ID: 906256685

View in Genome Browser
Species Human (GRCh38)
Location 1:44355748-44355770
Sequence GCTTAATCCCTCCTTGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906256685_906256688 7 Left 906256685 1:44355748-44355770 CCTGAGACAAGGAGGGATTAAGC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 906256688 1:44355778-44355800 AAAATGCTTAGATTTGTGAAGGG 0: 1
1: 0
2: 4
3: 49
4: 464
906256685_906256690 24 Left 906256685 1:44355748-44355770 CCTGAGACAAGGAGGGATTAAGC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 906256690 1:44355795-44355817 GAAGGGCCGTCCTAAGGAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 126
906256685_906256687 6 Left 906256685 1:44355748-44355770 CCTGAGACAAGGAGGGATTAAGC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 906256687 1:44355777-44355799 GAAAATGCTTAGATTTGTGAAGG 0: 1
1: 0
2: 2
3: 25
4: 281
906256685_906256691 25 Left 906256685 1:44355748-44355770 CCTGAGACAAGGAGGGATTAAGC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 906256691 1:44355796-44355818 AAGGGCCGTCCTAAGGAAGAGGG 0: 1
1: 0
2: 0
3: 10
4: 105
906256685_906256689 18 Left 906256685 1:44355748-44355770 CCTGAGACAAGGAGGGATTAAGC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG 0: 1
1: 0
2: 1
3: 8
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906256685 Original CRISPR GCTTAATCCCTCCTTGTCTC AGG (reversed) Intergenic
900138539 1:1129014-1129036 GCTGAATCCCTCCTCTTCTGAGG - Intergenic
903082846 1:20825774-20825796 GCTTTAAGCCTCCTTGTATCAGG - Intronic
904377214 1:30089351-30089373 GGTTCATGCCTCCTTGACTCAGG - Intergenic
906256685 1:44355748-44355770 GCTTAATCCCTCCTTGTCTCAGG - Intergenic
908540365 1:65116454-65116476 GCTTCTTTCCTCCTTGTCCCAGG - Intergenic
908833971 1:68209922-68209944 CCATAGTCTCTCCTTGTCTCAGG + Intronic
909426350 1:75529533-75529555 GCTTAATCCATCCTATTGTCAGG - Intronic
909708987 1:78622558-78622580 GTATAATCCCCCCTTGTCTGTGG + Intronic
913123459 1:115763418-115763440 GCTTATTCACTCCTCCTCTCTGG - Intronic
914922756 1:151858854-151858876 CCCAAATCCCTCCTTGTCTTGGG + Intergenic
917194326 1:172449901-172449923 GCTGAATGCCTCCTCATCTCAGG + Intronic
921174921 1:212585355-212585377 GCTGAATCCCTTCCTGCCTCAGG + Intronic
1063208423 10:3856377-3856399 GCTTCTGCCCTCCCTGTCTCAGG + Intergenic
1064195184 10:13238539-13238561 GCTTAGACCCTCCATGTCGCTGG + Intergenic
1065804461 10:29381969-29381991 GCTTAATCCCTTGCTCTCTCTGG - Intergenic
1065944722 10:30596066-30596088 GCTTAATCCCTTGCTCTCTCTGG + Intergenic
1066463245 10:35630860-35630882 TCTTAATCCCTCATTGTTACTGG + Intergenic
1067497793 10:46774994-46775016 CCTCAAGCCCTCCTTCTCTCTGG - Intergenic
1067596856 10:47565420-47565442 CCTCAAGCCCTCCTTCTCTCTGG + Intergenic
1067797459 10:49331225-49331247 CCTGAATCCATCCTTGTCTTAGG - Intergenic
1068927321 10:62553901-62553923 GTTTTTTGCCTCCTTGTCTCTGG - Intronic
1072574976 10:96691084-96691106 GCTTAATTCCTCTTTTTCCCAGG + Intronic
1072957071 10:99896596-99896618 GCTGTTTTCCTCCTTGTCTCTGG - Intronic
1073143312 10:101262923-101262945 GCTTCAGCCCACCTGGTCTCTGG + Intergenic
1075842446 10:125516473-125516495 GCTAAATCCCTGCTGGCCTCTGG + Intergenic
1076591686 10:131587946-131587968 GCTGAAACCCTCCATTTCTCAGG + Intergenic
1077132671 11:981257-981279 GTTTAAAACCTCCGTGTCTCTGG + Exonic
1077432463 11:2522542-2522564 GCTTTATCTATTCTTGTCTCGGG - Intronic
1078325385 11:10376369-10376391 GGTTAATCACTCATTCTCTCTGG - Intronic
1079860536 11:25664703-25664725 CCATAATCCCTTGTTGTCTCAGG - Intergenic
1081320650 11:41688202-41688224 GCTTAATTTCTCCTTTTCTTGGG + Intergenic
1085189721 11:74608507-74608529 GCTTACCCCCTCCTAGGCTCTGG + Intronic
1085252570 11:75153263-75153285 GGTTCATCCCTCCTTGTTTCCGG + Intronic
1085680078 11:78565068-78565090 GCTGGATCACTCCTTGTCTTTGG + Intronic
1085919353 11:80933497-80933519 AGTTAATCTCTCCTTGTCTTCGG - Intergenic
1092089795 12:5795057-5795079 GATCCATCCCTCCTTGTCTCTGG - Intronic
1092287150 12:7135295-7135317 TCTTCATCCCTCCTTCTCTCTGG + Intronic
1092467720 12:8748497-8748519 GAATAATCCCACCTTGTCTGTGG - Intronic
1098546396 12:71716690-71716712 GCTTAACCTCTCTGTGTCTCAGG + Intergenic
1105751818 13:23427765-23427787 GCTTTATCCCCCCTTCTCTCCGG - Intronic
1112493138 13:99884801-99884823 GCTTCATCCCAGCTGGTCTCAGG - Intronic
1122034590 14:98938139-98938161 GCTTCCTCCCTTCCTGTCTCAGG - Intergenic
1128259781 15:66225059-66225081 GCACACTGCCTCCTTGTCTCAGG - Intronic
1130539089 15:84809051-84809073 ACATAATCCCTCCTTTTCTGTGG + Intergenic
1130967150 15:88705796-88705818 GCTCAATCGCTCCCTGTCTCAGG - Intergenic
1132717477 16:1299115-1299137 GCTTCCTCCCACCTCGTCTCTGG - Intergenic
1134081384 16:11327338-11327360 GCTCAAACCATCCTTGCCTCAGG + Intronic
1135247393 16:20868771-20868793 TCCACATCCCTCCTTGTCTCTGG - Intronic
1136143006 16:28299160-28299182 GCTTAATCTCTCTGTGCCTCAGG + Intronic
1139060471 16:63244725-63244747 GCTCAATCCCTCCCTGGCTCAGG + Intergenic
1144827113 17:18111654-18111676 ACCTGATCCCTCCTGGTCTCTGG - Intronic
1145017855 17:19410844-19410866 GATGAATAACTCCTTGTCTCTGG + Intergenic
1146577846 17:34010480-34010502 GAGTTATCCCTCCATGTCTCTGG + Intronic
1147976820 17:44252785-44252807 CCAGTATCCCTCCTTGTCTCTGG - Intronic
1151770784 17:76159263-76159285 GCTTCATCCCTCCTTGGTGCTGG - Intronic
1151852933 17:76701654-76701676 ACATACTCCCTCCTTGTCTGCGG - Intronic
1154350393 18:13578373-13578395 TCTGGGTCCCTCCTTGTCTCAGG + Intronic
1156818322 18:41339778-41339800 GGTTTATCCCACCCTGTCTCTGG + Intergenic
1157480179 18:48048840-48048862 TTTTCATACCTCCTTGTCTCAGG + Intronic
1158772805 18:60541769-60541791 GCTCAATCCATCCTTGTCTTTGG - Intergenic
1160047423 18:75399992-75400014 GCTCACTGCCTCCTTGTCTCAGG + Intergenic
1160240668 18:77120102-77120124 CATGAATCCCGCCTTGTCTCGGG + Intronic
1160803205 19:979887-979909 GCTGAGTCCCTCCTTGGCTGGGG - Intergenic
1160803230 19:979942-979964 GCTGAGTCCCTCCTTGGCTGGGG - Intergenic
1160803255 19:979997-980019 GCTGAGTCCCTCCTTGGCTGGGG - Intergenic
1161283850 19:3459012-3459034 GCTTCTTCCCTCCCTCTCTCCGG - Intronic
1161871447 19:6873536-6873558 GTTTATTCCCTCTTTGTGTCTGG + Intergenic
1162947803 19:14054377-14054399 GCTTCATCCCTCCCTGTCCCTGG + Exonic
1163193979 19:15701740-15701762 TCTTAATCCTTCCTTGTGGCAGG + Intergenic
1164763395 19:30744853-30744875 GGATAATCCCTGCTTGCCTCAGG - Intergenic
1166074013 19:40403577-40403599 CCTTAACCCCTCCTGGTCGCCGG + Intronic
1166640614 19:44492088-44492110 GCTTCATCTCTTCTTCTCTCAGG + Intronic
1166752181 19:45169608-45169630 GCTTCATCCCTCATTGGCTGGGG - Intronic
1167053971 19:47097153-47097175 GCAGAATCCCTCTTTGGCTCAGG - Intronic
928010487 2:27602973-27602995 GCACAACCCTTCCTTGTCTCTGG - Intronic
929567687 2:42999972-42999994 ACTTAGCCTCTCCTTGTCTCTGG - Intergenic
933610584 2:84430341-84430363 GCTTAATCTCTCGTTGCCTCAGG - Intronic
934487452 2:94729155-94729177 GATGCATCCTTCCTTGTCTCTGG + Intergenic
935385089 2:102491623-102491645 GCATAATCCCTACTTGTCATGGG - Intronic
938035452 2:128031096-128031118 GCTTTATTCATCCATGTCTCTGG + Intergenic
938807021 2:134815504-134815526 TCTTAATCACTCCTAGGCTCAGG - Intergenic
947731008 2:232431645-232431667 GCTGGAGCCCTTCTTGTCTCTGG + Intergenic
1179402159 21:41094253-41094275 GCTTAGGCCCACCTTTTCTCTGG - Intergenic
1183369908 22:37426731-37426753 GCTGCCTCCCTCCTTGTCCCTGG + Intronic
949435820 3:4028197-4028219 GTTTGATCTCTCATTGTCTCTGG + Intronic
952341657 3:32452288-32452310 GCTTGTTCCCTTCATGTCTCTGG - Intronic
952898079 3:38092594-38092616 GCTTGCTCCCTGCTTTTCTCTGG + Intronic
952952970 3:38539107-38539129 CCTTCATCCCTCCCTGACTCTGG - Intronic
955405591 3:58623751-58623773 GCTTAACCTCTCCACGTCTCTGG + Intronic
956935306 3:74094341-74094363 TCTGACTCCCTCCTTGTCTTGGG + Intergenic
959313554 3:104772937-104772959 GGTCAATCCCTCCTTATCTCAGG - Intergenic
959351371 3:105268956-105268978 CCATAATCCCTACATGTCTCGGG + Intergenic
963305280 3:143644727-143644749 GCTTAAGGACTCCTTGTCTTGGG - Intronic
967312712 3:188121294-188121316 AGTTAATCACTCCTTTTCTCAGG + Intergenic
967683376 3:192391840-192391862 GCTTAAAGCCACCTTGTATCAGG + Intronic
967880903 3:194300541-194300563 GCCTCATCCCTCCTTGCCTGAGG - Intergenic
974416172 4:61609697-61609719 TCTTAATCCCTCCTTCCCTCGGG + Intronic
975885623 4:78961154-78961176 GGTCAGTCCCTCCTTATCTCAGG - Intergenic
976132188 4:81896388-81896410 GCTGAATCCCTTCTTGGATCTGG - Intronic
976576644 4:86680000-86680022 GCTTAACCTCTCCATGTCTTAGG + Intronic
979521828 4:121676225-121676247 GCTTAATTCCACCTTCTTTCGGG - Intronic
980206471 4:129725232-129725254 TCTTACTCCTTCCATGTCTCAGG - Intergenic
980878852 4:138689050-138689072 CCTTAATCCGTCCCTGTGTCTGG - Intergenic
981905993 4:149922581-149922603 GCATGATCCTTCCTTTTCTCAGG + Intergenic
988619199 5:32805146-32805168 GTTTAACCACTCTTTGTCTCAGG - Intergenic
990503227 5:56418140-56418162 GCCTAATCCCTACTTGACCCCGG - Intergenic
992778893 5:80110576-80110598 GCTAAATGCCACCTTGACTCTGG - Intergenic
997361404 5:133297485-133297507 ACTTAATCTCTCTGTGTCTCCGG + Intronic
1003121312 6:3321048-3321070 GCTTAATCTCTCTGTGCCTCAGG - Intronic
1004308042 6:14518953-14518975 GCTGATTCCCTTCTGGTCTCAGG + Intergenic
1006499460 6:34448644-34448666 GCCTCAGCCCTCCCTGTCTCTGG + Intergenic
1011047963 6:83107742-83107764 ACTTATACCCTCCTTGTCTGGGG - Intronic
1012866179 6:104621041-104621063 TCATAATCCTTCCTGGTCTCTGG + Intergenic
1015572836 6:134639507-134639529 GTTTCTTCCCTCCTTGTATCTGG + Intergenic
1017545319 6:155444828-155444850 GAGTAGTCCCTCCTTGTCTGCGG - Intronic
1022667817 7:32428205-32428227 GCTTACTCCCTCCTGGTGCCGGG + Intergenic
1026399201 7:69992267-69992289 GTTTAATCTCACCTTTTCTCTGG - Intronic
1027148961 7:75718960-75718982 GATTAATGCATCCTTGTCTCCGG - Intronic
1027252659 7:76408768-76408790 GCTTCATCCCTCCCTGTCCTTGG + Intronic
1027457281 7:78408473-78408495 TCTCCATCCCTCCTTTTCTCAGG - Intronic
1029940783 7:104478588-104478610 GCTTATACCATCCATGTCTCTGG + Intronic
1031709441 7:125026792-125026814 GCATAATGAGTCCTTGTCTCTGG + Intergenic
1031710229 7:125035434-125035456 TCTTAATCTCTGCTTGTTTCAGG + Intergenic
1033720575 7:144055089-144055111 GCTTTATTCCTCCTTTTTTCCGG - Intergenic
1033855214 7:145552713-145552735 GTTTGACCCCTCCTTGTGTCTGG + Intergenic
1037063486 8:14545815-14545837 TCTTAATCCTTCTTTTTCTCTGG + Intronic
1038988482 8:32839688-32839710 GCTTAATCTCTCTGGGTCTCAGG - Intergenic
1043587194 8:81783167-81783189 GGTTTATTCCTCCTTGTCACAGG - Intergenic
1045668048 8:104512585-104512607 GATTAATCCCACCTTGTTTTTGG - Intronic
1050061318 9:1712483-1712505 GCTTAATCCTTCCTTTGCTGTGG + Intergenic
1050737475 9:8780480-8780502 AATTAATCCCTCCGTGTCTGAGG - Intronic
1051240390 9:15049540-15049562 GATTAATCCCACCTAGTTTCAGG - Intergenic
1053670353 9:40355275-40355297 GATGCATCCTTCCTTGTCTCTGG - Intergenic
1053920143 9:42981538-42981560 GATACATCCTTCCTTGTCTCTGG - Intergenic
1054381473 9:64495260-64495282 GATGCATCCTTCCTTGTCTCTGG - Intergenic
1054514259 9:66021025-66021047 GATGCATCCTTCCTTGTCTCTGG + Intergenic
1057757649 9:97850727-97850749 GCTAAAAGCCTTCTTGTCTCAGG - Intergenic
1058638163 9:107056871-107056893 GCTGAGTCCCTCCTTTTCTCTGG + Intergenic
1058890267 9:109355251-109355273 GCTAATTCCCTCCTTCTCTGGGG + Intergenic
1059471982 9:114512011-114512033 TCTTAATGTCTCTTTGTCTCTGG + Intergenic
1060584770 9:124779079-124779101 ACTCATTCCCTCCTTGTCTCTGG - Intronic
1187223653 X:17354922-17354944 TCTTAATCTCTCTGTGTCTCAGG - Intergenic
1188132010 X:26447708-26447730 GCTTATTCCCTCCATATATCTGG + Intergenic
1193334187 X:80268362-80268384 GCTAAATACCTGTTTGTCTCTGG + Intergenic
1194710730 X:97233363-97233385 ATTTAATCTCTCTTTGTCTCAGG + Intronic
1198484030 X:137068303-137068325 GCTTTCTCCCTCATTGTGTCTGG - Intergenic
1199565763 X:149214243-149214265 TCCTAATCCCTTCTTGCCTCTGG + Intergenic