic
934923004 2:98360696-98360718 CCTTGTCTCCCACCTCCCCCCGG - Intronic
936428398 2:112437493-112437515 CCTGGTCTCAGGGCTCCTCCAGG + Intergenic
943820319 2:192314108-192314130 CCCTGTCTCAGGGATCTCCCTGG + Intergenic
945979014 2:216294018-216294040 CCTGCTCTCAGTTCTCCCCCTGG + Intronic
948104496 2:235402426-235402448 CCATGCCTCAGGTCTTCCACGGG + Intergenic
948262550 2:236614881-236614903 CCTTGTCTCCCGTTTCCACCAGG - Intergenic
948644970 2:239398821-239398843 CCTTAGCCCAGGGCTCCCCCGGG + Intronic
1172127246 20:32632036-32632058 GCATGTCTCAGGTCGCCCTCTGG - Intergenic
1172239699 20:33404581-33404603 ACTTGTCTCAGGTCTGCTTCTGG - Intergenic
1172662750 20:36578730-36578752 CCTTGTCCCAGGTTTACCCAAGG + Exonic
1175823808 20:61925736-61925758 CCAGGTCTCGGATCTCCCCCTGG - Intronic
1175988514 20:62776270-62776292 CACTGTCTCAGGGCTCCCCGGGG + Intergenic
1176054458 20:63136457-63136479 CCCTGTCTCATGTCTCCCTTGGG + Intergenic
1176135845 20:63521657-63521679 GCTTCTCTCAGGTCTCCCCAAGG + Exonic
1176373853 21:6077718-6077740 CCTGGTCTCAGGGCTCCTCCAGG - Intergenic
1176976585 21:15327812-15327834 CCTTGGCTCAGGGATCTCCCAGG - Intergenic
1178822608 21:35989547-35989569 CCCTGGCTCAGCTCTGCCCCTGG - Intronic
1178879709 21:36439629-36439651 CATTGACTCAGGCCTGCCCCAGG - Intergenic
1178880015 21:36441981-36442003 CATTGACTCAGGCCTGCCCCAGG + Intergenic
1178966945 21:37129416-37129438 CCTTCTCTAAGGCCTCCTCCAGG + Intronic
1179301773 21:40118274-40118296 CCTTGCTTCAGGTCCTCCCCTGG - Intronic
1179749624 21:43460525-43460547 CCTGGTCTCAGGGCTCCTCCAGG + Intergenic
1180082186 21:45491973-45491995 CCTGCTCTCAGCTCTGCCCCGGG - Intronic
1180940984 22:19659366-19659388 CCTGGTCTCTGGTGTCCACCTGG - Intergenic
1180984288 22:19895361-19895383 CTCTGTCTCTGGTCTCCCCGAGG - Intronic
1181054152 22:20252239-20252261 CCTTGTGTGAGGTCAGCCCCAGG - Intronic
1183368927 22:37421556-37421578 CCGTGTCTCACCTCTCCTCCAGG + Intronic
1183442242 22:37829922-37829944 CCTTGCCTCAATTCTTCCCCAGG + Intergenic
1184331233 22:43829141-43829163 CCTTGTCACAGGACACCCCCAGG + Exonic
950017778 3:9766306-9766328 CCATGCCTGAGGTCTACCCCTGG + Exonic
954139717 3:48598632-48598654 CCTTGTGCCAAGTCACCCCCTGG - Intergenic
955371490 3:58355835-58355857 CCTGGCCTCAGGACTTCCCCGGG + Intronic
956824233 3:72982969-72982991 CCTTGTCTCTTTCCTCCCCCTGG + Intronic
958043287 3:88251670-88251692 CCTTGTTTCAGGTATACCCAAGG - Intergenic
961389468 3:126543794-126543816 ACTTGTCTCTGAGCTCCCCCAGG + Intronic
962240181 3:133745739-133745761 CCTAGTCTAAGGTGTCCCACAGG + Intergenic
962915900 3:139903065-139903087 TCTAGTCTCAGGTCAGCCCCTGG + Intergenic
963259327 3:143177186-143177208 CCGTGTCTCAGGTCTCCAACCGG + Intergenic
968081049 3:195847292-195847314 CCTGGTCTCTGCTCTCCCCAGGG + Intergenic
968871879 4:3246526-3246548 CCATGTCCCAGGTCTGCACCAGG + Intronic
969705291 4:8788402-8788424 CCTTGCCTCATGCCTCCCTCTGG + Intergenic
970010058 4:11448700-11448722 CCATGTCTCTGTTTTCCCCCTGG + Intergenic
976330169 4:83822402-83822424 CATTGTTTCAAATCTCCCCCTGG + Intergenic
978119690 4:105063577-105063599 GCTTGTCTCAGGTCTCTGCATGG + Intergenic
978473017 4:109092164-109092186 CTCTGTCTCAGATCTCCCCGTGG - Intronic
979763443 4:124435984-124436006 CCTTGGCCCAGGTCACCCCCAGG + Intergenic
982757976 4:159247237-159247259 CCATGTTTCAGGTCTGTCCCAGG + Intronic
989043170 5:37249477-37249499 CCTGCTCTCAGGCCTCCGCCCGG + Intergenic
997898339 5:137740324-137740346 TCTTGACTCAGCTCTGCCCCTGG - Intergenic
998044045 5:138972050-138972072 CTATGTCTCAGCTCTCCCCAGGG - Intronic
1001676288 5:173519314-173519336 CCTTGTTTCTGGACTCACCCTGG + Intergenic
1002068504 5:176664764-176664786 CCTTCTCCCAGCCCTCCCCCAGG - Intergenic
1002959420 6:1899884-1899906 CCCTGTCGCAGGTCTCCACGTGG - Intronic
1006911979 6:37569303-37569325 GCTCATCTCAGGTCTACCCCAGG - Intergenic
1006945791 6:37783725-37783747 CCATCTCTCATTTCTCCCCCAGG + Intergenic
1007495972 6:42260624-42260646 CCTTCCCTCAGGTATCCCCGTGG - Intronic
1009506215 6:64483558-64483580 CCTTCTCTCTGGTGACCCCCAGG + Intronic
1014292556 6:119575841-119575863 CACTGTCTCTGTTCTCCCCCAGG - Intergenic
1019933914 7:4242062-4242084 CCTAGACTCAGGGCTGCCCCTGG - Intronic
1021842783 7:24734041-24734063 GCTTGTGTCACCTCTCCCCCAGG + Intronic
1022723236 7:32958754-32958776 CCTTCTCTCAGCTCTGCCTCAGG + Intronic
1024563810 7:50665568-50665590 ACTGCTCTCAGGGCTCCCCCTGG + Intronic
1025187406 7:56871624-56871646 GCTTGCCTCAGTTCTTCCCCAGG - Intergenic
1025188820 7:56881428-56881450 GCTTGCCTCAGTTCTTCCCCAGG - Intergenic
1025683116 7:63695492-63695514 GCTTGCCTCAGTTCTTCCCCAGG + Intergenic
1025684519 7:63705296-63705318 GCTTGCCTCAGTTCTTCCCCAGG + Intergenic
1025698080 7:63790268-63790290 CCTGGGCTCGGGTCGCCCCCGGG - Intergenic
1025917051 7:65873738-65873760 CCTGGGCTCAGGCCGCCCCCCGG - Intronic
1025990422 7:66492870-66492892 CCTTGGCTCAGTTCTTCCCAGGG - Intergenic
1026038326 7:66845733-66845755 CCTTGGCTCAGTTCTTCCCAGGG + Intergenic
1026847486 7:73706055-73706077 CCCAGTCTCAGGACACCCCCAGG + Intronic
1026858143 7:73768520-73768542 CCCTTTCTCATCTCTCCCCCAGG + Intergenic
1035173838 7:157036639-157036661 CCTTGTGTCAAGTCTCTCCTGGG + Intergenic
1035469270 7:159099416-159099438 CCTTATCTCCTGTCTCCTCCTGG - Intronic
1035644368 8:1206880-1206902 CCCTGTCCCCGGTCTGCCCCCGG + Intergenic
1036028161 8:4934108-4934130 CCTTGTCAAAGGTCTCTCCCTGG - Intronic
1038455345 8:27669107-27669129 CCTGGGCTCACTTCTCCCCCAGG - Intronic
1039692483 8:39877975-39877997 CCTGTTATCAGGTCTGCCCCTGG - Intergenic
1040796148 8:51291790-51291812 CCTTTTATCAGGCCTGCCCCTGG - Intergenic
1041487713 8:58397033-58397055 CCGGGTCTCAGGTCTGCGCCTGG + Intergenic
1041691802 8:60694637-60694659 CTTTGTCTCTGGTGTCCTCCTGG + Intronic
1042040892 8:64587301-64587323 CCTTCTCTCAGGACTTCCCCTGG + Intergenic
1042470629 8:69183441-69183463 CCTGGTCTCAGGTCTCATCCTGG - Intergenic
1042695929 8:71555601-71555623 CGTTTTCTAAAGTCTCCCCCTGG - Intronic
1043789582 8:84447430-84447452 CCATGTCTCAGGTCACACACAGG + Intronic
1044748203 8:95391669-95391691 TCTTGTCTCAGCTCTCCTGCTGG - Intergenic
1049474510 8:142790542-142790564 CCTAGTCTTAGGTCACCCCCTGG + Intergenic
1051155040 9:14133541-14133563 CCTTGTCTCAGGACTGACTCTGG - Intronic
1053494702 9:38541710-38541732 CCTTATCCCAGGTTTTCCCCTGG - Intronic
1054852610 9:69864082-69864104 CCTTGTGTGAGGTCTACCTCGGG - Intronic
1054864631 9:69987527-69987549 CCTTTTCTCAGGTCTCTTGCTGG + Intergenic
1055397942 9:75892838-75892860 CCTAGTCTCAGTTCTCCACAGGG - Intronic
1056549408 9:87639166-87639188 CCTTGTCTCAGGCCTGCTTCAGG + Intronic
1056750662 9:89348717-89348739 TCTTGTCAGAGGCCTCCCCCAGG + Intronic
1056770342 9:89473965-89473987 CCCTTTCTCAGGTCCTCCCCAGG + Intronic
1057669506 9:97076249-97076271 CCATGCCTAGGGTCTCCCCCGGG - Intergenic
1057915932 9:99055258-99055280 CCTTGTCTCCATTCTCCCCCTGG - Exonic
1058387859 9:104460038-104460060 CCTTGTCTCAGGTCTCCATCCGG - Intergenic
1059113831 9:111582999-111583021 CCTTGTCTTAGGTACCTCCCAGG + Intronic
1059324811 9:113497703-113497725 CCATGTCTCAGGGATCCCCCAGG + Intronic
1062344168 9:136107165-136107187 GCTGTTCTCAGGTCACCCCCAGG - Intergenic
1062402384 9:136378263-136378285 CCTGGGCTCAGGTATCTCCCTGG + Exonic
1062582180 9:137233576-137233598 CCCTCTCTCAGGACTCACCCGGG - Intronic
1188002537 X:24995678-24995700 TCTTATCTCTGGTCTACCCCTGG - Intronic
1188006559 X:25020080-25020102 CCCTGCCTCAGTTCTCCCCACGG + Intergenic
1188988871 X:36792573-36792595 TCTTGTTTCAGGTCTCCTTCTGG + Intergenic
1189088748 X:38055051-38055073 CCTTGTCTCAGGGCCCCTCTTGG + Intronic
1196285066 X:113870528-113870550 CCTTGTACCAGGTCTCTCCCTGG - Intergenic
1197583183 X:128310744-128310766 CCTTTTCTCATGGCTCCTCCAGG + Intergenic