ID: 906256689

View in Genome Browser
Species Human (GRCh38)
Location 1:44355789-44355811
Sequence ATTTGTGAAGGGCCGTCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906256685_906256689 18 Left 906256685 1:44355748-44355770 CCTGAGACAAGGAGGGATTAAGC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG 0: 1
1: 0
2: 1
3: 8
4: 49
906256681_906256689 29 Left 906256681 1:44355737-44355759 CCTGGGGGAGACCTGAGACAAGG 0: 1
1: 0
2: 3
3: 25
4: 186
Right 906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG 0: 1
1: 0
2: 1
3: 8
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906256689 Original CRISPR ATTTGTGAAGGGCCGTCCTA AGG Intergenic
901068830 1:6507383-6507405 ATTTCTGAAGGGCTGCCCCATGG - Intronic
901566251 1:10118258-10118280 ATTTGTAAAGGGCCTTCTTTGGG + Intronic
905460953 1:38122789-38122811 ATTTTTGCAGGGCTGTCCTGGGG + Intergenic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
908927581 1:69274749-69274771 ATTGGTAAAGGGCAGTCCTCAGG + Intergenic
917487579 1:175468852-175468874 ATTTCTGAAGGGCTCTCATAAGG + Intronic
921037145 1:211391474-211391496 TGTTGTGAAGGGCTTTCCTATGG - Intergenic
1074784355 10:116826009-116826031 ATGTGTGAAGGGCTGTCACATGG + Intergenic
1082631540 11:55548174-55548196 ATGTGTCAAGTGCCATCCTATGG - Intergenic
1085001769 11:73043940-73043962 ATTGGTGAATGGCCTTCCAAGGG - Intronic
1085883110 11:80491115-80491137 ATCTAGGAAGGGCTGTCCTAAGG - Intergenic
1092663207 12:10763033-10763055 ATATCTGAAGGGCAGTCTTAGGG + Intergenic
1093115669 12:15207789-15207811 TTTTGTGAAGGGCTGTCATAAGG + Intronic
1108013737 13:46051752-46051774 GTTTGTGAAGGGTAGTCTTAAGG - Intronic
1115349159 14:32374562-32374584 AGTTGTGAAGGGCCTACTTAAGG + Intronic
1130454153 15:84088230-84088252 ATTTGTGAGGTGAAGTCCTACGG + Intergenic
1131099196 15:89674699-89674721 ATATGTGAAGGGCCAACCCATGG - Intronic
1136497473 16:30653008-30653030 TTTTGTGAAGGGCCCTCCTCTGG - Exonic
1138366546 16:56483312-56483334 ATTTGACAAGGGCTGTCCTAGGG - Intronic
1140213329 16:72987827-72987849 ATTCATGAAAGGCAGTCCTAGGG - Intronic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1144194648 17:12878658-12878680 ATTAGTGAAGGCCTGACCTATGG - Intronic
1144628934 17:16860381-16860403 ATTAGTGAAGGGCCATCCTGAGG - Intergenic
1144652475 17:17015734-17015756 ATTAGTGAAGGGCCATCCTGCGG + Intergenic
1145160508 17:20570948-20570970 ATTAGTGAAGGGCCATCCTGCGG - Intergenic
1149797350 17:59533016-59533038 ATTTGAGAGGGGCCTTCCTAGGG - Intergenic
1153212509 18:2783316-2783338 CTTTGAGAAGGGCTGTCCCAGGG + Intronic
1163372407 19:16908815-16908837 ACTTGTGAGGGCCAGTCCTAGGG - Intronic
925184393 2:1837024-1837046 ATTTGGGAAGGGGCGTCATGGGG + Intronic
925666531 2:6262930-6262952 CTCTGTGCAGGGTCGTCCTATGG - Intergenic
925868133 2:8246609-8246631 GTCTGTGAAGGGCCCTTCTATGG + Intergenic
929570821 2:43021930-43021952 CTTTGTGCAGTGCCGTCCTCGGG - Intergenic
937949053 2:127369653-127369675 ATTTGTGAACAGCCCTCCCACGG - Intronic
940159238 2:150693648-150693670 ATTGGTTAAGGGCCATCCTTGGG - Intergenic
945749293 2:213760830-213760852 ATTTGGCAAGGGACATCCTATGG + Intronic
1172518770 20:35554058-35554080 CTTTGCAAAGGGCTGTCCTAAGG - Intronic
1173285922 20:41671384-41671406 ACTTGTTAAGGGCTGTCCCAGGG + Intergenic
1173391727 20:42641280-42641302 ATGTGTGAGAGGCCTTCCTAAGG + Intronic
1175269054 20:57720978-57721000 GTTACTGAAGGGCCGTTCTATGG - Intergenic
1179525734 21:41974751-41974773 ATTTGGGAAGTCCTGTCCTAGGG + Intergenic
965861329 3:173154448-173154470 TTTTGTTAAGGGCAGTCCTAGGG + Intergenic
970619156 4:17799286-17799308 ATATGTGAAGGGCCAACATATGG + Intergenic
981749660 4:148081852-148081874 ATTGGTGAGGGGCCTTCCCAGGG + Intronic
985426024 4:189831333-189831355 ATTTCTTAAGGGCTGTCCTGTGG + Intergenic
1003406193 6:5828977-5828999 ATGCCTGAAGGTCCGTCCTAAGG - Intergenic
1015148584 6:130015196-130015218 ATTTGTGAAGGGCTGGCTCATGG + Intronic
1016079378 6:139837093-139837115 ATGTGACAAGGGCCGTCATAAGG + Intergenic
1029781173 7:102735355-102735377 ATTTGTTAAGGGCTGTTTTATGG + Intergenic
1037309644 8:17541429-17541451 ATTTGTGAAGTGCCATGCTTTGG + Intronic
1048382126 8:133874475-133874497 ATTTGTGAAAGCCCTTGCTATGG - Intergenic
1052712052 9:32068984-32069006 ATTAGTGAAGTGTCTTCCTATGG - Intergenic
1057425539 9:94946545-94946567 ATCTGAGAAGGGCCATTCTAAGG - Intronic
1061868324 9:133506797-133506819 ATTTGTTAAGTGCCTGCCTACGG + Intergenic
1188400177 X:29734805-29734827 ATTTGTGAAGGGGAAACCTAAGG + Intronic
1188745021 X:33830736-33830758 ATTTGTTAAGGGCCGTCCTTGGG + Intergenic
1192536502 X:71932969-71932991 ATTTGGGATGGGCCTTTCTAGGG - Intergenic
1195009173 X:100718591-100718613 ATTTGTGAAGGCAGGCCCTAGGG - Intronic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1199542090 X:148968468-148968490 ATTTGAGAACGACTGTCCTAGGG + Intronic