ID: 906256689

View in Genome Browser
Species Human (GRCh38)
Location 1:44355789-44355811
Sequence ATTTGTGAAGGGCCGTCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906256685_906256689 18 Left 906256685 1:44355748-44355770 CCTGAGACAAGGAGGGATTAAGC No data
Right 906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG No data
906256681_906256689 29 Left 906256681 1:44355737-44355759 CCTGGGGGAGACCTGAGACAAGG No data
Right 906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906256689 Original CRISPR ATTTGTGAAGGGCCGTCCTA AGG Intergenic