ID: 906266921

View in Genome Browser
Species Human (GRCh38)
Location 1:44438648-44438670
Sequence GGTGGCCTGTGACCCATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906266918_906266921 -2 Left 906266918 1:44438627-44438649 CCTAGTACTGGATGTTTCTTAGG 0: 1
1: 0
2: 1
3: 4
4: 120
Right 906266921 1:44438648-44438670 GGTGGCCTGTGACCCATTTAAGG 0: 1
1: 0
2: 0
3: 13
4: 102
906266913_906266921 30 Left 906266913 1:44438595-44438617 CCATTGAGCTTACAGCTACATCA 0: 1
1: 0
2: 0
3: 13
4: 137
Right 906266921 1:44438648-44438670 GGTGGCCTGTGACCCATTTAAGG 0: 1
1: 0
2: 0
3: 13
4: 102
906266917_906266921 6 Left 906266917 1:44438619-44438641 CCAGGGAACCTAGTACTGGATGT 0: 1
1: 0
2: 0
3: 11
4: 101
Right 906266921 1:44438648-44438670 GGTGGCCTGTGACCCATTTAAGG 0: 1
1: 0
2: 0
3: 13
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906266921 Original CRISPR GGTGGCCTGTGACCCATTTA AGG Intronic
900917488 1:5649039-5649061 GGGGCCCTGTGACTCATGTAAGG - Intergenic
903377633 1:22876602-22876624 GGTGCCCTGTGACCCCTGCAAGG - Intronic
903759716 1:25689492-25689514 CGTGTCCTATGACCCATTTGTGG - Intronic
905296063 1:36955201-36955223 GGTGGGCTGTCACTTATTTAGGG - Intronic
906266921 1:44438648-44438670 GGTGGCCTGTGACCCATTTAAGG + Intronic
906663465 1:47599090-47599112 GATGGGCAGTGACCCATTGAGGG - Intergenic
915670347 1:157483568-157483590 CCTGGCCAGTGACCCATCTAGGG - Intergenic
916370908 1:164093086-164093108 GGTGCCCTGTGTCCCAGCTATGG - Intergenic
917158008 1:172025470-172025492 GGTGGTCAGGGACCCACTTAAGG - Intronic
919247744 1:195010821-195010843 GGTGTATTATGACCCATTTAAGG + Intergenic
921608665 1:217184916-217184938 ACTGGCTTATGACCCATTTATGG + Intergenic
922979847 1:229816470-229816492 GGGGGCCTCTGAGCCATTTCTGG + Intergenic
1063683835 10:8216774-8216796 GGTGGACTGTGAACCTTTTGGGG + Intergenic
1063724186 10:8619067-8619089 GATGGCCAGTGACTCATCTATGG + Intergenic
1066993427 10:42539185-42539207 GGGGGTCAGTGACCCATTTGAGG + Intergenic
1067352397 10:45488216-45488238 GGTGGCCTGTGATCCAGTTCTGG + Intronic
1075073628 10:119335742-119335764 GGTGGCCTGTGACACAAGTCCGG - Intronic
1077977286 11:7261128-7261150 GACAGCCTGTGACCCACTTAAGG - Intronic
1085675677 11:78515316-78515338 GGTGGCCTGTGACACAGGTTGGG + Intronic
1085745123 11:79108746-79108768 GCTGGCCTGTGAGCCATGGAGGG - Intronic
1086067231 11:82758788-82758810 GGTCAACTGTGACTCATTTATGG - Intergenic
1086444249 11:86857642-86857664 GATGGCCTATGACCGATTTGTGG - Intronic
1089467404 11:118694213-118694235 GGTGGCCAGGGACCCAGTTCTGG + Intergenic
1091917186 12:4278125-4278147 AATGGCCTGTGAAACATTTAGGG + Intronic
1091927861 12:4370423-4370445 GATGGCCAGTGACCCATTAGGGG - Exonic
1098550842 12:71759498-71759520 GATGGCCTGTGGCCCATGCATGG - Intronic
1101494248 12:105238498-105238520 TGTAACCTGTGACCCATTGAAGG + Intronic
1103772203 12:123336705-123336727 GGAGTCTTGTGACCCATTTGTGG - Intronic
1106773366 13:32984457-32984479 GGTGGCCTGTGATGCATTCATGG + Intergenic
1111565448 13:90008779-90008801 GCTGGCCTGTGACCCTATTAAGG + Intergenic
1113328478 13:109306657-109306679 GGTGGCAAGTGACCTATTAAGGG - Intergenic
1114764732 14:25358106-25358128 GATGGCCTATGACCCATTTGTGG + Intergenic
1119488220 14:75006511-75006533 TGTGGCCAGTGGCCCTTTTAGGG + Intronic
1120204692 14:81574960-81574982 GGTGAACAGTGGCCCATTTAAGG + Intergenic
1122125097 14:99574591-99574613 GGTGGCCTGCGAGGAATTTAGGG + Intronic
1123949439 15:25256274-25256296 GGGGGTCAGGGACCCATTTAAGG - Intergenic
1125550059 15:40538419-40538441 GGTGCCCTGTGACCCCTTGAGGG - Intronic
1125605376 15:40937230-40937252 GGAGGCCTGTGACTCTCTTAGGG + Intronic
1126365048 15:47885715-47885737 GGTGGCCTTTATCCCATTAACGG + Intergenic
1127652312 15:61021202-61021224 GTAGCCATGTGACCCATTTATGG - Intronic
1130679946 15:85987981-85988003 GCTGGCCTGTGACACAGTTCTGG - Intergenic
1132101714 15:99028345-99028367 GGTGGGGTGTGACCCATCTCCGG + Intergenic
1134008280 16:10832989-10833011 AGAGGCCAGTGACTCATTTAGGG - Intergenic
1134837181 16:17370881-17370903 GAGGGCCTGTGACCCTTCTAAGG - Intronic
1139323169 16:66131741-66131763 GGTGGCCTGTGACTTTATTATGG - Intergenic
1141154437 16:81587419-81587441 GGGGGCCTGTGACCCAGTGGGGG + Intronic
1141633626 16:85302425-85302447 GGTGTGCTGTGACTCATTTGTGG - Intergenic
1142875711 17:2851159-2851181 GGTGGCGTGTGGCCCAATTGTGG + Intronic
1146959595 17:36962430-36962452 ACAGGTCTGTGACCCATTTAGGG - Intronic
1157397418 18:47354460-47354482 GGTGACCTGTGACTCACTTCAGG - Intergenic
1160430395 18:78807460-78807482 GTTGCCATGTGACCCATTCAGGG - Intergenic
1162018075 19:7856401-7856423 GGTGGCTTGTGGCCCAATTACGG - Intronic
1165351132 19:35276629-35276651 GGTGGCCTGAAAACCATTTCAGG - Intronic
1166597022 19:44059083-44059105 GGTGTTCTGTGACCCATTTGTGG + Intronic
1167768337 19:51499075-51499097 GGTGACCTGAGACCCTTTTGTGG - Intronic
1168666651 19:58209725-58209747 GGTGCCCTGTGACCCTTGGAGGG + Intronic
934590626 2:95546937-95546959 GATGGCCTATGACCGATTTGTGG + Intergenic
938224926 2:129607332-129607354 GGTGACCTGTGGCCCCTTTTGGG - Intergenic
940114474 2:150192841-150192863 GGGGGTCTGGGACCCATTTGAGG - Intergenic
940420562 2:153476560-153476582 GATGGCCGTTGACACATTTAAGG - Intergenic
945623397 2:212170649-212170671 GGTGCCCTGTGTCCCAGCTATGG + Intronic
947837285 2:233184801-233184823 GGTGGACTGTGACCCACTCTAGG + Intronic
1172006770 20:31823381-31823403 GCTGGCCTGGGCCCCATCTAGGG - Intronic
1176315283 21:5237041-5237063 GGTGCCCTGTGTCCCAATCATGG + Intergenic
1178671386 21:34594583-34594605 GGTGGCAAGGTACCCATTTAGGG + Intronic
1180839823 22:18954128-18954150 GGGGAGCTGGGACCCATTTAGGG + Intergenic
1181062072 22:20286351-20286373 GGGGAGCTGGGACCCATTTAGGG - Intergenic
949415971 3:3814398-3814420 GATGGCAAGGGACCCATTTATGG - Intronic
957615686 3:82523795-82523817 GGTGGGATGTGAGCCATGTAAGG - Intergenic
959981696 3:112524780-112524802 GATGGCCTATGACCAATTTGTGG - Intergenic
961002170 3:123381334-123381356 TGTGGCCTGTGCCACATTCAGGG + Intronic
962959932 3:140301622-140301644 GGTTCCCTGTGACCCTTTTGGGG - Intronic
965620839 3:170641074-170641096 TGGAGCCTGTGACCCAGTTATGG + Intronic
974127566 4:57714787-57714809 GGTGGTCAGGGACCCACTTAAGG - Intergenic
977631417 4:99247680-99247702 GGGGGTCAGGGACCCATTTAAGG + Intergenic
978860830 4:113446990-113447012 TGTGGCCTGTGATCCAGTTCTGG + Intergenic
980545819 4:134260219-134260241 GGTGCCCTGTGTCCCAATCATGG - Intergenic
983610462 4:169638849-169638871 GTGGGCATGTGACCCAATTATGG - Intronic
984775252 4:183476151-183476173 GGTGGTCTGAGACCCCATTAAGG + Intergenic
987656596 5:20815297-20815319 GGGGGTCAGGGACCCATTTAAGG - Intergenic
988141803 5:27252894-27252916 GGAGCCATGTGACACATTTAAGG - Intergenic
988766957 5:34388648-34388670 GGGGGTCAGGGACCCATTTAAGG + Intergenic
989583317 5:43053803-43053825 GGGGGCCAGGGACCCACTTAAGG - Intergenic
990155982 5:52877809-52877831 TGTGGGCTGAGACCCATTTTGGG + Intronic
1001782335 5:174380731-174380753 TCTGGGCTGTGACCAATTTAGGG + Intergenic
1009774166 6:68183501-68183523 GGTGGCCTGAGACCATTATATGG + Intergenic
1011792693 6:90915489-90915511 GGTGCCCTGTGACCCAGCTGTGG + Intergenic
1015789057 6:136948178-136948200 GTAGGTCTGTGACCCATTTTGGG - Intergenic
1016601394 6:145865542-145865564 GGTGGCCTTTGACCCTGTTTAGG + Intronic
1029699349 7:102236270-102236292 GGTGGCCTCTGCCCCATTCAGGG + Intronic
1029915583 7:104206644-104206666 GGTGGCCTGTGAAGCATTAGTGG - Intronic
1030061199 7:105622703-105622725 GGGGGCATGTGACCCATTTCTGG + Intronic
1036614367 8:10377285-10377307 GGTGGCCTGAAGCCCCTTTAAGG + Intronic
1037426985 8:18766816-18766838 GGTGGCCTGTGGCCCTATTCAGG - Intronic
1040680920 8:49807493-49807515 GGTGGCCTATCAGACATTTAAGG - Intergenic
1042159312 8:65876172-65876194 GGTGGCCTGTGACCCTGTTTTGG + Intergenic
1042807625 8:72789045-72789067 AGTGGCCTGTGAGTCATTTAAGG - Intronic
1043497969 8:80823621-80823643 GGTGGTCAGGGACCCACTTAAGG - Intronic
1046495661 8:115010420-115010442 AGTGGCCTGAGACCCATATCTGG + Intergenic
1048564063 8:135575598-135575620 GGTGGCCTGTGATCCAATTCTGG - Intronic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1050484516 9:6119561-6119583 AGTGGCCTGTAACCCTATTAGGG + Intergenic
1052758084 9:32562056-32562078 GGTAGCCTGGGACCAATTTATGG - Intronic
1053066867 9:35075195-35075217 GGTGGGCTGGGACACATTAAAGG + Intronic
1054344969 9:63905585-63905607 GGTGCCCTGTGTCCCAATCATGG + Intergenic
1054904871 9:70405986-70406008 GGTGGCCTATGCCCTTTTTATGG - Intronic
1056753083 9:89365453-89365475 GGTGGCCCATGGCCCATTTGGGG - Intronic
1060779049 9:126398310-126398332 GGTTGCCAGGGACGCATTTATGG - Intronic
1062251453 9:135597700-135597722 TGTGGGTTGTGCCCCATTTATGG + Intergenic
1203454169 Un_GL000219v1:149579-149601 GGTGCCCTGTGTCCCAATCATGG + Intergenic
1186246271 X:7619864-7619886 AGTGGCATGTTGCCCATTTAAGG - Intergenic
1186889333 X:13944872-13944894 GGTGGCCTTTGTCCCACTCATGG - Intergenic
1189912450 X:45824727-45824749 GGTGGGCTGTGAGCCCTTCATGG - Intergenic
1191610211 X:63103585-63103607 GGGGGTCCGTGACCCACTTAAGG - Intergenic
1191781110 X:64866776-64866798 GGTGGTCTGGGAACAATTTAGGG + Intergenic
1197544857 X:127812263-127812285 GGTGCCCTGTGTCCCACCTATGG + Intergenic