ID: 906263090

View in Genome Browser
Species Human (GRCh38)
Location 1:44407675-44407697
Sequence GGGTTCTGCGGCCCGCACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906263090_906263102 19 Left 906263090 1:44407675-44407697 CCGCGGTGCGGGCCGCAGAACCC 0: 1
1: 0
2: 1
3: 3
4: 87
Right 906263102 1:44407717-44407739 CCGCAGTCCAGGAGCTGGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 165
906263090_906263103 24 Left 906263090 1:44407675-44407697 CCGCGGTGCGGGCCGCAGAACCC 0: 1
1: 0
2: 1
3: 3
4: 87
Right 906263103 1:44407722-44407744 GTCCAGGAGCTGGAAGGGCCCGG 0: 1
1: 0
2: 5
3: 41
4: 514
906263090_906263099 14 Left 906263090 1:44407675-44407697 CCGCGGTGCGGGCCGCAGAACCC 0: 1
1: 0
2: 1
3: 3
4: 87
Right 906263099 1:44407712-44407734 CGCATCCGCAGTCCAGGAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 90
906263090_906263100 18 Left 906263090 1:44407675-44407697 CCGCGGTGCGGGCCGCAGAACCC 0: 1
1: 0
2: 1
3: 3
4: 87
Right 906263100 1:44407716-44407738 TCCGCAGTCCAGGAGCTGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 178
906263090_906263098 8 Left 906263090 1:44407675-44407697 CCGCGGTGCGGGCCGCAGAACCC 0: 1
1: 0
2: 1
3: 3
4: 87
Right 906263098 1:44407706-44407728 GCACTGCGCATCCGCAGTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906263090 Original CRISPR GGGTTCTGCGGCCCGCACCG CGG (reversed) Intronic