ID: 906271031

View in Genome Browser
Species Human (GRCh38)
Location 1:44478874-44478896
Sequence GGAGTGCACCAACAGCCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906271031_906271039 22 Left 906271031 1:44478874-44478896 CCCCGTGGCTGTTGGTGCACTCC 0: 1
1: 1
2: 0
3: 2
4: 84
Right 906271039 1:44478919-44478941 TCATCCTTGGACATCACCCATGG 0: 1
1: 0
2: 1
3: 9
4: 128
906271031_906271037 9 Left 906271031 1:44478874-44478896 CCCCGTGGCTGTTGGTGCACTCC 0: 1
1: 1
2: 0
3: 2
4: 84
Right 906271037 1:44478906-44478928 CCTTCCTTTTCTATCATCCTTGG 0: 1
1: 1
2: 2
3: 29
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906271031 Original CRISPR GGAGTGCACCAACAGCCACG GGG (reversed) Intronic
900356767 1:2268715-2268737 GGACTGCACCTACAGCCCCTGGG - Intronic
904388213 1:30161478-30161500 GGAGTGCATGGGCAGCCACGGGG - Intergenic
906271031 1:44478874-44478896 GGAGTGCACCAACAGCCACGGGG - Intronic
913426591 1:118738152-118738174 GGAGGTCACCACCAGCCACAGGG - Intergenic
917438367 1:175044076-175044098 GGAGGACAGCAGCAGCCACGCGG + Intergenic
1063069654 10:2648434-2648456 GGAGTCCAACAACAGGCAGGAGG - Intergenic
1067052292 10:43028666-43028688 GCAGCAAACCAACAGCCACGTGG - Intergenic
1069748313 10:70730067-70730089 GGAGAGCACCAACAGCCACGTGG - Intronic
1073779375 10:106820526-106820548 AGAGTGCACCACCAGCCTCAGGG - Intronic
1077141870 11:1028296-1028318 GGAGTCCACAAACAGCGAGGCGG + Exonic
1079268683 11:18960864-18960886 GGAGAGCACCAGCAGGCAGGTGG - Intergenic
1080109322 11:28547709-28547731 TGAGTGCAGCAAGAGCAACGTGG + Intergenic
1081934430 11:46895232-46895254 GGGCTGCACCAACAGCGAAGGGG - Exonic
1084488714 11:69465984-69466006 GGGGTTCACCATCAGCCATGGGG + Intergenic
1085644054 11:78211115-78211137 GGAGGGGACCAACACCCACTAGG - Intronic
1089337026 11:117732313-117732335 GGATTGCACCAACAGTGATGTGG + Intronic
1090238622 11:125166530-125166552 GGAGTGCTCCAGGAGCCACCTGG + Intronic
1097229174 12:57498706-57498728 GGAGTGCCCAGACAGCCACCCGG - Intronic
1108529310 13:51314265-51314287 GGAGTGGAACAACAGACACCGGG + Intergenic
1127078975 15:55357048-55357070 GGAGAACACCAACATCCATGGGG - Intronic
1136776973 16:32877227-32877249 GGAGAGCAGCCACACCCACGGGG - Intergenic
1136893644 16:33984286-33984308 GGAGAGCAGCCACACCCACGGGG + Intergenic
1141144609 16:81520225-81520247 TGAGTGCACCAGCAGGCAAGAGG - Intronic
1142187691 16:88702187-88702209 GGGGTGCACCACCAGCCAGTGGG + Intronic
1203079389 16_KI270728v1_random:1139336-1139358 GGAGAGCAGCCACACCCACGGGG - Intergenic
1144865294 17:18331711-18331733 GCATTGCACCAACAGCCCCAGGG + Intronic
1151069819 17:71196059-71196081 AGAGGGGACCAACAGCCACCAGG - Intergenic
1151616702 17:75217784-75217806 GGTGTGCACCACCAGCCCCCTGG + Intronic
1151698063 17:75728093-75728115 GGAGGGCACCCCCTGCCACGAGG + Intronic
1160510141 18:79448898-79448920 CGTGTCCACCACCAGCCACGAGG + Exonic
1160542532 18:79632561-79632583 GGATTTCACAACCAGCCACGGGG - Intergenic
1162468300 19:10856268-10856290 GGAGAGCACCAAGATCCAAGTGG - Exonic
1162494071 19:11013499-11013521 GGACTGCTCCACCAGCCTCGGGG + Intronic
1164982638 19:32625876-32625898 GGCCTGCACCTACGGCCACGAGG - Exonic
1164996262 19:32721584-32721606 GGAGTTCGAGAACAGCCACGTGG - Intronic
1167692634 19:50996175-50996197 GGAGTGCACCATCACACACCAGG + Exonic
1168614498 19:57826819-57826841 GGTGTGGACCAACAGCGACCTGG + Intronic
926898023 2:17716549-17716571 GCAGTGCACCTACAGCCAGCTGG - Intronic
927139710 2:20121485-20121507 GGGAGGCTCCAACAGCCACGTGG - Intergenic
927488766 2:23506635-23506657 GGGCTGCAGCCACAGCCACGGGG + Intronic
931275631 2:60741544-60741566 AGAGGGCACCAACAAACACGAGG + Intergenic
934047073 2:88181050-88181072 GGAGTGCATCACCAGCCCTGAGG - Intronic
937450836 2:122001045-122001067 GAACTGCAGCAGCAGCCACGCGG + Intergenic
941568401 2:167138551-167138573 GGAATGCACCAACATGCACACGG - Intronic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1170871738 20:20212507-20212529 GGTGTGCACCAGAAGCCAGGTGG + Intronic
1175572787 20:60036804-60036826 GCAGAGCACCAGCAGCCAGGGGG - Intergenic
1180880015 22:19197047-19197069 ACAGTGAAACAACAGCCACGTGG - Intronic
1181177368 22:21045356-21045378 TGAGGGCAGCAACAGCCCCGGGG + Intergenic
1181407813 22:22697360-22697382 GCAGTGCACCCACATCCACACGG - Intergenic
1181412464 22:22734028-22734050 GCAGTGCACCCACATCCACACGG - Intergenic
1181420091 22:22791942-22791964 GCAGTGCACCCACATCCACACGG - Intronic
1181424142 22:22822228-22822250 GCAGTGCACCCACATCCACACGG - Intronic
1184477537 22:44729690-44729712 AGAGAGCCCCAACAGCCGCGAGG + Intronic
1185250431 22:49798942-49798964 GGAGTGCACCACTGGCCACGGGG - Intronic
949294253 3:2502291-2502313 GGAATGCACCATGAGACACGTGG - Intronic
950141894 3:10621306-10621328 GCAGGGAACCCACAGCCACGAGG + Intronic
952694502 3:36249936-36249958 GGGGTGGAACAACAGCCATGTGG - Intergenic
952776767 3:37053907-37053929 GGAGATGACCAACAGCCACCTGG - Exonic
956898497 3:73688377-73688399 GGAGTGCACCAGCTGCCAAATGG + Intergenic
960908096 3:122621755-122621777 GGAGGGCACCACCAGCTACTGGG + Intronic
961614255 3:128166381-128166403 CAAGTGCTCCAACAGCCATGAGG - Intronic
966260810 3:177976667-177976689 GGAATGTACCAACTGCCATGGGG + Intergenic
976751078 4:88451875-88451897 GGCGTCCACCAACAACCACCTGG - Intergenic
981133077 4:141180206-141180228 CTTGTGCTCCAACAGCCACGTGG - Intronic
993016061 5:82535918-82535940 GGAAAGCACCAGCAGCAACGGGG + Intergenic
1000880887 5:166695815-166695837 GGAGTGTACCATCATCCACTGGG - Intergenic
1014481995 6:121950745-121950767 GAAGTGCACCTCCAGCCAGGAGG + Intergenic
1017987254 6:159455262-159455284 GGGGTGCAGCGACAGCCAAGAGG + Intergenic
1019364754 7:627657-627679 GGAGGGCACCAACACCCCCCAGG + Intronic
1022537014 7:31104663-31104685 GGACTTGACCACCAGCCACGTGG + Intronic
1024209582 7:47192090-47192112 GGAGTGGCCCATTAGCCACGAGG + Intergenic
1024286632 7:47763408-47763430 GGACTGCACCAACACTCACCGGG + Intronic
1027124639 7:75547642-75547664 GGAGAGCAGTAGCAGCCACGGGG - Intronic
1028443544 7:90892379-90892401 GTGGTGCAACAACAGCCATGAGG - Intronic
1030492502 7:110255321-110255343 GGAGGGCAGCAACACCCACTGGG - Intergenic
1037808299 8:22070389-22070411 GGACTGCAGCAAGAGCCAAGGGG - Intronic
1038725916 8:30082697-30082719 GGAGAGCACGAACAGCAAAGAGG + Intronic
1049755094 8:144307743-144307765 GGAGTGCACCAGCACCAACATGG - Intronic
1052263529 9:26545720-26545742 GGAGTGGAACAACAGCCACTGGG + Intergenic
1052446514 9:28568293-28568315 GGAGAGGAACAACAGACACGGGG + Intronic
1060934481 9:127507291-127507313 GGAGTACAGCAACAGCGGCGGGG - Exonic
1061388180 9:130302760-130302782 GGGATGCACCAGCAGCCAGGAGG - Intronic
1062407133 9:136402232-136402254 GGAGGACAGCAGCAGCCACGCGG + Exonic
1062475482 9:136724763-136724785 GCAGTTCAAAAACAGCCACGCGG + Intergenic
1190038355 X:47048112-47048134 GGAGAGTAACATCAGCCACGTGG - Intronic
1192852671 X:74974156-74974178 GGAGGGGAACAACAGCCACCAGG + Intergenic
1194977171 X:100407778-100407800 CGAGGGCACCAACGGCCAGGTGG - Exonic