ID: 906256813

View in Genome Browser
Species Human (GRCh38)
Location 1:44356638-44356660
Sequence TTTAAATTGGAGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 1, 2: 0, 3: 32, 4: 354}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906256809_906256813 -4 Left 906256809 1:44356619-44356641 CCTCTATTCTCAAGGAGCTTTTA 0: 1
1: 0
2: 4
3: 56
4: 408
Right 906256813 1:44356638-44356660 TTTAAATTGGAGAGGGAAGCTGG 0: 1
1: 1
2: 0
3: 32
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906256813 Original CRISPR TTTAAATTGGAGAGGGAAGC TGG Intergenic
903224375 1:21886583-21886605 GTTAAATAGGAGGGGGAGGCTGG - Intronic
905388504 1:37621201-37621223 GGGAAGTTGGAGAGGGAAGCAGG + Intronic
906256813 1:44356638-44356660 TTTAAATTGGAGAGGGAAGCTGG + Intergenic
907602600 1:55785923-55785945 TTTAAATCTGAGAGGGAAAAAGG + Intergenic
909699107 1:78500605-78500627 TGTGAAGTGGAGAAGGAAGCAGG - Intronic
911751386 1:101501120-101501142 TTTAAATCAGAGAGGGAGGAGGG - Intergenic
912391812 1:109308161-109308183 TTTAAAATGCAGAGGGATGCTGG - Intergenic
912419017 1:109530985-109531007 TATAAATAGCAGAGGGAGGCTGG - Intergenic
913131574 1:115842488-115842510 GTTAAAGTGAAGATGGAAGCCGG + Exonic
913272101 1:117104446-117104468 TTTAGTTTGGAGAGGGATGCAGG + Exonic
913382594 1:118227783-118227805 TTTAAATCGGAGAGGGAGAAGGG - Intergenic
913466643 1:119149779-119149801 TTTGAATTGGAAAGAGGAGCAGG + Intergenic
913615072 1:120550477-120550499 AGAAAAGTGGAGAGGGAAGCTGG - Intergenic
914575201 1:148960431-148960453 AGAAAAGTGGAGAGGGAAGCTGG + Intronic
914906256 1:151747843-151747865 TATAAATTAGAGAGGGAAAAGGG - Intergenic
915492662 1:156259859-156259881 TTTTTATTTGAGAGGGAAGAAGG - Intronic
915682150 1:157591535-157591557 TATATATGGGAGAGGTAAGCAGG + Intronic
919604393 1:199663542-199663564 TTAAAATTAGAGAGGGAATTGGG - Intergenic
919605592 1:199678952-199678974 TTGAATTTGAATAGGGAAGCTGG + Intergenic
920142113 1:203823970-203823992 TTAAAAAAGGAGAGGGAAGCCGG + Intronic
920765605 1:208830600-208830622 ATAAACTTGGAGATGGAAGCAGG - Intergenic
921303071 1:213769024-213769046 TATATATTGTAGAAGGAAGCAGG - Intergenic
921507062 1:215984499-215984521 TTTAATTTTCACAGGGAAGCTGG + Intronic
921771086 1:219040742-219040764 TTTACATTGAAGAGAGAACCTGG + Intergenic
922801899 1:228368279-228368301 CTTAAAGTGGAGAGGGAGGCTGG + Intronic
923881960 1:238113296-238113318 TTTAAAATGCAGAGGAAAGATGG + Intergenic
923978463 1:239292951-239292973 TTCAGATTGGAGAAGAAAGCAGG + Intergenic
924132550 1:240926999-240927021 TTTAAACTGGGGATGGAAACAGG + Intronic
924150081 1:241120916-241120938 TTCAAATTGTAGTGTGAAGCAGG - Intronic
1062861263 10:812245-812267 TTGAAACTGGAGTGAGAAGCTGG + Exonic
1063270501 10:4504822-4504844 TTTAAATTGTAGTGGGATGCAGG + Intergenic
1063376282 10:5556521-5556543 TTGAATTTGGAGGGGGAGGCAGG - Intergenic
1063920656 10:10928992-10929014 TTTGAATTGGGAAGGGAAGGAGG + Intergenic
1065399189 10:25277100-25277122 TTTAAATTGGATAGGCATGGTGG - Intronic
1067435848 10:46276508-46276530 TTAAATTGGGAGAGGGAAGGGGG + Intergenic
1067985567 10:51140030-51140052 TCTAGTTTGGAGAAGGAAGCTGG - Intronic
1068135203 10:52946346-52946368 TATATGTTGAAGAGGGAAGCAGG - Intergenic
1068240627 10:54297718-54297740 TTTAAATCGGAGAGGGAGAAGGG - Intronic
1070109670 10:73472775-73472797 TTTAAAATGGGCAGTGAAGCAGG + Intronic
1070408674 10:76119373-76119395 TTAAAAATGAAGAGGGAACCTGG + Intronic
1071159823 10:82732793-82732815 TTTACATTTGAGAGGCAAGGTGG - Intronic
1073351052 10:102820153-102820175 ATCAAACTGGAGAGAGAAGCAGG + Intergenic
1074260427 10:111848200-111848222 CTTATATTTGAAAGGGAAGCAGG + Intergenic
1074790546 10:116882207-116882229 TTTAAAAAGGAGAGGGAATTAGG - Exonic
1075067634 10:119300219-119300241 TTTAAAATGGAGAGGTGTGCAGG + Intronic
1078104957 11:8352502-8352524 GTTATAATGGAGAGGGCAGCAGG + Intergenic
1079006560 11:16795242-16795264 TTTAAATTAGGTAGGCAAGCTGG - Intronic
1079027375 11:16960120-16960142 CCTAAAGTGGAGAGTGAAGCCGG - Intronic
1079417826 11:20256215-20256237 TTGAAATTTGAGAGAGGAGCAGG + Intergenic
1080744695 11:35098185-35098207 GTTACATTGGATAGGGAGGCAGG + Intergenic
1081985105 11:47296090-47296112 CTTTAATGGGGGAGGGAAGCAGG + Intronic
1084048327 11:66583898-66583920 TTTAAAATGGAGATGGAGGCCGG - Intergenic
1084444084 11:69193354-69193376 ATTTAATTGGAAAGGGAGGCTGG + Intergenic
1085137778 11:74109228-74109250 ATTAAATTTGAAAGGGAGGCAGG - Intronic
1086613987 11:88792589-88792611 TTTACAATGGAGAAGTAAGCTGG - Intronic
1086993049 11:93327126-93327148 ATCATATTGGACAGGGAAGCTGG - Intergenic
1087319253 11:96638640-96638662 TTTAAATTAGAGAGGGAGAAGGG - Intergenic
1087749995 11:101996769-101996791 AAAAAACTGGAGAGGGAAGCAGG + Intronic
1089008187 11:115110544-115110566 TTTAGATAGGAGAAAGAAGCTGG + Intergenic
1089017686 11:115180408-115180430 GTTTAATTGGAGAAGGGAGCTGG + Intronic
1089657646 11:119962979-119963001 TTTGACCTGGAGATGGAAGCTGG + Intergenic
1090137797 11:124217087-124217109 TTTAAATTGGGGAGAGACACAGG - Intergenic
1090203450 11:124871944-124871966 ATTAGATTAGACAGGGAAGCAGG - Intronic
1090215513 11:124959708-124959730 TTTAAATTGGGGTGGGGGGCAGG - Intronic
1090388204 11:126368822-126368844 TTTAACTTGGAGAGGAGAGGAGG + Intronic
1091248281 11:134118825-134118847 TTTCAATTGGAGATGAGAGCGGG + Intronic
1091552788 12:1549581-1549603 CTTAAATTTAAAAGGGAAGCAGG + Intronic
1091661756 12:2389455-2389477 TTGAAGTAGGAGAGGCAAGCTGG + Intronic
1093275744 12:17123137-17123159 ACTAAAGTGGAGAGGGAGGCAGG - Intergenic
1093591093 12:20903706-20903728 GTTGAATTGGAGAAGGAACCTGG - Intronic
1093855846 12:24101188-24101210 ATAAAATTGGAGATGGAGGCAGG - Intergenic
1095526261 12:43129481-43129503 GTGAAAATGAAGAGGGAAGCAGG + Intergenic
1095732209 12:45518591-45518613 TTTTACTAGAAGAGGGAAGCCGG + Intergenic
1095804244 12:46301037-46301059 ATTAAGTGGGAAAGGGAAGCCGG + Intergenic
1095919817 12:47517854-47517876 TTTAAATAGGACAAGGATGCAGG - Intergenic
1096196674 12:49653042-49653064 TTTTAGTTGGAGAGGAAAGGTGG - Intronic
1097067011 12:56328067-56328089 TGCATACTGGAGAGGGAAGCAGG + Exonic
1097839319 12:64305779-64305801 TTAGAAGTGGATAGGGAAGCAGG - Intronic
1097975610 12:65683469-65683491 TGTAACTTGAAGTGGGAAGCAGG - Intergenic
1098622175 12:72614984-72615006 TATAAATTGGAGAAGGAGGAGGG + Intronic
1100081724 12:90860692-90860714 TTAAAATTGAAGATGGAAGAAGG - Intergenic
1100301294 12:93310302-93310324 TTTACGTGGGACAGGGAAGCTGG - Intergenic
1100501868 12:95182230-95182252 TTTTTTTTGGAGATGGAAGCTGG + Intronic
1100610234 12:96185877-96185899 CTGAAATTGGACAGGGAAGAGGG - Intergenic
1100926294 12:99551908-99551930 TTAAATCTGGAGAGGCAAGCAGG - Intronic
1101761938 12:107665779-107665801 TTGATAATGGAGAGGGACGCTGG + Intergenic
1102262789 12:111454929-111454951 TTGATAGTGGGGAGGGAAGCCGG - Intronic
1102677822 12:114670004-114670026 TTTAAATTAGGGAGCAAAGCAGG - Intergenic
1103447544 12:121004051-121004073 TTGAACTTGGAGAGGGAGGTGGG + Exonic
1104691808 12:130832141-130832163 ATTAAATTGCAGAGGCAGGCCGG - Intronic
1104767091 12:131337090-131337112 TTTAAATCAGAGAGGGAAAAGGG - Intergenic
1104882723 12:132083895-132083917 TTTAAATTGGGCAGGGGAGTCGG - Intergenic
1106355586 13:28979688-28979710 TTCAAAATGGAAAGGGAATCTGG + Intronic
1106574725 13:30963955-30963977 GTGAAATAGGAGAGGCAAGCTGG - Intronic
1106821185 13:33466377-33466399 TTGAAATAGGAGAGGGATGCAGG - Intergenic
1107296687 13:38916561-38916583 ATTAAATGGGAGAGGGAAAGAGG - Intergenic
1107777611 13:43862992-43863014 TTTAAAAAGGAGAGAGAAGAAGG - Intronic
1107850182 13:44563433-44563455 TTTGGATTGAAGTGGGAAGCAGG - Intronic
1108039339 13:46324729-46324751 TTGTTACTGGAGAGGGAAGCAGG - Intergenic
1109419588 13:62094077-62094099 TTTTCCTTGGAGAGGGAAGCTGG - Intergenic
1110328816 13:74248086-74248108 TTTATATTGGGGAGGAGAGCTGG + Intergenic
1110384062 13:74888083-74888105 TTTAAATGTGAGAGGTAAGCTGG - Intergenic
1110933347 13:81250835-81250857 TTTAAATAAGAGAGTGAACCAGG - Intergenic
1111121295 13:83854265-83854287 TTAAAGTTGGAGAGGGTAGTGGG - Intergenic
1111162754 13:84417403-84417425 ATGAAGTTGGAGAGAGAAGCTGG + Intergenic
1112773508 13:102818833-102818855 TTTAAAAAGGAGAGGGAAAGGGG - Intronic
1113299497 13:109002108-109002130 ATTAAATTGGAGTGGGGTGCAGG - Intronic
1113736364 13:112681172-112681194 TTTAAGGAGGAGATGGAAGCTGG - Intronic
1114509903 14:23250007-23250029 TTGAAATTGGAGAGGTTAGGAGG - Intronic
1114638673 14:24204163-24204185 ATAAAATTGGGGAGGTAAGCAGG + Intronic
1115154066 14:30318370-30318392 TTTAAAGTGAGGATGGAAGCAGG - Intergenic
1115776276 14:36719098-36719120 TTCAAAGTGGAGAGGAAAACTGG + Intronic
1117140080 14:52780970-52780992 TTTAAATATGACAGAGAAGCTGG + Intronic
1118406986 14:65434601-65434623 CTTACATAGGAGAGAGAAGCAGG + Intronic
1119573034 14:75693165-75693187 TTTTAGATGGAGAGGAAAGCAGG + Intronic
1119789599 14:77338071-77338093 TTTAAATTCCAAAGGGAAGAGGG - Exonic
1120096278 14:80391644-80391666 TTTAAATAAGAGATGGAACCAGG - Intergenic
1120198779 14:81515229-81515251 TTTAAATCAGAGAGGGAGGAGGG - Intronic
1121460193 14:94069802-94069824 TTTTAATTGTAAAGGGATGCTGG - Intronic
1122355156 14:101118492-101118514 ATTAAATTGCAGAGTGAAGGCGG - Intergenic
1122928900 14:104924258-104924280 TTTATCTTGGAGAACGAAGCTGG - Intergenic
1124841089 15:33242916-33242938 TGTAAAATGGAGAGGGGAGGGGG - Intergenic
1125463279 15:39926571-39926593 TTTAAAAATGAGAGAGAAGCGGG + Intergenic
1126925531 15:53581555-53581577 TTTACATAGGAGATGGAAGATGG + Intronic
1127296605 15:57614329-57614351 TTTACAGTTGATAGGGAAGCAGG + Intronic
1127421195 15:58807987-58808009 TGTAAATGGGAGAGGAAAGAAGG - Intronic
1127642744 15:60931045-60931067 TTTAAATGGCAGGGGGAAGAGGG + Intronic
1130133681 15:81163997-81164019 TTTAAATTGTAGTGTGAAGTTGG - Intronic
1131472408 15:92708607-92708629 TTGAAGTTGAAGAGGGAAGCAGG - Intronic
1131674303 15:94655339-94655361 TTAAAAGTGGAGAGAGAAGCTGG + Intergenic
1131676082 15:94672070-94672092 TTTACAGTGGAGAGGGGAGCTGG + Intergenic
1134211282 16:12279606-12279628 TCCCAAGTGGAGAGGGAAGCAGG + Intronic
1134913177 16:18047234-18047256 TTTAAATTTGAGAGTGGAGAGGG - Intergenic
1135813178 16:25608348-25608370 TTTAACTTGGTGAGGGAGACCGG + Intergenic
1135912492 16:26574094-26574116 TGTAAGTAGGAGAGGGAGGCAGG + Intergenic
1136511601 16:30741108-30741130 GTTAAATTGGAGAGAGGAGGTGG + Exonic
1137026317 16:35479155-35479177 TTGAAATTGGGGATGGAAGATGG - Intergenic
1138727620 16:59157739-59157761 TTTAAATTGGGTGGGCAAGCAGG + Intergenic
1140154287 16:72406628-72406650 CTTAAAGTGCTGAGGGAAGCAGG + Intergenic
1140556325 16:75925497-75925519 TTGAACTTGGAGAGGAAAGGTGG - Intergenic
1141277141 16:82598587-82598609 TCTACATTGCAGAGGGAAGTGGG - Intergenic
1141738129 16:85869072-85869094 TTCACTGTGGAGAGGGAAGCAGG + Intergenic
1142732166 17:1867096-1867118 TTTAAATTGGAGAGGGAATCGGG + Intronic
1142772355 17:2107686-2107708 TTTAACTTGGAGCTGGAAGAGGG + Intronic
1144426903 17:15151711-15151733 TCTGAAATGGAGAGGGAAGAGGG - Intergenic
1146514697 17:33480107-33480129 TTTAAAATGGAATGGGAAGATGG - Intronic
1147306138 17:39565728-39565750 TAGAAATATGAGAGGGAAGCTGG - Intergenic
1147441106 17:40447737-40447759 TTTAAAGTGGGGAGGGCAACAGG + Intronic
1148516611 17:48224388-48224410 TTTAAACTGGAGAGGCTAGGAGG + Intronic
1149357658 17:55859459-55859481 TTTAAATTGGGGAGGCAACTTGG + Intergenic
1149794350 17:59505676-59505698 TCTTACTGGGAGAGGGAAGCAGG + Intergenic
1149856788 17:60089429-60089451 TTGCCATTGGAGAGGGAAGAGGG - Intergenic
1151790014 17:76299280-76299302 TTGAAAATGTAGACGGAAGCAGG + Intronic
1151790604 17:76303336-76303358 TTGAAAATGTAGACGGAAGCAGG - Intronic
1152067622 17:78120478-78120500 TTTAGATTGGAAAGGAAAACAGG - Intronic
1152351948 17:79789233-79789255 TTTGAAGTGAAGAGAGAAGCTGG + Intergenic
1152917430 17:83048528-83048550 TGAAAAATGGAGAGTGAAGCTGG - Exonic
1155028005 18:21959838-21959860 TTTCAATAGGAGAGGAAAGAAGG + Intergenic
1155055715 18:22181094-22181116 TCTAAATTGGAGAAGAAACCAGG + Intronic
1156897555 18:42263628-42263650 TTTCAATTGGAAAGGCAACCAGG + Intergenic
1156914435 18:42448372-42448394 TTTATATTTCAAAGGGAAGCAGG - Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158872904 18:61706385-61706407 CTAATATTGGAGAGGGGAGCTGG - Intergenic
1161442664 19:4301217-4301239 CTTAAATTGGAGACTGAGGCAGG - Intronic
1161494485 19:4580046-4580068 TTTATTTTGGAGAGGGAATTTGG + Intergenic
1163925415 19:20337057-20337079 TTTACGTTGGAGAGGAAAGCAGG + Intergenic
925122708 2:1431885-1431907 TCTAACTTGCAGAGGGAAGGAGG + Intronic
928047398 2:27949911-27949933 TTTAAAAAGGAGAGGGCAACAGG - Intronic
928682394 2:33715786-33715808 TCCAAATTGGAGAAGGGAGCTGG + Intergenic
929330345 2:40674380-40674402 TTTAAATCGGAGAGGGAAAAGGG - Intergenic
929876452 2:45800729-45800751 TTAAAATTGGAGAAGGAACTTGG + Intronic
930119320 2:47747288-47747310 CTTATATTGAAAAGGGAAGCAGG + Intronic
930271601 2:49263675-49263697 TTTTAAAAGGAAAGGGAAGCAGG + Intergenic
930428237 2:51239061-51239083 ATTAAAGTAGAGAGGGAAGGAGG - Intergenic
931520630 2:63092752-63092774 TTTAGATTGGGGAGGGGAGGAGG + Intergenic
932337525 2:70939401-70939423 TTGACCCTGGAGAGGGAAGCGGG - Exonic
933263645 2:80157279-80157301 TTTATATTGAACAGGAAAGCGGG + Intronic
933343973 2:81060296-81060318 TTTAAATTAGGGAGAGAATCTGG + Intergenic
933346702 2:81095662-81095684 TTCAAATGGGAAAGGGCAGCAGG + Intergenic
933900147 2:86843930-86843952 TCTAAATTGAAGAGGGCAACAGG - Intronic
934706642 2:96485944-96485966 GATCAATTGGAGAGGGAAGGGGG - Intergenic
937849966 2:126623278-126623300 TTTAAATTGGAGAGCAACCCTGG - Intergenic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
939267624 2:139893664-139893686 ATAAAATTGAATAGGGAAGCTGG + Intergenic
939390597 2:141564293-141564315 TTAAACTTGGAGAGGCAAACTGG + Intronic
939469211 2:142598246-142598268 TATAAATTGGAAAGAGAAGTAGG + Intergenic
939857953 2:147383139-147383161 CTGAAATGGGAGAGGGAAGAAGG - Intergenic
940386015 2:153072654-153072676 GTTAAATTGGAGAGGTAGGCTGG - Intergenic
940909475 2:159197495-159197517 AGTAAATTCGAGTGGGAAGCTGG + Intronic
941301460 2:163807912-163807934 TTAAAAGTGGAGAGGAAGGCAGG + Intergenic
941504035 2:166318064-166318086 TTTAACATAGAGAGGGAAGTGGG - Intronic
941568304 2:167137170-167137192 TGTAATTTGGAGTGGGAGGCAGG + Intronic
942257243 2:174115637-174115659 TTGAAGTTGGAGAAGGAAACAGG - Intronic
942573260 2:177335286-177335308 TTTAATTTGGTAAGGAAAGCTGG + Intronic
942620463 2:177839517-177839539 ATGAAACTGGAGAGGGAAGCAGG - Intronic
942930557 2:181487329-181487351 TTTAAATTGGAGCTGTAAGAGGG + Intronic
943300166 2:186188410-186188432 TTTATATAGGAGAGGCCAGCTGG - Intergenic
944454033 2:199875135-199875157 TTTAAAGGAGAGAGGGAAGATGG + Intergenic
945553698 2:211252771-211252793 TTTAAATTAGATAGGACAGCAGG - Intergenic
946021056 2:216640398-216640420 TTTGAATTCATGAGGGAAGCTGG + Intronic
947394912 2:229676802-229676824 CATGAAATGGAGAGGGAAGCAGG - Intronic
1169863736 20:10177757-10177779 TTAAAGTTGGAGTGGGAAGGAGG + Intergenic
1170004286 20:11648053-11648075 TTTCAACTTGGGAGGGAAGCTGG - Intergenic
1170055345 20:12196814-12196836 TGTGAAGTGGTGAGGGAAGCTGG + Intergenic
1170632301 20:18075915-18075937 TCCAAAGTGGAGAGGGAAGAAGG - Intergenic
1171249329 20:23636555-23636577 TGTGACTTGGGGAGGGAAGCAGG + Intronic
1173789809 20:45820935-45820957 TTTAAAATAGAGATGGAGGCTGG - Intergenic
1174057539 20:47808677-47808699 TTTAAGTTAGAGATGGAGGCCGG - Intergenic
1174284562 20:49463442-49463464 TTTAAAATGAAGAGTGAAGCAGG - Intronic
1174485176 20:50856465-50856487 TTTTAAATGGAGTGAGAAGCTGG + Intronic
1175577749 20:60075283-60075305 TAAAAATTGGAGATGGAGGCTGG + Intergenic
1175631599 20:60543166-60543188 TTTAATTTGGAGAGGCTAGTGGG - Intergenic
1177135037 21:17299014-17299036 TTTAAATCAGAGAGGGAGGAGGG - Intergenic
1177262514 21:18749286-18749308 TTTAAATGGGAAAGAGCAGCAGG + Intergenic
1178454006 21:32729810-32729832 TTTAATTTGAAGAAAGAAGCTGG - Intergenic
1178739913 21:35189374-35189396 TTTAAATGCGAGAAGGGAGCGGG + Intronic
1178881032 21:36450220-36450242 TTTTAATTGGAGGGGGATGCAGG - Intergenic
1179034457 21:37747615-37747637 TTTAAGTGGGAGAGGGAGGCAGG + Intronic
1179723072 21:43326373-43326395 ATTAAATTGAAAAGGGAAGTAGG - Intergenic
1180239071 21:46487092-46487114 GTTAAATTGGAGAGGGCCACAGG + Intronic
1180947292 22:19703433-19703455 ATTAAAATACAGAGGGAAGCCGG - Intergenic
1181150816 22:20881981-20882003 TTTTAAGTGGAAAGAGAAGCAGG + Intronic
1182186752 22:28412085-28412107 TTTTAGTTGGTGAAGGAAGCTGG + Intronic
1182900580 22:33895047-33895069 CTTATATTGGAGAGGCAAGTGGG + Intronic
1183334526 22:37239074-37239096 TTGACATTGGAGGGGGAAGAGGG - Intronic
1183567626 22:38627269-38627291 TATAAAATGGAAAGGGAGGCCGG + Intronic
1183890873 22:40927511-40927533 TTTAAATTGAAGAGAAAAGATGG - Exonic
1185010540 22:48310450-48310472 TGCATATTGGAGAGGGAAGTGGG + Intergenic
1185305096 22:50110917-50110939 TTTTAATTGGAGATGGAGTCTGG - Intronic
949442257 3:4094627-4094649 TTAAAATTAGGGAGTGAAGCTGG - Intronic
950706482 3:14785647-14785669 TTCAAATGGGAAACGGAAGCTGG + Intergenic
951363104 3:21747993-21748015 TTCACATGGGAGAAGGAAGCAGG - Intronic
953030392 3:39176101-39176123 TTTCATCAGGAGAGGGAAGCTGG - Intergenic
953062615 3:39439871-39439893 ATGAATCTGGAGAGGGAAGCAGG - Intergenic
953314250 3:41911172-41911194 TTGAAATTGGAGAGTGAAACTGG + Intronic
953401045 3:42617496-42617518 TTTAAATGGGAGAAAGAAACAGG - Intronic
954050834 3:47975746-47975768 TTTTATTTGGGGAGGGAAGGTGG - Intronic
955494264 3:59515139-59515161 TTCAACTTGTGGAGGGAAGCTGG - Intergenic
957496744 3:81002212-81002234 TTTAAATAAGAGAGGGATCCTGG + Intergenic
958903330 3:99914060-99914082 TTTAAATTAGAGAGGGAATTTGG + Intronic
959518670 3:107300994-107301016 TGTAAATTGGACAGGGATGGGGG - Intergenic
960613986 3:119580340-119580362 TGTAAACTGGAGGGGGAAGTGGG - Exonic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
964602626 3:158518617-158518639 GTAAAATTGGAGAGGGATGGTGG - Intronic
967183284 3:186924937-186924959 TTTAAATGGGGGAGAAAAGCCGG + Intergenic
967232958 3:187358116-187358138 TTTAAACTAGAGAGAGAAGGAGG + Intergenic
967668270 3:192200716-192200738 TTAAAATGGGAGAGGGAATGGGG + Intronic
969352110 4:6603963-6603985 TCTGATTTGGAGAGGGAGGCTGG - Intronic
969946974 4:10793463-10793485 TGCAAACTGGAGAGGGAAGAAGG + Intergenic
969954094 4:10870465-10870487 GTGAATTTGGAGAGGGTAGCAGG + Intergenic
971732576 4:30404835-30404857 TATAAAGTGGAGGGGGAGGCAGG - Intergenic
972168323 4:36314100-36314122 TTTATATTTGAGAGGCAACCTGG - Intronic
973041381 4:45474054-45474076 TTTAAATTAGAGAGATAATCTGG - Intergenic
973934823 4:55833804-55833826 TTCAAATTGGAAAGGGAAAAGGG - Intergenic
974707068 4:65533078-65533100 TTGAAATTGAAGTGGGAAGTAGG - Intronic
975461932 4:74664046-74664068 TTTGAATTGGAGAGAGAAACTGG + Intergenic
975608705 4:76182443-76182465 TTTAAAAAGTAGAAGGAAGCAGG - Intronic
975890448 4:79021030-79021052 TTTAATATGAAGAGGAAAGCAGG + Intergenic
976519482 4:86009368-86009390 ATGAAATTGGAGAGAGAAGCAGG - Intergenic
978609862 4:110525855-110525877 ATTAATTGGGAGAGGGAAGCAGG + Intronic
980025700 4:127763729-127763751 TTTAAATTACAAAGTGAAGCTGG + Intronic
980799442 4:137730477-137730499 TTTAAATGGGATAGGGAACAGGG + Intergenic
981786335 4:148483324-148483346 AATAACTTGAAGAGGGAAGCTGG - Intergenic
981820932 4:148886702-148886724 TTCACATTGGACAGGGAATCTGG + Intergenic
982003392 4:151042135-151042157 ATTAAGTTGGAGAGGTAGGCAGG + Intergenic
982233543 4:153231427-153231449 TTTAGATGGAAGAGGGAAGTGGG + Intronic
982395285 4:154909313-154909335 TTTTAGTTAGAGAGAGAAGCAGG + Intergenic
983195483 4:164801935-164801957 TTTTAATTTGAGAGAGAGGCTGG + Intergenic
985120735 4:186638998-186639020 AGTAATTTGGAGAGGGAAGGTGG - Intronic
985126969 4:186704157-186704179 TTTAAAGGTGAGAGAGAAGCTGG - Intronic
985380708 4:189391883-189391905 TTTGAATTTGACAGGGAGGCTGG - Intergenic
985899144 5:2773712-2773734 GTAAAATGAGAGAGGGAAGCGGG - Intergenic
986846648 5:11764083-11764105 TATAAATGGAAGAGGGAGGCAGG + Intronic
987204457 5:15610593-15610615 GTTCAAGTGGAGAGGGAGGCAGG - Intronic
989243952 5:39232447-39232469 TTTCAATTTGAGAGGACAGCTGG - Intronic
989713338 5:44428174-44428196 TTCTAGTTGGAGAGGGAACCTGG - Intergenic
990119977 5:52439255-52439277 TTTACAATAGAGTGGGAAGCAGG + Intergenic
990188310 5:53231079-53231101 TTTAAATCAGAGAGGGAAAAGGG + Intergenic
991481794 5:67089247-67089269 TTAAACATGCAGAGGGAAGCAGG + Intronic
992238585 5:74739458-74739480 TCTAAATTGGAGAGGCATGATGG - Intronic
992455159 5:76909735-76909757 TTTAAATTAGAGAGGGAGAAGGG - Intronic
992794876 5:80246675-80246697 TTTGAATTTTAAAGGGAAGCAGG - Intronic
992848963 5:80784684-80784706 TTTAAAATGTGGAGGGAAGTGGG - Intronic
993991443 5:94662781-94662803 GTTAAATTAGGGAGGGAATCGGG + Intronic
994815037 5:104575527-104575549 TTTAAATAGGAGAGAGGAGTAGG + Intergenic
995011517 5:107261294-107261316 ATTATAGTGGAAAGGGAAGCAGG + Intergenic
995060369 5:107806577-107806599 GTTAACTTGGTGAGGGAAGGGGG - Intergenic
996099272 5:119430605-119430627 TTTAAATCAGAGAGGGAAAGGGG + Intergenic
996464360 5:123782487-123782509 TTGAAATTGGAAAGGAAATCAGG + Intergenic
997404596 5:133635125-133635147 TCTAAGTTGGAGTGGAAAGCAGG + Intergenic
998954828 5:147428358-147428380 TTAAAATTGGGGAGGATAGCAGG - Intronic
1000792171 5:165621454-165621476 TAAAGATTGGAAAGGGAAGCTGG + Intergenic
1002827859 6:790101-790123 TTTTAATTGGAGAGGGAAAAGGG + Intergenic
1003831681 6:10018860-10018882 TTTAAATTCCAGAGGGCAGATGG - Intronic
1004125245 6:12866692-12866714 TTTTATTTGCAGAGGGAAGCTGG - Intronic
1004338412 6:14785092-14785114 TTACAATGGGAGAGGGAGGCTGG - Intergenic
1005232570 6:23720647-23720669 GTTAAATTGAAGAGGTAAACGGG + Intergenic
1005671578 6:28111297-28111319 ATGAAATTGGAAAGGTAAGCAGG + Intergenic
1008041304 6:46802030-46802052 TTGAAATTGGAGAGCAAAGCTGG - Intronic
1009401984 6:63267373-63267395 TTCCAGTTGGAGAAGGAAGCAGG - Intergenic
1010427817 6:75746549-75746571 ATGAGATTGGAGAGGTAAGCAGG + Intergenic
1011736894 6:90319842-90319864 TTTAAATTAGAGATGGAGGATGG - Intergenic
1012110759 6:95229282-95229304 TTTAAATTGTAAAGGAAACCTGG + Intergenic
1013122647 6:107154837-107154859 ATTAAATTGGGGAGGGGAGATGG + Intronic
1013892423 6:115040531-115040553 TTTAAATCAGAGATGGATGCTGG - Intergenic
1014038014 6:116790511-116790533 TATAAATTATAGAGGGAACCAGG + Intergenic
1014069937 6:117169119-117169141 TTTGAAATGGAGAGGCAATCAGG + Intergenic
1015799128 6:137043401-137043423 TTTTAATCGAAGAGAGAAGCTGG - Intronic
1015922667 6:138281169-138281191 TTTAAGTTAGACAGGCAAGCAGG + Intronic
1016023400 6:139259356-139259378 ATGAAGTTGGAGAGGTAAGCAGG - Intronic
1016188454 6:141228752-141228774 TTTAAAGTGGAGAGGGCAAAGGG - Intergenic
1016691987 6:146948744-146948766 TATAAATAGAAGAGGGAGGCAGG - Intergenic
1017358461 6:153537827-153537849 TATTAATTGGAGAGGGAAAAGGG - Intergenic
1018405492 6:163477425-163477447 TTTAAATTGGAGATGTAGGAAGG + Intronic
1020617119 7:10473424-10473446 TTTAATTTGGAGTGTGCAGCTGG + Intergenic
1021088101 7:16447790-16447812 TTTATATTGGAAAAGGAAGAAGG - Intergenic
1022195679 7:28065203-28065225 TTTAAATAGGAGAGGACAGAAGG + Intronic
1023310466 7:38881337-38881359 TGTAAATGGAAGAGGGAGGCAGG - Intronic
1023433199 7:40115609-40115631 AATAAATAGGAGAGAGAAGCCGG + Intergenic
1023601116 7:41882718-41882740 TTCAAATTGCAAGGGGAAGCTGG + Intergenic
1024155357 7:46617125-46617147 TTTAGATTGGAGAGGGGAGTAGG - Intergenic
1024386550 7:48758366-48758388 TTTTTATTTGAGACGGAAGCTGG - Intergenic
1026276258 7:68879672-68879694 TTGAAAGTGGAGAGAGAGGCAGG - Intergenic
1027455914 7:78391848-78391870 TTTATATTGCAGTGGGAATCAGG - Intronic
1028094471 7:86743449-86743471 TTTAAAATAGAAAGGGAAGAAGG - Intronic
1028451186 7:90985082-90985104 TTTTAATTAGAGAGAGAAACTGG + Intronic
1028819215 7:95186714-95186736 TTTTAATTGTAAAGGGATGCTGG + Intronic
1028832113 7:95339699-95339721 TTTAAATGAGAGAGGGAAATGGG + Intergenic
1031247898 7:119340498-119340520 TTTAAATTGTATAAGGAAGGTGG - Intergenic
1031314704 7:120241341-120241363 TATAGACTGGAGAGGGAAACTGG + Intergenic
1031406069 7:121389049-121389071 TTTTAAGTGGAGGGAGAAGCAGG - Intronic
1032003658 7:128283136-128283158 TTTAAAATGGAGAAGAAAGAAGG + Intergenic
1033528129 7:142236813-142236835 GAGAAATTGGAGAGGGGAGCAGG + Intergenic
1033587866 7:142787644-142787666 TATATTTTGGAGAGGGAAGTTGG + Intergenic
1033615728 7:143012429-143012451 TATAAATTGGAGTGGGAAATTGG + Intergenic
1035017479 7:155779210-155779232 TTTAATTTGGAGTGGGAGGGAGG + Exonic
1035229559 7:157456330-157456352 TTCAAATTGGAAAGGAAAGCCGG - Intergenic
1036406490 8:8460062-8460084 TTTAAAGTGGAAAGGTTAGCAGG - Intergenic
1037056274 8:14445550-14445572 TTTTCAGTGGAGAGGGCAGCTGG - Intronic
1037718176 8:21417582-21417604 TGAAAATTGGAGAGAGCAGCCGG - Intergenic
1037938799 8:22933957-22933979 TTTAGAAGGGAAAGGGAAGCTGG + Intronic
1038252301 8:25916565-25916587 TTAATATTGGAGAGATAAGCAGG - Intronic
1039012741 8:33112698-33112720 TTAAAGTTGGAGAGGTAGGCTGG + Intergenic
1039622904 8:39016251-39016273 TTTAATTTGGAGACAGAAACAGG - Intronic
1042549491 8:69981643-69981665 TTTAAAATGGATAGAGAACCAGG + Intergenic
1042880905 8:73487587-73487609 TTCAAATTGCAGAGTGCAGCAGG - Intronic
1043439004 8:80260441-80260463 TTTTCAGTGGAGAGGGGAGCTGG + Intergenic
1044456679 8:92398651-92398673 TTTAAATCAGAGAGGGAGACAGG + Intergenic
1045391481 8:101719338-101719360 TGTAACTTCGAGGGGGAAGCTGG - Exonic
1045854843 8:106752864-106752886 TTTAAAATGGAGATGGGAGAAGG + Intergenic
1045971363 8:108082889-108082911 TTTAAAGAAGAGAGGGAAGGAGG + Intronic
1046687099 8:117239822-117239844 TTTAAAGTGGAGGGAGAAGGAGG - Intergenic
1047276464 8:123409257-123409279 ATTATATTGGGGTGGGAAGCAGG - Intronic
1049285827 8:141774730-141774752 TTTTCCTTGGAGAGGGAGGCTGG + Intergenic
1049914532 9:304543-304565 TTTAATTTGGAGAGAGAAAGAGG - Intronic
1051380352 9:16451719-16451741 TTTTAATGGGAGTGGGAAGGTGG - Intronic
1051933309 9:22412917-22412939 ATTAGATGGGAGAGGGAAGGAGG + Intergenic
1052538121 9:29773899-29773921 TGTAAATTGGAGAGTACAGCTGG + Intergenic
1055687420 9:78791700-78791722 TTTCACTGGGACAGGGAAGCAGG + Intergenic
1056453222 9:86736513-86736535 TTTAATTTTGAGAGTGAAGGGGG + Intergenic
1060626337 9:125115766-125115788 TTCCAATAGGAGAGGGAAGGAGG + Intronic
1061157212 9:128871018-128871040 TTTAAATTGTAGAGACAGGCTGG + Intronic
1061879194 9:133560271-133560293 TTTAAACTGGACAGTGCAGCAGG - Intronic
1185757711 X:2665115-2665137 TTGAAATTGCAGAGGGGAGCAGG + Intergenic
1186357562 X:8803160-8803182 TTTAAAATGTTGAGGGAAGAAGG - Intergenic
1186432422 X:9516308-9516330 TTTATTTTGGAGAAGGAAGTGGG - Intronic
1186447243 X:9642078-9642100 TTTAAATGTCAGAGGGAAGCAGG + Intronic
1186617931 X:11208981-11209003 TTTAAAATGTTGAGGGAAGAAGG + Intronic
1189588649 X:42488505-42488527 GTGGAAGTGGAGAGGGAAGCGGG - Intergenic
1192105892 X:68316701-68316723 TATACATTGAAGAGGGAGGCAGG - Intronic
1193948366 X:87765731-87765753 TTTATATTTAAAAGGGAAGCAGG - Intergenic
1194834395 X:98663335-98663357 TTTAAAGTGGAAAGGGACACTGG + Intergenic
1195344524 X:103936140-103936162 TTTAAATTTCATATGGAAGCTGG - Intronic
1195620329 X:106946936-106946958 TTAAAATTGAAGAAAGAAGCTGG - Intronic
1195644409 X:107212403-107212425 TTTAAAGTGAAGAAGGACGCTGG - Intronic
1195902197 X:109810849-109810871 TAAAAATTTAAGAGGGAAGCTGG - Intergenic
1196292286 X:113956998-113957020 TAAAAGTGGGAGAGGGAAGCAGG + Intergenic
1197041094 X:121936542-121936564 TTTATATTGGCAAGGCAAGCAGG - Intergenic
1197491829 X:127127401-127127423 TTTAAACTGGAGAGGGTAAATGG + Intergenic
1197604867 X:128573863-128573885 TTTAATTTGGAGAGGAATCCTGG - Intergenic
1198607583 X:138358843-138358865 TGTGAAGTGGAGAGGGAAGTGGG - Intergenic
1198857027 X:141030044-141030066 TTTAAAGGGAAAAGGGAAGCAGG - Intergenic
1198905668 X:141557323-141557345 TTTAAAGGGAAAAGGGAAGCAGG + Intergenic
1199001723 X:142646802-142646824 TTTAAGTTGAAGAGGAAAGGGGG + Intergenic
1199754303 X:150850178-150850200 ATCAGGTTGGAGAGGGAAGCAGG + Intronic
1200880859 Y:8210172-8210194 TTTAAATCAGAGAGGGAAAGGGG + Intergenic
1201341038 Y:12934716-12934738 TTTGAAGTGGAGATGGAAGTGGG - Intergenic
1201516034 Y:14819470-14819492 TTTAAATTGGAGAGGGAGAAGGG + Intronic