ID: 906274518

View in Genome Browser
Species Human (GRCh38)
Location 1:44506245-44506267
Sequence GAGGGTGGCAGGGTTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 995
Summary {0: 1, 1: 0, 2: 9, 3: 99, 4: 886}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906274503_906274518 25 Left 906274503 1:44506197-44506219 CCCAGCATCACAGTGGTCAGAGA 0: 1
1: 0
2: 2
3: 22
4: 194
Right 906274518 1:44506245-44506267 GAGGGTGGCAGGGTTGCTGGTGG 0: 1
1: 0
2: 9
3: 99
4: 886
906274504_906274518 24 Left 906274504 1:44506198-44506220 CCAGCATCACAGTGGTCAGAGAG 0: 1
1: 0
2: 1
3: 10
4: 181
Right 906274518 1:44506245-44506267 GAGGGTGGCAGGGTTGCTGGTGG 0: 1
1: 0
2: 9
3: 99
4: 886

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906274518 Original CRISPR GAGGGTGGCAGGGTTGCTGG TGG Intronic
900156273 1:1204506-1204528 GAGGGAGGGAGGGAGGCTGGTGG + Intronic
900322845 1:2093616-2093638 GAGGGTGTCCGGGTGGCTGTTGG + Intronic
900562664 1:3315165-3315187 GAGGGTGGGAGGGAAGCAGGGGG - Intronic
900643154 1:3696883-3696905 GAGGGTGGCAGGGGGGCCGGAGG - Intronic
900660113 1:3777955-3777977 GGGGCTGGCAGGGCTGCTGGTGG - Intergenic
900977036 1:6024316-6024338 CAGGGTGGGAGGATTGCTTGAGG - Intronic
901751370 1:11412176-11412198 GAGGGTGGAAAGGATGGTGGGGG - Intergenic
901766092 1:11501111-11501133 CAGGGGGACAGTGTTGCTGGCGG + Exonic
901769863 1:11524701-11524723 TGGGGTGGCAGGGATGGTGGGGG - Intronic
901769878 1:11524742-11524764 TGGGGTGGCAGGGATGGTGGGGG - Intronic
901769893 1:11524783-11524805 TGGGGTGGCAGGGATGATGGGGG - Intronic
901769907 1:11524824-11524846 TGGGGTGGCAGGGATGATGGGGG - Intronic
901769934 1:11524903-11524925 TGGGGTGGCAGGGATGGTGGGGG - Intronic
901769951 1:11524956-11524978 TGGGGTGGCAGGGATGGTGGGGG - Intronic
902436794 1:16403285-16403307 GAGGGAGGGATGGTAGCTGGCGG - Intronic
902681308 1:18045824-18045846 GCGGGTGGCTGGGCTCCTGGAGG - Intergenic
902779945 1:18698663-18698685 TGGAGTGGCAGGGATGCTGGAGG - Intronic
902889287 1:19430168-19430190 GAGGGTGTCAGGGTAGTTTGGGG - Intronic
903118690 1:21199049-21199071 GATGAGGGCTGGGTTGCTGGAGG - Intergenic
903153667 1:21430132-21430154 GAGGGGAGCAGGCTTCCTGGGGG - Intergenic
903279965 1:22244816-22244838 GAAGGTGGGTGGGGTGCTGGGGG + Intergenic
903291816 1:22318772-22318794 GAGGGAGGGAGGGTTGCCTGAGG - Intergenic
903551431 1:24159652-24159674 GAGAGTGGCAGAGCTGCTGTGGG + Intronic
903811572 1:26037679-26037701 GAGGGGTGGGGGGTTGCTGGTGG - Intronic
904408788 1:30312338-30312360 GATGGGGGCAGGGCTGCTGGGGG + Intergenic
904454404 1:30638736-30638758 GAGGGAGGCAGTGTGGCTGCTGG - Intergenic
904614258 1:31741577-31741599 GAGAATGGCAGGGGTGGTGGTGG + Intronic
904691283 1:32294897-32294919 CAAGGTGGCAGGATTGCTTGAGG - Intronic
904790095 1:33013324-33013346 GAGTGTGGTAGGCTTGCAGGCGG + Exonic
904818177 1:33221000-33221022 GAGGGTGGCAGGGCTCCTTGGGG + Intergenic
905264161 1:36739681-36739703 GAGGCTGGCAGGGTGTCCGGGGG - Intergenic
905396707 1:37670918-37670940 GGGGGTGGGAGGGTTGCTTGAGG + Intergenic
905891603 1:41521750-41521772 GAGGCAGGCAGGGTTGTTGGTGG - Intronic
906211155 1:44012948-44012970 GAGGGTGTGAGGCCTGCTGGGGG + Intronic
906274518 1:44506245-44506267 GAGGGTGGCAGGGTTGCTGGTGG + Intronic
906525115 1:46489342-46489364 GGGGGTGGCAGTGTTGTTGCAGG + Intergenic
907697080 1:56742050-56742072 GGGGGTGGCAGTGGGGCTGGGGG + Intronic
907987466 1:59546413-59546435 GAGGGTGGGAGGGTTGGGGTGGG + Intronic
909180569 1:72419261-72419283 GAGGGTTGTAGGGTGGGTGGCGG + Intergenic
909206085 1:72759512-72759534 GAGGGTGGCAGGGAGGCTCAGGG - Intergenic
909480073 1:76121304-76121326 GAGGGTGGCAGGTAAGGTGGTGG - Intronic
909847803 1:80417791-80417813 GAAGGTGGGAGGGTTGCTTGAGG + Intergenic
911308762 1:96266478-96266500 GAGGATGGGAGGGTGGCAGGTGG + Intergenic
911354600 1:96800497-96800519 CAAGGTGGGAGGATTGCTGGAGG + Intronic
912795143 1:112688867-112688889 GAGGGAGGCAGGGCGGCGGGTGG - Intronic
912893002 1:113555664-113555686 GATGGTGGGAGGATTGCTTGAGG + Intronic
913057455 1:115175562-115175584 GGGGGGGGCAGGGTTGTTGGTGG + Intergenic
913179084 1:116302085-116302107 GAGGTTGGCTGGGTTGGGGGTGG + Intergenic
913186300 1:116373357-116373379 GAGGGTGGGAGGGCGGCCGGCGG - Intronic
913267548 1:117060017-117060039 GAAGGTGGCGGGGCTTCTGGAGG - Intergenic
913433764 1:118825927-118825949 GAGGGTTGCAGCTTTGCTGTGGG + Intergenic
914752951 1:150548473-150548495 GAGGGATGCAGGGTTGGGGGAGG - Intergenic
915237941 1:154499522-154499544 GAGGGTGGCAGGGGTGGATGTGG + Intronic
915288416 1:154867424-154867446 GAGAGCAGCCGGGTTGCTGGAGG + Intronic
915296381 1:154924651-154924673 TAGGGTGTCATGGTGGCTGGAGG - Intergenic
915417631 1:155754329-155754351 GAGGGTATCAGAGCTGCTGGGGG - Intronic
915487931 1:156234992-156235014 AAGGGAGGGAGGGTTGCAGGAGG - Intronic
915580089 1:156808369-156808391 GAGGGGCTCAGGGATGCTGGGGG + Intronic
915704937 1:157834697-157834719 GAGGGTGTCAGGCTGGCTGACGG - Exonic
916061951 1:161105346-161105368 CAGGGTGGGAGGATTGCTTGAGG - Intronic
916108375 1:161446903-161446925 GAGGGTGGCGGTGGTGGTGGTGG + Intergenic
916109962 1:161454283-161454305 GAGGGTGGCGGTGGTGGTGGTGG + Intergenic
916111548 1:161461694-161461716 GAGGGTGGCGGTGGTGGTGGTGG + Intergenic
916113134 1:161469074-161469096 GAGGGTGGCGGTGGTGGTGGTGG + Intergenic
916120662 1:161525488-161525510 CAGGGTGGCCTGGGTGCTGGAGG - Exonic
916130428 1:161607120-161607142 CAGGGTGGCCTGGGTGCTGGAGG - Intronic
916534495 1:165690788-165690810 GAAGGTGGCAGTGAAGCTGGGGG + Intronic
916854316 1:168734564-168734586 AAGGGTGGCAAGTTTGCTGAAGG - Intergenic
917134351 1:171774946-171774968 GGGGCTGGCAGGGTTGGGGGTGG - Intergenic
917972145 1:180215430-180215452 GAGGGTGGGAGGATTGGTTGAGG + Intergenic
918655955 1:187027090-187027112 GAGGGTGGATGGGATGGTGGAGG - Intergenic
918855653 1:189753169-189753191 GACACTGGCAGGGTTCCTGGAGG + Intergenic
918981745 1:191570376-191570398 GAGGGTGGGAGGGTGGGAGGAGG + Intergenic
919480264 1:198079540-198079562 AAGGTTGGCAGGGGTGCTGCTGG - Intergenic
919785997 1:201259177-201259199 GAGGGAGGCAGGGCTGCAGTGGG + Intergenic
919850758 1:201670681-201670703 GATGGTGGTAGAGATGCTGGTGG + Intronic
919989832 1:202702140-202702162 GAGGGTGGCAGGGGTGCCCTGGG - Intronic
920666200 1:207964273-207964295 GAGGGTGGCGGGGTTGCTCGGGG + Intergenic
921023841 1:211259748-211259770 GAGGGGGGCAGGCGGGCTGGCGG - Intronic
921154860 1:212431752-212431774 GAGGATGCCCGGCTTGCTGGAGG - Intergenic
921952104 1:220940868-220940890 GATGGTGGCAGGTGTGGTGGTGG + Intergenic
922757398 1:228104089-228104111 GAGGGTGTCTGGGTAGCTGCTGG - Intronic
922873793 1:228924092-228924114 CAAGGTGGGAGGATTGCTGGAGG - Intergenic
923003239 1:230024834-230024856 GAGGCTGGCAGGGAATCTGGTGG - Intergenic
923094049 1:230760799-230760821 CAGGGTGGCAGTGTTGGGGGTGG + Intronic
923280583 1:232439308-232439330 GATGGTGGCAGGCATGCAGGGGG + Exonic
923286093 1:232497342-232497364 GAGGGAGGCAGAGTCGATGGGGG + Intronic
923711719 1:236393015-236393037 CAAGGTGGCAGGATTGCTTGAGG - Intronic
923724623 1:236495514-236495536 GAGGGAGGCGGGGTGGGTGGAGG - Intergenic
923741406 1:236658236-236658258 CAGGGTGGGAGGATTGCTTGAGG + Intergenic
923805037 1:237248268-237248290 GGGGGGGGCGGGGTTGCGGGGGG - Intronic
923936865 1:238771173-238771195 CATGGTGGCAGGATTGCTTGAGG - Intergenic
1062811567 10:470387-470409 GAGAGTGGCAGGATGGGTGGAGG - Intronic
1062995032 10:1857723-1857745 CAAGGTGGCAGGATTGCTTGAGG + Intergenic
1063218911 10:3948367-3948389 GAGGGTGGAAGGGAGGCTGAGGG + Intergenic
1063287847 10:4709652-4709674 GAGGGTCCCAGGGATGGTGGGGG - Intergenic
1063516688 10:6703270-6703292 GAAGGTGGGAGGCTTGCTTGAGG - Intergenic
1063665879 10:8060315-8060337 GAGGGAGGCAGGCTAGCTGGTGG + Intronic
1064308581 10:14190616-14190638 CAAGGTGGAAGGATTGCTGGAGG - Intronic
1065534584 10:26704867-26704889 GAGGGTGGGAGGATAGCTTGAGG - Intronic
1065830280 10:29608683-29608705 GAGTGTGGGAGGGAGGCTGGGGG + Intronic
1065856981 10:29838909-29838931 GAGGAGGGGAGGGGTGCTGGAGG + Intergenic
1065997159 10:31069814-31069836 GATGGGGGCAGGGTTGTTGCAGG - Intergenic
1066004039 10:31131039-31131061 CAAGGTGGGAGGGTTGCTTGAGG + Intergenic
1067090719 10:43264747-43264769 GAGGGGCGCTGGGCTGCTGGGGG - Intronic
1067170856 10:43904649-43904671 GATGGTGGTGGGGCTGCTGGGGG - Intergenic
1067908605 10:50320746-50320768 GAGGGAGGAAGGGTTCCAGGTGG - Intronic
1067947632 10:50700208-50700230 GAGGAGGGCATGGTTGCTAGGGG + Intergenic
1068287599 10:54961261-54961283 GAGGGTGCCATGGTGGCAGGGGG - Intronic
1068690024 10:59905802-59905824 GAGGCTGGCGGCGTGGCTGGGGG - Intronic
1069658251 10:70106193-70106215 GAGGGTGGCAGTGCTGCTGCTGG - Intronic
1069674015 10:70234118-70234140 TAGGGTGGCAGGGGGGATGGAGG - Intergenic
1069853158 10:71423597-71423619 GAGGGAGGCAGAGAAGCTGGTGG + Intronic
1069916751 10:71791282-71791304 GAGGGTGGCAGGGCTAAAGGTGG - Intronic
1070197858 10:74175691-74175713 CAAGGTGGGAGGGTTGCTTGAGG + Intronic
1070631147 10:78085689-78085711 GTATGTGGCAGGGTAGCTGGAGG + Intergenic
1070631153 10:78085709-78085731 AGGTGTGGCAGGGTGGCTGGAGG + Intergenic
1070756830 10:78998511-78998533 GAAAGTGGCAGGTTTGGTGGGGG + Intergenic
1070775234 10:79105946-79105968 GAGTGGGGAGGGGTTGCTGGAGG + Intronic
1070806992 10:79276504-79276526 GAGGGTGGCCAGGGTGGTGGGGG - Intronic
1070882949 10:79865195-79865217 GAGGAGGGCATGGTTGCTAGGGG + Intergenic
1071204615 10:83259777-83259799 GAGGGAGGCAGGGGTGCTACTGG - Intergenic
1072519612 10:96219427-96219449 GAGGGTGGCATGCCTCCTGGGGG - Intronic
1072760200 10:98050462-98050484 GAGGGAGCCAGGGTTCCTGAGGG + Intergenic
1072924699 10:99606759-99606781 TAGGGTGGCAGAGGTGGTGGTGG + Intergenic
1072967433 10:99986275-99986297 CAAGGTGGGAGGGTTGCTTGAGG + Intronic
1073076460 10:100827952-100827974 GAGTCCGGCAGGGTGGCTGGCGG - Exonic
1073205867 10:101769043-101769065 GAGGGAGGGAGGGCTGCTGTGGG - Intergenic
1073214378 10:101828558-101828580 GAGGGAGGGAGGGATTCTGGAGG - Intronic
1073609681 10:104930698-104930720 GGGGCTGGCTGGGTTGCTGAGGG + Intronic
1074077569 10:110142822-110142844 GAGGGTGGCGGGGTTGGGGGCGG - Intergenic
1074649658 10:115506171-115506193 CAGGGTGTCAGGGGTGGTGGTGG + Intronic
1075022083 10:118959510-118959532 GGATGTGGCCGGGTTGCTGGGGG - Intergenic
1075629355 10:123991807-123991829 GACGGTGGCAGGGGTGGTAGCGG + Intergenic
1075718997 10:124574267-124574289 GAGGGGCACAGGTTTGCTGGGGG + Intronic
1076739474 10:132476267-132476289 GAAGGTGGCAGGGTGGCCAGGGG - Intergenic
1076753373 10:132554915-132554937 GTGGGTGGCATGGTTGGTGTGGG + Intronic
1076753411 10:132555092-132555114 GTGGGTGGCATGGCTGCTGTGGG + Intronic
1076788165 10:132761549-132761571 GAGGATGGCATGGCTGGTGGGGG + Intronic
1076810457 10:132883906-132883928 GATGGATGCAGGATTGCTGGGGG + Intronic
1076811399 10:132888399-132888421 GAAGGCGGCAGGGGTGCAGGCGG - Intronic
1076811409 10:132888429-132888451 GAAGGTGGCAGGGGTACAGGCGG - Intronic
1076811458 10:132888588-132888610 GAAGGTGGCAGGGGTGCAGGCGG - Intronic
1076811502 10:132888732-132888754 GAAGGTGGCAGGGGTGAAGGTGG - Intronic
1076919573 10:133444706-133444728 GAGGGTCACAGGGTTGATTGAGG + Intergenic
1077011138 11:379882-379904 GTGGGTGGCACAGTTCCTGGCGG + Exonic
1077096299 11:800527-800549 GATGCTGGTAGGGATGCTGGTGG - Exonic
1077199101 11:1296653-1296675 GATGGAGGCCTGGTTGCTGGTGG + Intronic
1077305022 11:1865076-1865098 CAGGGGGGCAGGGGTGCGGGAGG + Intronic
1077327726 11:1970945-1970967 GAGGGTGGCAGGGGTGGGGCAGG + Intronic
1077352156 11:2098006-2098028 AAGGGAGGCAGAGATGCTGGAGG - Intergenic
1077417317 11:2430649-2430671 GATGGTGACAGTGTTGATGGTGG + Intergenic
1077420469 11:2447591-2447613 CAGGATGGCAGAGTAGCTGGAGG + Intronic
1077778511 11:5298202-5298224 CAGGGTGGGAGGATTGCTTGAGG + Intronic
1078086176 11:8234172-8234194 GGTGGAGGCAGGGCTGCTGGTGG + Intronic
1078748399 11:14137254-14137276 GAGGCTGGCAGTGGTGGTGGTGG - Intronic
1079290831 11:19186300-19186322 GAATTTGGAAGGGTTGCTGGTGG + Exonic
1080551945 11:33380033-33380055 GGGGTTGGCAGTGTTGATGGTGG + Intergenic
1081558251 11:44187428-44187450 CAGGGTGGGAGGATTGCTCGAGG - Intronic
1081748526 11:45489881-45489903 GCAGGTGGCAGGGATGGTGGAGG + Intergenic
1081935242 11:46899542-46899564 GAGGGTGAGAGGGTTGCCTGTGG - Intronic
1083151952 11:60797559-60797581 GAGGGAGACAGGGTTATTGGAGG - Intronic
1083328475 11:61885732-61885754 GAGTGTGGCAGGGCTGCTGAGGG + Intronic
1083663954 11:64264850-64264872 GAGGCTGACAGGGGTGCTAGGGG + Intronic
1083888028 11:65582158-65582180 GAGGGGGCCAGGGCTGCTGCAGG + Exonic
1084218904 11:67666047-67666069 GAGGGTGGGAGGGTTGTGGAGGG - Intronic
1084375742 11:68776164-68776186 CAAGGTGGGAGGATTGCTGGAGG + Intronic
1084479464 11:69410383-69410405 GGGGGTGGGAGGGCTGATGGCGG - Intergenic
1084577199 11:69997024-69997046 GAGGGTGCCTGAGTTGCAGGAGG - Intergenic
1084603311 11:70159194-70159216 GAGAGTGGAAGTGATGCTGGAGG - Intronic
1084965081 11:72740257-72740279 GATGCTGGTAGGGTTGCTGCAGG - Intronic
1085038992 11:73315921-73315943 GAGGGTGGGAGGGAAGCAGGAGG - Intronic
1085200542 11:74699225-74699247 GAAGGTGGCAGGGATGAGGGCGG + Intronic
1085314392 11:75535585-75535607 TTGGGGGGCAGGGGTGCTGGGGG - Intergenic
1085329850 11:75639143-75639165 AAGGGTGGCAGGGTGGGAGGCGG + Intronic
1087352152 11:97045853-97045875 CAAGGTGGCAGCGTGGCTGGGGG - Intergenic
1087872688 11:103317245-103317267 CAGGGTTGCAGGGTTGGGGGTGG - Intronic
1087955566 11:104282793-104282815 GAGGATGGCAGGGGTAATGGAGG - Intergenic
1090056568 11:123429799-123429821 GAGGAAAGCAAGGTTGCTGGAGG - Intergenic
1090229665 11:125092521-125092543 GGGGGTGGGAGAGTTGCTGTTGG + Intergenic
1090252659 11:125262591-125262613 AAGGGTGGGAGGGCTGCTTGGGG - Intronic
1090331048 11:125932493-125932515 CAGGGAGGCAGGGGAGCTGGGGG + Intergenic
1090918436 11:131187178-131187200 GGAGGTGGGAGGGATGCTGGCGG + Intergenic
1091003898 11:131934638-131934660 GAGGCTGCCTGGGTGGCTGGTGG + Intronic
1202810708 11_KI270721v1_random:26125-26147 GAGGGTGGCAGGGGTGGGGCAGG + Intergenic
1091484433 12:870745-870767 GGGGGTGGCAGGATTGCTCCTGG + Intronic
1091487146 12:900513-900535 GAGGGTGGAGGGTCTGCTGGGGG - Exonic
1092741329 12:11632989-11633011 GGAGGTGGGAGGGTTGCTTGAGG - Intergenic
1092763006 12:11826499-11826521 GTAGGTGGCAGGGGTCCTGGAGG - Intronic
1094244258 12:28269544-28269566 ATGGGTGGCAGGGTTGGTTGGGG - Intronic
1094688783 12:32748238-32748260 GAGGGCGGGAGGATTGCTTGGGG - Intronic
1094779384 12:33773281-33773303 GAAGGTGGCAGTGAGGCTGGGGG + Intergenic
1096651449 12:53063904-53063926 GAGGGGGGCAGTGTTGATGTGGG - Exonic
1096719656 12:53511725-53511747 GCGGGTGGGAGAGTTGCTGATGG - Intronic
1096863983 12:54550275-54550297 CAGTGTGGCAGGGCTGCAGGAGG + Intronic
1097220171 12:57444912-57444934 CAAGGTGGCAGGATTGCTTGAGG - Intronic
1097500788 12:60398726-60398748 CAAGGTGGCAGGATTGCTTGAGG + Intergenic
1097917796 12:65038987-65039009 GTGGGTGGCAGGGTATCTGTCGG + Intergenic
1098013002 12:66074033-66074055 CAAGGTGGCAGGATTGCTTGAGG + Intergenic
1100738295 12:97562459-97562481 GGGGTTGGGAGGGTAGCTGGTGG + Intergenic
1100796743 12:98189907-98189929 GAGGATTGCAGCTTTGCTGGAGG - Intergenic
1100811134 12:98339489-98339511 GAGGTGTGCAGGGTTGGTGGAGG - Intergenic
1101407513 12:104441717-104441739 CAGGGTGGCAGCATTGGTGGAGG - Intergenic
1102198192 12:111039332-111039354 GAGGGTGTCAGGGATGGTAGAGG + Intronic
1102295132 12:111730452-111730474 GAGAGTGACAGGGTCTCTGGGGG + Intronic
1102554473 12:113717879-113717901 GCAGGTGGTAAGGTTGCTGGTGG + Intergenic
1102959877 12:117085504-117085526 GTGGGAGGCAGGGTGGCTTGGGG - Intronic
1103001526 12:117388795-117388817 GACTGCGGCAGGGTTGTTGGGGG + Intronic
1103351585 12:120287413-120287435 GTGGGTGGGAGGGTGGGTGGGGG + Intergenic
1103428838 12:120863908-120863930 CAAGGTGGGAGGATTGCTGGAGG - Intronic
1103602207 12:122061555-122061577 GAGGGGTGCAGGGTGGGTGGGGG - Exonic
1103627443 12:122230836-122230858 GTGGGGGGCAGGGGTGTTGGAGG - Exonic
1103685224 12:122727038-122727060 CAAGGTGGGAGGATTGCTGGAGG + Exonic
1104133927 12:125919625-125919647 CCAGGTGGCAGGGCTGCTGGGGG + Intergenic
1104597993 12:130132968-130132990 GAGGGAGGCAGGAGGGCTGGAGG + Intergenic
1104853778 12:131892395-131892417 GAGGGTGGGAGGGTGGGAGGAGG + Intergenic
1104984094 12:132587002-132587024 GAGGGCGGCAGTGCGGCTGGAGG + Intergenic
1104984117 12:132587089-132587111 GAGGGCGGCAGTGCAGCTGGAGG + Intergenic
1104984123 12:132587112-132587134 GAGGGCGGCAGTGCAGCTGGAGG + Intergenic
1104984150 12:132587223-132587245 GAGGGTGGCAGTGCGGCTGGAGG + Intergenic
1104984157 12:132587246-132587268 GAGGGCGGCAGTGCGGCTGGAGG + Intergenic
1104984185 12:132587379-132587401 GAGGGTGGCAGTGCAGCTGGAGG + Intergenic
1105070026 12:133228626-133228648 AGGGCTGGCAGGTTTGCTGGGGG - Intronic
1105532060 13:21229290-21229312 GGGGGTGGGAGGGTTGTGGGGGG - Intergenic
1105859346 13:24395305-24395327 GAGGAGGGCAGTGTTGCTGGGGG - Intergenic
1105886734 13:24649099-24649121 GGGGGTGGCAGGGCTGCTGGAGG - Intergenic
1106213058 13:27668739-27668761 GAGGTTGGCAGGGGGGCAGGGGG + Intergenic
1110014787 13:70386865-70386887 GAGGGGGGCAAGGTGGCAGGGGG + Intergenic
1112261849 13:97884499-97884521 GAAGATGGCAGGGTTGGGGGAGG - Intergenic
1112326659 13:98446317-98446339 GGGGATGACAGGGATGCTGGCGG + Intronic
1112338896 13:98536875-98536897 GAGTGTGGCTGGGCGGCTGGAGG - Intronic
1113189044 13:107722577-107722599 GAGCGTGGTAGTGTTGCTAGGGG - Intronic
1114197805 14:20494559-20494581 GTGGGTGGGAGGGTTTCTTGTGG - Intergenic
1114561003 14:23590418-23590440 GAAGGTGGAAGGATTGCTCGAGG + Intergenic
1114840371 14:26256155-26256177 GTGGGTGGCAGAGTTGCATGAGG - Intergenic
1116085173 14:40228015-40228037 GAGAGTGGCAGGGTGGGAGGTGG - Intergenic
1117152454 14:52903303-52903325 GAAGGTGGGAGGGCTGCTTGAGG + Intronic
1117776502 14:59189285-59189307 GAGGGTGCCAGGGGCACTGGGGG - Intronic
1118008952 14:61590493-61590515 GAGGCTGGTGGGGTTCCTGGTGG - Intronic
1118444833 14:65841371-65841393 GAGGGTAGCAGGGCTAATGGTGG + Intergenic
1119407373 14:74407179-74407201 GAGGTTGGCAGGGTAGGTGGTGG + Exonic
1119526319 14:75325208-75325230 GAAGGTGGCTGGGATGCAGGAGG + Intergenic
1119646817 14:76354231-76354253 GAGGGTGGAAGTGTGGGTGGGGG - Intronic
1119732063 14:76957231-76957253 GAGGGTGGGATGGGAGCTGGGGG - Intergenic
1121120375 14:91372361-91372383 TAGGGTGCCAGACTTGCTGGTGG - Intronic
1121240249 14:92424627-92424649 CAAGGTGGGAGGGTTGCTTGAGG + Intronic
1121530796 14:94651725-94651747 GGGGGTGGGGGGGTTGTTGGGGG + Intergenic
1122056471 14:99101672-99101694 GGGGGTGGACGGGTTGCGGGGGG - Intergenic
1122418943 14:101563569-101563591 TAGGCTGGCAGGGGCGCTGGAGG + Intergenic
1122604158 14:102937492-102937514 GAGGGAGGGAGGGATGCAGGCGG - Intronic
1122769563 14:104091969-104091991 GAAGGTGGCAGAGTTGCTGGGGG + Intronic
1122791098 14:104184517-104184539 GTTGGTGGCAGGGAGGCTGGTGG + Intergenic
1122847163 14:104506324-104506346 GAGGAGGGCGGCGTTGCTGGGGG - Intronic
1122855916 14:104560002-104560024 CTGGGTGGCACTGTTGCTGGGGG - Intronic
1122867659 14:104614738-104614760 GAGGGTGGCAGGGAGGAAGGAGG + Intergenic
1122970374 14:105149920-105149942 GGGGGAGGCAGGGTTGGGGGAGG + Intronic
1122970400 14:105149972-105149994 GGGGGAGGCAGGGTTGGGGGAGG + Intronic
1122970422 14:105150023-105150045 GGGGGAGGCAGGGTTGGGGGAGG + Intronic
1122993220 14:105248657-105248679 GGGGGTGGCAGGGGAGCGGGTGG + Exonic
1123058831 14:105585341-105585363 GAGGATGGAAGGGTGGATGGAGG - Intergenic
1123083158 14:105705567-105705589 GAGGATGGAAGGGTGGATGGAGG - Intergenic
1123734903 15:23175853-23175875 CAGGGTGGTGGGGTTGCAGGAGG - Intergenic
1124051278 15:26199332-26199354 GGGGGAGGCAGGGTGGCAGGGGG - Intergenic
1124239294 15:28016924-28016946 GGGTGTGGAAGGTTTGCTGGGGG - Intronic
1124240249 15:28022292-28022314 GACAGTGGCGGGGTTGGTGGTGG - Intronic
1124244614 15:28058498-28058520 CAGGGTGGCAGGGTGGGTGGTGG - Intronic
1124285408 15:28397157-28397179 CAGGGTGGTGGGGTTGCAGGAGG - Intergenic
1124297289 15:28514485-28514507 CAGGGTGGTGGGGTTGCAGGAGG + Intergenic
1126621872 15:50648010-50648032 GAGGGTGGAAGGATGGCTTGAGG - Intronic
1126750953 15:51876390-51876412 GTGGGTGGAAGGATTGCTTGAGG - Intronic
1128082464 15:64864771-64864793 GAGGGAGGCTGGGGAGCTGGGGG + Intronic
1128228657 15:66019866-66019888 GAAGCTGGTAGGCTTGCTGGAGG - Intronic
1128367077 15:67012113-67012135 GAGGGTGGTAGAGAGGCTGGTGG - Intergenic
1128510732 15:68312652-68312674 GTGGGTGGCAGGGTTGAGGCTGG + Intronic
1128627257 15:69222321-69222343 GTGGGAGGCAGGGGTGGTGGAGG + Intronic
1128697604 15:69780362-69780384 GGGGGGTGAAGGGTTGCTGGTGG - Intergenic
1128806663 15:70536202-70536224 GAGGGTGGCCTGGGTGCAGGAGG - Intergenic
1128967772 15:72077629-72077651 GGTGGTGGCAGGGTGGCGGGGGG + Intronic
1129154743 15:73710782-73710804 GAGGCTGGCAGATTTGCAGGTGG - Intronic
1129189099 15:73927284-73927306 GCGGGTAGGAGGGCTGCTGGCGG - Exonic
1129606097 15:77025701-77025723 GAGGGCGGCAGGGGTGGTGGTGG + Intronic
1129607968 15:77034069-77034091 GAGGGAGGCCTGGCTGCTGGAGG + Intronic
1129734649 15:77952754-77952776 GGGGGTGGCAGTGCTGCTGTAGG - Intergenic
1129825321 15:78631053-78631075 GTGAGTGGCAGGGTTGGTGGAGG - Intronic
1129840941 15:78743237-78743259 GGGGGTGGCAGTGCTGCTGTAGG + Intergenic
1129847990 15:78776888-78776910 GAGGGGGGCAGGGTGGGTGGCGG - Intronic
1129867623 15:78921647-78921669 GAGGATGGTGGGGGTGCTGGCGG - Exonic
1129923356 15:79339611-79339633 GAGGGTGGCAGTGATGGTGGCGG + Intronic
1129962319 15:79698482-79698504 GAAGGTGTTAGGGTTTCTGGTGG - Intergenic
1130253925 15:82317047-82317069 GAGGGGGGCAGGGTGGGTGGCGG + Intergenic
1130282549 15:82531238-82531260 GAGGGTGGGAGGGATGGCGGGGG + Intergenic
1130385751 15:83410212-83410234 CAAGGTGGGAGGATTGCTGGAGG - Intergenic
1130744610 15:86637679-86637701 GAGGGTGGCAGGGGTGGTGGTGG + Intronic
1131336405 15:91553483-91553505 GGGGGAGGCAGCGGTGCTGGTGG + Intergenic
1131492805 15:92877496-92877518 GAGGATGTCAGGCTTGCTGAGGG - Intergenic
1132096276 15:98987469-98987491 GAGGTGGGCAGGGGTGGTGGTGG + Intronic
1132501504 16:286483-286505 GAGGGAGGCAGGGGTGGTGTGGG + Intronic
1132553419 16:562700-562722 GCAGGGGCCAGGGTTGCTGGAGG + Intronic
1133072175 16:3254038-3254060 CAGGGCGGGAGGATTGCTGGAGG - Intronic
1133128784 16:3663628-3663650 GAGGGCGGCAGGAGGGCTGGGGG + Exonic
1133401786 16:5493302-5493324 CAAGGTGGGAGGGTTGCTTGAGG - Intergenic
1133907743 16:10037414-10037436 GAGGGTGGCAGGGCTGCACACGG - Intronic
1134364199 16:13561634-13561656 GAGGGTGGAAGGGCCCCTGGAGG + Intergenic
1136005702 16:27327311-27327333 GCGGGTGGCAGGGGGGCAGGGGG - Intronic
1136047359 16:27625003-27625025 GAGGGTGGCAGGGCAGCAGGAGG + Intronic
1136116580 16:28098403-28098425 GAGGCAGGCAGCGTTGCTTGCGG + Exonic
1136384151 16:29912183-29912205 GAGAGTGGCAGAGAGGCTGGCGG - Intronic
1136414440 16:30095174-30095196 GAGGGGGTCAGGGCTGCCGGTGG + Intronic
1136669929 16:31846956-31846978 TAAGGTGGGAGGCTTGCTGGAGG + Intergenic
1136776473 16:32874382-32874404 GATGCTGGCAGGGTAGCTGATGG + Intergenic
1136894142 16:33987130-33987152 GATGCTGGCAGGGTAGCTGATGG - Intergenic
1136931097 16:34418541-34418563 GAAGGTGGGAGGGTTGCTTGAGG - Intergenic
1136973476 16:34993267-34993289 GAAGGTGGGAGGGTTGCTTGAGG + Intergenic
1137314064 16:47298671-47298693 CAGGGTGGCATGGGTGATGGTGG + Intronic
1137330258 16:47487586-47487608 GAGGGTGGAAGGGTAGGAGGAGG - Intronic
1137343312 16:47631619-47631641 GAGGGTGGGAGGCTAGCGGGGGG - Intronic
1137485727 16:48889169-48889191 GAGAGGGGCAGGGTTGAGGGAGG - Intergenic
1137607111 16:49794299-49794321 CAAGGTGGGAGGGTTGCTTGAGG - Intronic
1137623789 16:49894722-49894744 GAGGGTGCCAGGGCTGGGGGAGG + Intergenic
1137738680 16:50743080-50743102 GAAGGTGGCAGGGATGATGGGGG - Intronic
1138141348 16:54571335-54571357 CAAGGTGGGAGGATTGCTGGAGG - Intergenic
1138521842 16:57575610-57575632 GAGGGTGGCAGGCCTGCTGCTGG + Exonic
1139349772 16:66327759-66327781 GTGGGTGGCAGGGGTGAGGGTGG - Intergenic
1139622947 16:68162087-68162109 GTGTGTGGTAGGGTTGCAGGAGG - Intronic
1139653597 16:68374729-68374751 GAGGGCTGCAGGTTTGCTGGGGG - Intronic
1140252273 16:73304605-73304627 GAAGGGGGCAGGGATGCTGTGGG - Intergenic
1140474484 16:75232686-75232708 AACGGTGGCAGGGTGGCAGGGGG - Intronic
1140511743 16:75513535-75513557 GAGGGGGCCAGGGTGCCTGGAGG - Intergenic
1141345353 16:83239863-83239885 GTGGGGGGCAGGGGAGCTGGAGG + Intronic
1141608510 16:85169049-85169071 GAGGGAGGCAGGCTTGGAGGAGG + Intergenic
1141626553 16:85264471-85264493 GAGGGAGGCGGTGATGCTGGGGG - Intergenic
1141659045 16:85431774-85431796 GAGGGTGCGTGGGTGGCTGGGGG - Intergenic
1141786116 16:86201891-86201913 GAGGCTGGGTGGGTGGCTGGGGG + Intergenic
1142123959 16:88401020-88401042 GAGGGAGCCAGGCTTGGTGGGGG - Intergenic
1142124534 16:88403595-88403617 GAGGGTGGCAGAGCAGCTGCTGG + Intergenic
1142129852 16:88427606-88427628 AAGGGTGCCAGGGAGGCTGGCGG + Exonic
1142162515 16:88565852-88565874 GAGATGGGCAGGGGTGCTGGGGG - Intergenic
1142171362 16:88624393-88624415 GAGCCTGGAAGGGCTGCTGGGGG + Intronic
1203078888 16_KI270728v1_random:1136491-1136513 GATGCTGGCAGGGTAGCTGATGG + Intergenic
1142983209 17:3683217-3683239 GAGGTGGGAAGGGTTGGTGGAGG + Intronic
1143108415 17:4540813-4540835 GAAGGTGGCAGGGTTGGGTGGGG - Intronic
1143165710 17:4896345-4896367 GAGCTTGGCGGGGCTGCTGGGGG + Intronic
1143178919 17:4972425-4972447 GAGGCTGGCAGAGGTGCAGGGGG + Exonic
1143468149 17:7152154-7152176 TGAGGTGGAAGGGTTGCTGGAGG + Intergenic
1143498316 17:7324833-7324855 GAGGTAGGCAGGGTTGTGGGTGG + Exonic
1144344691 17:14339183-14339205 GGCGGGGCCAGGGTTGCTGGAGG + Intronic
1144545288 17:16189159-16189181 CAAGGTGGGAGGGTTGCTTGAGG + Intronic
1144685917 17:17226226-17226248 GGGGGTGGCTGGGGTGCTGGTGG + Exonic
1144839318 17:18175892-18175914 AAGGGAGCCAGGGTGGCTGGAGG - Intronic
1144848077 17:18230384-18230406 GAGGGTGGCAGGTGGGCTGGGGG + Intronic
1144898056 17:18557949-18557971 GAAGGGGGTAGGGCTGCTGGTGG - Intergenic
1144937598 17:18912800-18912822 CAAGGTGGGAGGGTTGCTTGAGG + Intronic
1146367240 17:32238720-32238742 GAGGGAGGGAGGATGGCTGGTGG - Intronic
1147458128 17:40551447-40551469 GCGTCTGGCAGGGTTGCAGGAGG - Intergenic
1147538323 17:41335144-41335166 GAGTGTGGCTGGCTTGCGGGGGG + Intergenic
1147579847 17:41622094-41622116 GAGGGAGGCAGGGTAGGTAGAGG + Intronic
1147586357 17:41655765-41655787 GTGGGTGGCAGGGAAGGTGGAGG + Intergenic
1148496909 17:48058512-48058534 GAGGCTGGTAGAATTGCTGGGGG - Exonic
1148557012 17:48584862-48584884 GAGGGAGCCTGGGATGCTGGAGG - Intronic
1148700350 17:49583070-49583092 GTGGGTGGCAGGGATCCTGGGGG + Intronic
1149471758 17:56922673-56922695 GAGGTTGGGAGGATTGCTTGGGG + Intergenic
1149517632 17:57292483-57292505 TGGGGTGGCAGGGTACCTGGAGG + Intronic
1149531037 17:57395500-57395522 GATGGTGGTAGAGTTGGTGGTGG + Intronic
1149965669 17:61161672-61161694 GAGGGTAGGGTGGTTGCTGGTGG + Intronic
1150559956 17:66286038-66286060 GTGAGTGGCAGGGTTGGGGGTGG - Intergenic
1150655266 17:67035009-67035031 GAGGGAGGCAGGAGTGTTGGAGG + Intergenic
1151210888 17:72543078-72543100 GAGGAAGGCAGGCTTGATGGTGG - Intergenic
1151366328 17:73618714-73618736 GAGGATGGCAGGGGTGATCGGGG - Intronic
1151555369 17:74843822-74843844 CAGGGTGGCAGGGTTGAAGAGGG - Intronic
1151578489 17:74964443-74964465 GAGGGTGGAAGAGTAGCAGGAGG + Intronic
1151582038 17:74985505-74985527 GAGGGAAGCAGGGTTGGTGGGGG - Intergenic
1151674842 17:75592081-75592103 GTGAGTGGCAGGGTTGCAGGGGG + Intergenic
1151679058 17:75614410-75614432 GAGTGTGGCAGGGTGGCTGTGGG - Intergenic
1151777711 17:76218545-76218567 TAAGGTGGGAGGATTGCTGGAGG + Intronic
1151951945 17:77359559-77359581 GAGGGTGGGAAGATTGCTTGGGG + Intronic
1152293087 17:79451912-79451934 CTGGGTGGCAGGGATGCTGTGGG - Intronic
1152393401 17:80016604-80016626 GAGGGTGGGTGGGTGGGTGGAGG + Intronic
1152581287 17:81166483-81166505 GAGGGGGGCACGGAGGCTGGCGG + Intergenic
1152628084 17:81397455-81397477 GGGGGTGCCAGGCTTCCTGGCGG - Intronic
1152799488 17:82324180-82324202 GGGGGTGGCAGGGAGGCGGGGGG + Intronic
1152836764 17:82538253-82538275 GGAGGTGGGAGGATTGCTGGAGG + Intronic
1153225772 18:2898443-2898465 GAGGAAGGAAGGGGTGCTGGTGG + Intronic
1153823051 18:8848865-8848887 AGGGGTGGCAGGATTCCTGGGGG - Intergenic
1157215355 18:45778484-45778506 GCGGGTGGGAGGATTGCTTGAGG - Intergenic
1157578236 18:48758221-48758243 CAGGGTGTCAGGGCTGCGGGGGG - Exonic
1157600212 18:48889063-48889085 GGGCATGGCAGGGATGCTGGGGG - Intergenic
1158408803 18:57186450-57186472 GGAGGAGGCAAGGTTGCTGGTGG + Intergenic
1158854130 18:61525558-61525580 TAGGGAGGCAGGCTGGCTGGTGG + Intronic
1159052852 18:63437639-63437661 CAAGGTGGAAGGATTGCTGGAGG - Intergenic
1159603857 18:70454493-70454515 GAGGCTGGCTGGGTTGGTGGTGG + Intergenic
1160210194 18:76871274-76871296 GGAGGAGGCAGAGTTGCTGGAGG + Intronic
1160228834 18:77031361-77031383 GAGGCTGGCAGGGCAGGTGGTGG - Intronic
1160330239 18:77984476-77984498 GAGTATGGCGGGGGTGCTGGAGG - Intergenic
1160472024 18:79144973-79144995 GAGATTGTCAGGGCTGCTGGCGG + Intronic
1160724230 19:610578-610600 GGGGGTGGCGGGGGTCCTGGGGG - Intronic
1160759851 19:778080-778102 CAAGGTGGGAGGGTTGCTTGAGG + Intergenic
1161011051 19:1959609-1959631 AAAGGTGGCACGGGTGCTGGGGG - Intronic
1161135914 19:2619745-2619767 GTGTGTGGCAGGGCTGCCGGGGG + Intronic
1161163785 19:2774712-2774734 CAGGGTGGGAGGATTGCTTGAGG - Intronic
1161211013 19:3065796-3065818 TGGGGTGGCAGGGGTGCTAGCGG - Intergenic
1161234971 19:3193221-3193243 GGGGGTGGCAAGGTAGCAGGGGG - Intronic
1161270534 19:3387133-3387155 GAGGGGTGCAGGGTGGATGGCGG + Intronic
1161389729 19:4014799-4014821 CAGGGAGGCAGCGTTGATGGGGG + Intronic
1161397494 19:4052394-4052416 GAGGCAGGCAGTGTAGCTGGTGG - Intronic
1161456120 19:4370492-4370514 CAGGGTGGCAGGGTGGGTGGGGG + Intronic
1161470881 19:4456322-4456344 GAGGACGTCAGGGTTCCTGGGGG - Intronic
1161505291 19:4640359-4640381 GAGGGGGGAAGGGCTGGTGGAGG + Intronic
1161590390 19:5126771-5126793 GAGGGTGGCAGTGTTGAAGGGGG + Intronic
1161939787 19:7395197-7395219 GAGAGTGGCAGAGGAGCTGGCGG + Intronic
1162032105 19:7921950-7921972 TAGGGTGGCAGGGAGGATGGGGG + Intronic
1162126072 19:8500079-8500101 GAGGGGGTCAAGGATGCTGGGGG - Intronic
1162326793 19:10004214-10004236 GAGGTGGGCAGGACTGCTGGGGG - Intronic
1162342893 19:10102541-10102563 GAGGGTGGGAAGGTAGGTGGAGG - Intronic
1162580003 19:11523442-11523464 GAGGGAGGCATTGCTGCTGGAGG + Intronic
1163415060 19:17181302-17181324 GAGGATGGCACGTTTGCGGGTGG - Intronic
1163488198 19:17601943-17601965 CAGGGTGGCAGAGTTCCGGGAGG + Exonic
1163596225 19:18222470-18222492 GAGGGGTGCAGGGTTCCTGAGGG - Intronic
1165317003 19:35062185-35062207 GATGGTGGCAGGGTGGGAGGTGG + Intronic
1165364940 19:35359553-35359575 GAGGGTGGCGGGGCTGTTGGCGG + Exonic
1165366759 19:35372022-35372044 GAGGGTGGCGGGGCTGGTGGCGG + Exonic
1165903081 19:39177848-39177870 GCGGGTGGCAGGGCTCCAGGTGG + Intronic
1166310541 19:41959912-41959934 GAGGGGGCCATGGTTGCTGGAGG + Intergenic
1166333163 19:42090339-42090361 GAGGGTGACAGGGTTGAGGAGGG + Exonic
1166347568 19:42176104-42176126 GAGGGGGTCAGGGCTGGTGGCGG - Intronic
1166369043 19:42291344-42291366 GAGGGTGAAACGGATGCTGGTGG - Exonic
1166385193 19:42376680-42376702 GGGGGTGGTGGGGGTGCTGGGGG + Exonic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166787831 19:45379861-45379883 GCAGGTGGCTGGCTTGCTGGGGG + Exonic
1166870159 19:45865826-45865848 GGTGGAGGCAGGGTGGCTGGAGG + Intronic
1166913379 19:46177162-46177184 TGGGGTGGCAGGATTGCTTGAGG + Intergenic
1167045801 19:47048155-47048177 GGGGGTGGTAGGGTTGCGCGAGG - Intronic
1167249120 19:48391388-48391410 GAGGGAGGCAGGCTGGCGGGGGG + Exonic
1167556181 19:50197400-50197422 GAGGGTGTCAGGGGTCCAGGGGG + Intronic
1167635797 19:50654725-50654747 TAGGGTGGGAGGATTGCTTGAGG - Intronic
1167659595 19:50788845-50788867 CAAGGTGGGAGGGTTGCTTGAGG - Intergenic
1167674876 19:50877807-50877829 GAGGGCGGCAGGGTTGTGGGGGG + Intronic
1167822940 19:51946087-51946109 GAATGTGGCAGGGTTGCTAGTGG + Exonic
1168316507 19:55486857-55486879 GGGGGTGGGAGGGATGCTGGAGG + Exonic
1168667932 19:58218340-58218362 GATGATGGTAGGGGTGCTGGGGG + Intergenic
925017615 2:543722-543744 GTGGGAGGCAGGGAGGCTGGAGG + Intergenic
925148214 2:1595074-1595096 GAGGCTGGCAGTGTTCCCGGAGG + Intergenic
925173840 2:1768617-1768639 CAGGGTGGGAGGATTGCTTGAGG + Intergenic
925222444 2:2153063-2153085 TAAGGTGGGAGGGTTGCTTGAGG + Intronic
925309960 2:2875304-2875326 CAAGGTGGCAGGGCTGCTGGGGG - Intergenic
926253585 2:11170361-11170383 GATGCTGGCAGGGCTGGTGGTGG + Intronic
926313035 2:11688252-11688274 GGAGGTGGCAGGGTTGATGTAGG - Intronic
926420178 2:12688199-12688221 GATGGCAGCAGGGTTGCTGTAGG - Intergenic
927189487 2:20507442-20507464 GTGGGTGGTGGAGTTGCTGGAGG - Intergenic
927202062 2:20584017-20584039 GAGGGTGGCCCTGTTGCTGGAGG - Intronic
927809899 2:26175060-26175082 GTGTGTGGCAGGGTGGCGGGCGG - Intronic
927894846 2:26775136-26775158 GAGGGTTGAAGGGCTGCTGGGGG - Exonic
928032870 2:27796648-27796670 GGGGGTGGGAGGGGTGCCGGTGG + Intronic
928098033 2:28417424-28417446 TGGGGTGGCAGGGGGGCTGGGGG + Intergenic
929799081 2:45084005-45084027 GAGGGTGGCATGGGTGCTGTTGG - Intergenic
930571140 2:53088570-53088592 GGGGGTGGCTGGGATGCTGATGG - Intergenic
931268991 2:60685526-60685548 GAGGGGGACAGGGGAGCTGGGGG - Intergenic
931297162 2:60938575-60938597 GAGGAAGGCAGTGCTGCTGGAGG - Intergenic
931401241 2:61933371-61933393 CAGGGTGGCAGGGGTGTGGGGGG + Intronic
931576740 2:63725192-63725214 GAGGGTGGAAGGGTGGGAGGAGG - Intronic
932187698 2:69713061-69713083 GAGAGTGGCAGAGCTGCTGTGGG + Intronic
932625578 2:73293373-73293395 GCGGGTGGCGGGGAGGCTGGCGG + Exonic
934753107 2:96806937-96806959 CAGGCTGGCTGGGTTGCAGGTGG + Intronic
934848149 2:97676524-97676546 CAAGGTGGGAGGATTGCTGGAGG + Intergenic
934991797 2:98926915-98926937 GAGGGTGGGTGGGTTGCGAGGGG - Intronic
935240250 2:101171620-101171642 GGGGGGGGCAGGGGTGGTGGTGG - Intronic
936418995 2:112346306-112346328 GATGGTGGCAGTGGTGGTGGTGG - Intergenic
936419006 2:112346351-112346373 GATGGTGGCAGTGGTGATGGTGG - Intergenic
936419019 2:112346408-112346430 GATGGTGGCAGTGGTGATGGTGG - Intergenic
936419077 2:112346680-112346702 GATGGTGGCAGTGGTGGTGGTGG - Intergenic
936419098 2:112346767-112346789 GATGGTGGCAGTGGTGATGGTGG - Intergenic
937016325 2:118609362-118609384 TGGGATGGCAGGATTGCTGGTGG - Intergenic
937019991 2:118641391-118641413 TAAGGTGGGAGGGTTGCTTGAGG + Intergenic
937291567 2:120785165-120785187 GAGGGAGGGAGGGTGGCTGAGGG + Intronic
937616560 2:123929816-123929838 AAGGGTGGGAGGGTTGGTGGAGG - Intergenic
937692452 2:124771758-124771780 GATGGTGGCAGTGCTGGTGGTGG - Intronic
937695734 2:124806461-124806483 GTGGGAGGCAGGGTTGCTTGGGG + Intronic
938063156 2:128267544-128267566 GAGGGGAGCAGGCTTCCTGGGGG + Exonic
938100576 2:128495303-128495325 GTGGCAGGCAGGGCTGCTGGGGG - Intergenic
938324638 2:130390456-130390478 GAGGCTGGCACGGTTGCTGCCGG - Intergenic
938341447 2:130539197-130539219 GATGGGGGCTGGGTTTCTGGAGG + Exonic
938348382 2:130581512-130581534 GATGGGGGCTGGGTTTCTGGAGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938814899 2:134892076-134892098 AAGGGTGGGAGGGTGGATGGAGG + Intronic
938816431 2:134909226-134909248 GATGGTGGTAGTGTTGCTGGTGG + Intergenic
939629705 2:144516999-144517021 GAGGGGGGCAGCGGGGCTGGGGG + Intronic
940344906 2:152619116-152619138 GAGGGAGGCAGTGGTGGTGGAGG - Exonic
940414443 2:153403519-153403541 CAAGGTGGCAGGGAGGCTGGGGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941775122 2:169385103-169385125 CAGGGTGGGAGGATTGCTTGAGG - Intergenic
942303583 2:174585536-174585558 GGGGGCGGCGGGGGTGCTGGAGG + Exonic
942461099 2:176169478-176169500 GATGGGGGCAGGGTCGGTGGTGG - Exonic
942637051 2:178018778-178018800 CAGAGTGGGAGGGTTGCTTGAGG - Intronic
942851644 2:180494663-180494685 GTGGGTGTGGGGGTTGCTGGAGG - Intergenic
943208997 2:184938604-184938626 GGGGGTGGGAGGGCAGCTGGAGG - Exonic
943716236 2:191155227-191155249 CAAGGTGGCAGGGAAGCTGGAGG - Intergenic
946030072 2:216696515-216696537 GTGGGTGGCAGAGTAGCTGGAGG + Intergenic
946141877 2:217698425-217698447 GAGACTGGCAGGGTTGGGGGGGG - Intronic
946164951 2:217858213-217858235 GAGGGTATCTGGGTTGGTGGGGG - Intronic
946202185 2:218076796-218076818 GAGGGAGGCAGGGGTGAGGGTGG - Intronic
946261210 2:218492773-218492795 CAAGGTGGGAGGGTTGCTTGAGG + Intronic
946395009 2:219439248-219439270 GGGGGTGGCAGAGCTGCAGGTGG - Intronic
946427841 2:219608796-219608818 GGGCGTGGCAGGGTCTCTGGAGG + Intronic
946883477 2:224199476-224199498 GATGGGGGCAGGGTAGTTGGTGG + Intergenic
947486849 2:230558115-230558137 GAGGGTTGTTGGGTTGTTGGGGG - Intergenic
947517769 2:230822325-230822347 GCTGGTGGCAGGATTCCTGGAGG - Intergenic
947826117 2:233107180-233107202 GCGGTAGGCAGGGCTGCTGGTGG + Intronic
947865702 2:233396955-233396977 GAGGGGACCAGGGTGGCTGGGGG + Intronic
947865718 2:233396999-233397021 GAGGGGACCAGGGTGGCTGGGGG + Intronic
947865778 2:233397186-233397208 GAGGGGACCAGGGTGGCTGGGGG + Intronic
947865812 2:233397283-233397305 GAGGGGACCAGGGTGGCTGGGGG + Intronic
947865867 2:233397467-233397489 GAGGGGAGCAGGGTGGCTGGCGG + Intronic
947865885 2:233397518-233397540 GAGGGGACCAGGGTGGCTGGGGG + Intronic
948047392 2:234954299-234954321 GGGGGTGGCATGGGTGCTTGGGG - Intronic
948075589 2:235163037-235163059 GATGATGGCGGGGGTGCTGGTGG + Intergenic
948352295 2:237350921-237350943 GTTGGTGGCAGGGATGGTGGTGG + Intronic
948512230 2:238476318-238476340 GAGGGTGGGAGGGCTCCTTGTGG + Intergenic
948602775 2:239116734-239116756 CAGGGTGGCAGGGAGGCTGCAGG - Intronic
948638070 2:239353085-239353107 CAGGGTTGCAGGGGTGGTGGAGG - Intronic
1169015207 20:2286486-2286508 GAAGGTGGGAGGATTGCTTGAGG - Intergenic
1169251618 20:4065300-4065322 AGGGATGGCTGGGTTGCTGGGGG - Intergenic
1169654162 20:7903808-7903830 GTGGGTGGCAGCAGTGCTGGTGG + Intronic
1170177676 20:13490673-13490695 GAGGGTGGGAGGGGTGAGGGAGG - Intronic
1170515413 20:17124452-17124474 GAGGGTGGCAGGGATAGTGAGGG + Intergenic
1170699112 20:18687293-18687315 GAGGGTGGCAGTGTTGGTGGAGG + Intronic
1170723672 20:18906175-18906197 GAGGGTGAGAGGGTTGCCTGAGG + Intergenic
1170968754 20:21100234-21100256 GAGGGTGGGAGGGGTACAGGGGG + Intergenic
1171268826 20:23797653-23797675 AAGGGTGACAGTGTTGTTGGTGG + Intergenic
1171279946 20:23888015-23888037 AAGGGTGACAGTGTTGCTGGTGG + Intergenic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1172082062 20:32349869-32349891 CAAGGTGGTAGGGTTGCTTGAGG - Intergenic
1172176848 20:32977643-32977665 GAAGGATGAAGGGTTGCTGGTGG + Intergenic
1172448331 20:35004576-35004598 GAGGGAGGCAGGGGTGCAGCAGG + Intronic
1172539274 20:35698773-35698795 GAGGGAGAGAGGGTTCCTGGAGG + Intronic
1172602831 20:36195599-36195621 GAGGGTGGGAGGGCTGAGGGAGG - Intronic
1172786602 20:37472916-37472938 GAAGGTGGCAGGGATGGTGCTGG + Intergenic
1172854285 20:37989568-37989590 TAGGCTTGCAGGGTTCCTGGAGG - Intronic
1172993567 20:39053342-39053364 GGGGGTGGCTGGGTAGCTGTTGG + Intergenic
1173428136 20:42960360-42960382 CAGGGTGGAAGGGGAGCTGGAGG + Intronic
1173528487 20:43750643-43750665 CAAGGTGGGAGGGTTGCTTGAGG + Intergenic
1173672028 20:44805602-44805624 GAGGCTGGCAGGGTGGATGAGGG - Intronic
1173694408 20:44996334-44996356 GAGGAAGGCAGGGTTGGCGGGGG - Intronic
1173960378 20:47066783-47066805 GATGGTGGCAGGTCTCCTGGAGG - Intronic
1174218153 20:48932918-48932940 GAGTGTGGAAGGGTTACTGTGGG + Intronic
1174404684 20:50295770-50295792 GTGAGGGGCAGGGGTGCTGGGGG - Intergenic
1174412210 20:50343576-50343598 GAAGGAGGCAGGGTCCCTGGTGG + Intergenic
1174470776 20:50759120-50759142 AATGTTGCCAGGGTTGCTGGAGG - Intergenic
1174540924 20:51288625-51288647 GAGGCAGACAGGGTTGATGGGGG + Intergenic
1174567845 20:51479860-51479882 GAGGGTGGCAGGGAAGCGGGTGG - Intronic
1174965619 20:55211193-55211215 GAGGGTGGAAGGGAGGCTAGGGG + Intergenic
1175215119 20:57388226-57388248 GGAGGTGGGAGGGTTGCTTGAGG + Intergenic
1175408257 20:58749262-58749284 GTGGGTGGCTGGGATGGTGGTGG + Intergenic
1175698324 20:61119071-61119093 GAGAGAGGCAGCGGTGCTGGAGG - Intergenic
1175812377 20:61865141-61865163 GAGGGATGCAGGGTGGCAGGAGG - Intronic
1175825400 20:61933991-61934013 CAGGGTGGAAGGGGGGCTGGCGG + Intronic
1175975807 20:62709884-62709906 GACGGTGGCAGTGTGGATGGTGG - Exonic
1175984039 20:62755372-62755394 GAGGGAGGGAGGGTGGATGGAGG - Intronic
1175984112 20:62755589-62755611 GAGGGAGGGAGGGATGATGGAGG - Intronic
1175984167 20:62755745-62755767 GAGGGAGGGAGGATGGCTGGAGG - Intronic
1176103710 20:63375991-63376013 TGGGGTTGCAGGGTTGGTGGGGG - Intronic
1176258409 20:64166066-64166088 CGGGGTGGCAGGGAGGCTGGGGG - Intronic
1176703761 21:10093228-10093250 GGGGGTGGCAGGGGGGTTGGGGG + Intergenic
1178278161 21:31257855-31257877 GAGGTTGGCATGGTAGTTGGAGG - Intronic
1178508208 21:33180329-33180351 CAGGATGCCAGCGTTGCTGGGGG - Intergenic
1179049260 21:37874840-37874862 GAGGGTGGCAGTGGTGGAGGTGG - Intronic
1179238244 21:39566227-39566249 GAGAGAGGCATGGTGGCTGGGGG + Intronic
1179313800 21:40223032-40223054 AAGGTTGGTAGGGATGCTGGAGG - Intronic
1179413366 21:41179087-41179109 GAGGGTGTCAGGGTGACTGAGGG + Intronic
1179543639 21:42100471-42100493 GAGGGTGGCCGGGGTGCTTGAGG - Intronic
1179618741 21:42598722-42598744 GAGGGTGGCAGTGTGGTAGGCGG + Intergenic
1179647907 21:42786370-42786392 GAGGTTAGCAGGGGTGTTGGAGG - Intergenic
1179718425 21:43301940-43301962 GAGGGTGGTGGGGGTGCAGGCGG + Intergenic
1179724924 21:43336723-43336745 GATGGTGGCGGTGTTGGTGGTGG - Intergenic
1179853000 21:44147795-44147817 GGGAGTGGTAGGGGTGCTGGGGG - Intergenic
1179908031 21:44434248-44434270 GACGGTGGCGGGGACGCTGGCGG + Intronic
1179908073 21:44434410-44434432 GACGGTGGCAGGGATGCTGTCGG + Intronic
1180068936 21:45426549-45426571 GGGCGTGGCAGGGTTTCCGGGGG - Intronic
1180385466 22:12174453-12174475 GATTGTGGCAGGGATGCTGCTGG - Intergenic
1180959864 22:19757654-19757676 GCGGGTGGTAGGGATGCTGGTGG - Intronic
1180965299 22:19784999-19785021 CAGGGTGGCAGCGCGGCTGGGGG - Exonic
1181035561 22:20168315-20168337 GTGGGTGGCAGGGCCCCTGGAGG - Intergenic
1181051431 22:20240002-20240024 GGGGGTGCCAGGGGTGCTGATGG + Intergenic
1181580747 22:23826880-23826902 GTGACTGGCAGGGCTGCTGGGGG - Intronic
1181619891 22:24083663-24083685 GAGGGTAGGAGGGTTACTTGAGG + Intronic
1181819379 22:25463432-25463454 GGGGGTGGCGGGGTTGCGGGGGG + Intergenic
1182232428 22:28848814-28848836 AAGGGTGGGAGGATTGCTTGAGG + Intergenic
1182266945 22:29124382-29124404 GTGGTTGCCAGGGTTTCTGGGGG + Intronic
1182473061 22:30560549-30560571 GAGGCTGACAGGGGTGCTTGAGG - Intronic
1183244112 22:36680378-36680400 GATGGTGGCAGTGATGGTGGTGG - Intronic
1183281847 22:36936465-36936487 GAGGGTGACGGGGGTGCAGGAGG - Intronic
1183334504 22:37238974-37238996 GAGGATGGTAGGTTTGCTGGGGG - Intronic
1183374444 22:37454812-37454834 GAGGGAGGAAGGGAGGCTGGGGG - Intergenic
1183704419 22:39468221-39468243 GAGGGTGGCAGCGTTGCCCCTGG - Intronic
1184098860 22:42331015-42331037 GCAGGTGGCAGGGCTGCTCGGGG + Intronic
1184113489 22:42408988-42409010 GTGTGTGGGAGGGTTGCTGGAGG + Intronic
1184172650 22:42768938-42768960 GAGGGTGGGTGGGTGGGTGGTGG + Intergenic
1184264337 22:43339048-43339070 GAGGCTGCCAGGGCTGCTGTAGG - Intronic
1185166143 22:49263477-49263499 GAGGTTGCCAGGGGTGGTGGAGG - Intergenic
1185336813 22:50274665-50274687 GGGGCTGGGAGGGGTGCTGGGGG - Intergenic
1185336842 22:50274727-50274749 GGGGCTGGGAGGGGTGCTGGGGG - Intergenic
1185336857 22:50274759-50274781 GGGGCTGGGAGGGGTGCTGGGGG - Intergenic
1185336873 22:50274791-50274813 GGGGCTGGGAGGGGTGCTGGGGG - Intergenic
1185336902 22:50274853-50274875 GGGGCTGGGAGGGGTGCTGGGGG - Intergenic
949906772 3:8864385-8864407 GAGGGTGGCAGAGGGGCTGGGGG + Intronic
949956312 3:9271558-9271580 GAGGGTGGCAGGCTTGGAAGAGG - Intronic
950439947 3:13004699-13004721 GTGGGAGGGAGGGTGGCTGGGGG + Intronic
950507483 3:13404210-13404232 GAGGAAGGCAGGGTGGGTGGGGG - Intronic
950620969 3:14204964-14204986 GAGGGTGGTAAGGCTGCCGGGGG - Intergenic
951263403 3:20539286-20539308 GAAGGTACCAGGGTTACTGGTGG + Intergenic
951781530 3:26368635-26368657 GAGGGTTTTAGGGATGCTGGAGG + Intergenic
952338420 3:32424741-32424763 GAGGCTGGGAGGATTGCTGGAGG - Intronic
952952975 3:38539122-38539144 GATGAAGGCAGGGCTGCTGGAGG + Intronic
953913117 3:46902695-46902717 GAGGGTGGGAGGGGTTCCGGGGG + Intronic
954290866 3:49649303-49649325 CTCGGTGGCAGAGTTGCTGGTGG + Intronic
954328801 3:49878008-49878030 GGGGGTGGCAGGGGTGGGGGTGG + Intergenic
954405240 3:50341764-50341786 GAGGGTGGAGGGGATGCAGGAGG - Intronic
954428518 3:50456606-50456628 GAGGGCAGCAGGGTTCCTGGTGG - Intronic
954712307 3:52511271-52511293 TAGGGTGGCAGGGGTGGAGGTGG + Intronic
954861743 3:53696198-53696220 GATGGTGGGAGGATTGCTTGAGG - Intronic
955141830 3:56277433-56277455 GAGGGAGGCAGGGTTTTGGGAGG - Intronic
955203815 3:56876867-56876889 AAGGGTGGCAGGATGGGTGGAGG + Intronic
955546100 3:60032225-60032247 TTGGGTGGGAGGGTTGCTCGAGG + Intronic
955700812 3:61680298-61680320 GAGGGAAGCAGGGTAGGTGGAGG + Intronic
955721281 3:61883946-61883968 CAAGGTGGCAGGATTGCTTGAGG - Intronic
956625184 3:71259884-71259906 GAGGGTGGGGGTGCTGCTGGAGG + Intronic
958007711 3:87833716-87833738 GAGGGTGGGAGGACTGCTTGAGG - Intergenic
958446823 3:94225845-94225867 GAGTGTGGCCGGGTTACTGGAGG - Intergenic
958464709 3:94443242-94443264 GGGGGTGGCAAGGCAGCTGGGGG - Intergenic
959142001 3:102496850-102496872 GAGGGTGGGAGGGTGGGAGGAGG + Intergenic
960572643 3:119200283-119200305 CAGGGTGGGAGGATTGCTTGAGG - Intronic
960786242 3:121375018-121375040 GAGGGTGGGAGGGTGGGAGGGGG + Intronic
960878121 3:122316747-122316769 CAGAGTGGCAGGGTTGCTTGAGG - Intergenic
961213092 3:125140815-125140837 CAAGGTGGGAGGGTTGCTCGAGG - Intronic
961383698 3:126512228-126512250 GAGGTTGCCAGGGTGGGTGGAGG - Intronic
961416185 3:126759075-126759097 GAAAGTGGCAGGGCTGCAGGAGG - Intronic
961924266 3:130460725-130460747 GTGGGTGGTAGGGATGGTGGTGG + Intronic
962417289 3:135194598-135194620 TAGTGTGGAAGGGTAGCTGGGGG + Intronic
963648750 3:147949349-147949371 TAAGGTGGCAGTATTGCTGGAGG + Intergenic
963978485 3:151509905-151509927 TAAGGTGGCAGGGAGGCTGGGGG + Intergenic
964492133 3:157248184-157248206 CAAGGTGGGAGGGTTGCTTGAGG + Intergenic
964612002 3:158624944-158624966 AGGGGTCGCAGGGTTGGTGGAGG + Intergenic
965517486 3:169637104-169637126 CACAGTGGCTGGGTTGCTGGAGG - Intronic
965585492 3:170314297-170314319 GAGGGAGGCTGGGTTACTGGTGG - Intergenic
965806811 3:172550619-172550641 GTGGGTGGCAAGGTTGGGGGTGG + Intergenic
966146560 3:176818691-176818713 GAGGATTGCTGGGTTGCTTGAGG - Intergenic
966362997 3:179149156-179149178 AAGGGTGGGAGGGGAGCTGGCGG - Intronic
966592834 3:181700573-181700595 GAAGGTGGGAGGGTTTCTGCGGG + Intergenic
967224291 3:187276013-187276035 AAGGATGGCAGTGTGGCTGGAGG - Intronic
968225123 3:196968544-196968566 GAGGAGGGCAGGGGAGCTGGGGG - Intronic
968905835 4:3450094-3450116 GAGGGCGGGAGTGTGGCTGGTGG + Intergenic
969247973 4:5947889-5947911 GAGGCTGGCAGGGACCCTGGGGG - Intronic
969357860 4:6641186-6641208 GAAGATGGCAGAGATGCTGGTGG + Exonic
969446457 4:7247599-7247621 GGGCGTGTTAGGGTTGCTGGAGG + Intronic
969467430 4:7366125-7366147 GAGGGTGGCAGGGATGTGCGGGG - Intronic
969527449 4:7711062-7711084 CAGGGAGGCAGGGTCCCTGGGGG + Intronic
969579345 4:8054981-8055003 CAGAGTGCCAGGGATGCTGGGGG - Intronic
969617577 4:8262575-8262597 AAGTGTGGCAGGGGTGCTGGGGG - Intergenic
969694638 4:8727781-8727803 GTGGGGGACAGGGTTGGTGGCGG - Intergenic
969871173 4:10106099-10106121 GAGGGTGGAAGGGGTGGCGGGGG + Intronic
970383844 4:15536307-15536329 GGGGGTGGGAGGGTTGGGGGAGG + Intronic
970487853 4:16542386-16542408 GAGGATAGCAGGTTTGATGGAGG + Intronic
970515449 4:16825064-16825086 GAGGGAGGCAGCCTTCCTGGAGG + Intronic
971402601 4:26290095-26290117 CATGGTGGGAGGGTTGCTTGAGG + Intronic
972106789 4:35497565-35497587 GAGGGTGGAAGGGTGGGAGGAGG + Intergenic
972367250 4:38387718-38387740 GTGGGTGGAAGGGTGGCTGGAGG + Intergenic
972404481 4:38733359-38733381 GATGGTGGTAGTGTTGGTGGTGG + Intergenic
975784898 4:77877414-77877436 GGTGGGGGCTGGGTTGCTGGAGG + Intronic
976475197 4:85475307-85475329 GGGGGTGGCTGGGTGGCTGGGGG + Exonic
977227155 4:94406213-94406235 CAAGGTGGCAGGATTGCTTGAGG + Intergenic
977475953 4:97509945-97509967 AGGGGTGGGAGGGTTGGTGGGGG - Intronic
978344420 4:107752178-107752200 CAAGGTGGGAGGGTTGCTTGAGG + Intergenic
978545901 4:109872685-109872707 GAGGGTGGTAGGAATGCTGTAGG + Intergenic
978756603 4:112309459-112309481 CAGGGTGGCAGCGAGGCTGGGGG - Intronic
979056303 4:115999212-115999234 GAACCTGGCAGGGTTTCTGGAGG - Intergenic
980375977 4:131949580-131949602 GGGGGTGGCAGGGGGGTTGGGGG + Intergenic
981266643 4:142791912-142791934 GTGGGTGCCAGGATTGTTGGAGG - Intronic
981684140 4:147434500-147434522 GAGGGTGGCAGGGATGGGGGTGG - Intergenic
981841988 4:149123556-149123578 CAAGGTGGAAGGGTTGCTTGAGG + Intergenic
982172852 4:152678537-152678559 GAGGGGGGCAGTGGTGGTGGGGG + Intronic
982213833 4:153063273-153063295 CAAGGTGGGAGGATTGCTGGAGG + Intergenic
983072834 4:163290468-163290490 CAAGGTGGGAGGGTTGCTTGAGG - Intergenic
983416102 4:167456820-167456842 GATGGTGGCAGTGGTGGTGGTGG + Intergenic
983534996 4:168848129-168848151 GACGGGGGTAGGGTTGCCGGAGG - Intronic
984094455 4:175416707-175416729 CAAGGTGGCAGGATTGCTTGAGG - Intergenic
984206480 4:176792807-176792829 GAGGGCGGCGGGGCGGCTGGCGG + Intergenic
984781370 4:183529143-183529165 GAGGGTGGGAGGATTGCTTGAGG + Intergenic
984932449 4:184859042-184859064 GCAGATGGCAGAGTTGCTGGAGG + Intergenic
985079721 4:186252480-186252502 GTGGGTGGCAGGATTGGTGGTGG - Intronic
985079733 4:186252523-186252545 GTGGGTGGTAGGATTGGTGGTGG - Intronic
985079756 4:186252602-186252624 GTGGGTGGCGGGATTGGTGGTGG - Intronic
985079783 4:186252681-186252703 GTGGGTGGCGGGATTGGTGGTGG - Intronic
985478032 5:90874-90896 GGGTGTGGCAGGGGTGTTGGGGG + Intergenic
985673152 5:1216726-1216748 GAGGCTGGGAGGCTTCCTGGAGG - Intronic
985680340 5:1252784-1252806 TGGGGTGGCAGGGGTGATGGGGG - Intergenic
985680354 5:1252814-1252836 CAGGGTGGCAGGGATGATGGGGG - Intergenic
985680377 5:1252873-1252895 AAGGGCAGCAGGGATGCTGGGGG - Intergenic
985938895 5:3118468-3118490 GAGGGTGGAGGGGGTGCTGGAGG - Intergenic
986516806 5:8573088-8573110 GAGGCTGGGAGGGAAGCTGGAGG - Intergenic
987043649 5:14086363-14086385 GATGGTGGCAGGGATCCTTGTGG - Intergenic
987050848 5:14145035-14145057 GAGGCGGGCGGGGGTGCTGGTGG + Intronic
987681503 5:21142902-21142924 GAGGGTGGGTGGGATGTTGGAGG + Intergenic
987695591 5:21325575-21325597 GATGGTGGTAGGATTGGTGGTGG - Intergenic
987818211 5:22930993-22931015 AAAGGTGGCAGGGTTGAAGGTGG - Intergenic
988037228 5:25842845-25842867 AAAGGTGGGAGGATTGCTGGAGG - Intergenic
989457164 5:41657631-41657653 AAGAGTTTCAGGGTTGCTGGAGG - Intergenic
989977298 5:50601844-50601866 CAAGGTGGCAGGGAGGCTGGGGG - Intergenic
991587552 5:68215801-68215823 GAGGGCGGCAGGCTAGCTGTCGG + Exonic
991684330 5:69167586-69167608 GGGGGTTACAGAGTTGCTGGCGG - Intronic
991744812 5:69726523-69726545 GATGGTGGTAGGATTGGTGGTGG + Intergenic
991752893 5:69828703-69828725 GATGGTGGTAGGATTGGTGGTGG - Intergenic
991796382 5:70306251-70306273 GATGGTGGTAGGATTGGTGGTGG + Intergenic
991802511 5:70385437-70385459 GATGGTGGTAGGATTGGTGGTGG - Intergenic
991824192 5:70601837-70601859 GATGGTGGTAGGATTGGTGGTGG + Intergenic
991832212 5:70703831-70703853 GATGGTGGTAGGATTGGTGGTGG - Intergenic
991888760 5:71305807-71305829 GATGGTGGTAGGATTGGTGGTGG + Intergenic
992417023 5:76561522-76561544 CTGGGTGGCAGGGAGGCTGGGGG + Intronic
992632248 5:78692956-78692978 GGGGGTGGGAGTGTTGGTGGGGG - Intronic
993687689 5:90960177-90960199 TAGGGTGGTAGGGGTGGTGGTGG + Intronic
993901083 5:93584683-93584705 GAGGGGAGCAGGGGTGTTGGGGG + Exonic
994405966 5:99345334-99345356 GAAGGTGGCAGCGAGGCTGGGGG - Intergenic
994452153 5:99956082-99956104 CAGGGTGGCAGGGTGGGTGCTGG + Intergenic
994565621 5:101442468-101442490 GAAGGTGGCAGCGAGGCTGGGGG + Intergenic
995144947 5:108777077-108777099 CAGGGTGGGAGGATTGCTTGAGG + Intronic
995932514 5:117465036-117465058 GAGGGTGGGAAGGGTACTGGGGG - Intergenic
996103447 5:119469996-119470018 GGAGGGGGAAGGGTTGCTGGTGG + Intronic
996277514 5:121685191-121685213 GGGGGTTGCAGAGTTGCTGGAGG - Intergenic
997250424 5:132384655-132384677 GAGGGCGGCATGGTTGGAGGAGG + Intronic
997502555 5:134388033-134388055 GAGGCAGGCAGGATTGCTTGAGG - Intronic
997722016 5:136086367-136086389 CAGGGTGGGAGGATTGCTTGAGG + Intergenic
997826990 5:137115169-137115191 TAGGGTGGCGGGGTCGGTGGGGG + Intronic
997884093 5:137615357-137615379 CAGGCTCCCAGGGTTGCTGGAGG - Intergenic
998014963 5:138724736-138724758 GGAGGTGGGAGGGTTGCTAGGGG - Intronic
998039675 5:138944430-138944452 GAGGATGGCAGGGAGGGTGGTGG - Intergenic
998133781 5:139664186-139664208 GAGGGTGGATGGGTGGGTGGGGG + Intronic
998875779 5:146597679-146597701 TAGGGTGGTAGGGTTGCTCAGGG - Intronic
999413931 5:151378659-151378681 GATGGTGGCTGTGGTGCTGGTGG - Intergenic
1000335286 5:160237551-160237573 GAACATGGCAGGGGTGCTGGTGG - Intronic
1000965298 5:167648683-167648705 GAGGGTGGAAGAGGTGCAGGGGG + Intronic
1001310260 5:170605175-170605197 GAGGGTGGGCAGGTGGCTGGTGG - Intronic
1001551259 5:172603746-172603768 GAGGGTGGCTGGGCTGATGGTGG + Intergenic
1001641205 5:173245444-173245466 GAGTGCGGCAGGGACGCTGGGGG - Intergenic
1002061478 5:176628369-176628391 GAGGGTGGCAGGGGCGAGGGTGG - Intronic
1002107830 5:176888868-176888890 CAGGGGGGAAGGGTGGCTGGAGG + Intronic
1002460816 5:179372839-179372861 GTGGGTGGCAGCGTTTTTGGAGG + Intergenic
1002718780 5:181245781-181245803 GAGGGTGGCAGAGCTGCCGGAGG + Intronic
1003298641 6:4856525-4856547 GAGGGTGGCAGGGTAGAAGCAGG + Intronic
1003465559 6:6376836-6376858 GAGGGGGGCAGTGGTGGTGGTGG - Intergenic
1003507471 6:6751644-6751666 AAGGGTGGCAGTGTTTCAGGAGG + Intergenic
1004154934 6:13159149-13159171 GAAGGTGGCAGCGGGGCTGGAGG - Intronic
1004347823 6:14864656-14864678 GAGGGTGGCCAGGTTGTTGACGG - Intergenic
1004411924 6:15389255-15389277 TGAGGTGGGAGGGTTGCTGGGGG - Intronic
1004560899 6:16749621-16749643 GAAGGAGGCTGGGTGGCTGGAGG - Intronic
1005280697 6:24270695-24270717 GAGGGTGACAGGGTGGAGGGAGG - Intronic
1005360137 6:25023823-25023845 GAGGATGTCAGGGGTGTTGGGGG + Intronic
1006165411 6:32061741-32061763 GAGGATGGCAGGGTCCCTGGGGG + Intronic
1006333631 6:33409777-33409799 AGGGGTGGGAGGGTTGCTGGAGG + Exonic
1006421128 6:33934935-33934957 GAAGGTGGCAGAGCTGCTGAAGG - Intergenic
1006603399 6:35240510-35240532 GAGGGGGCCAGGGTGGCTGGGGG - Intronic
1006657018 6:35604239-35604261 CAAGGTGGGAGGGTTGCTTGAGG - Intronic
1006799129 6:36748301-36748323 GAGGGAGGCAGGGCTGTGGGAGG + Intronic
1007227946 6:40328026-40328048 GTGGGAGGCAGGGCTGCTGAGGG + Intergenic
1007228220 6:40329476-40329498 GAGGAGGGCAGGGCTGCAGGAGG - Intergenic
1007331698 6:41115932-41115954 GAGGGTGGTAGGTTTGAGGGAGG - Intergenic
1007369722 6:41418378-41418400 GAGGGTGGCAGGGGTGATGGTGG - Intergenic
1007599471 6:43072847-43072869 GAAGGTGGCAGAGCTGCTTGGGG + Exonic
1007635058 6:43294711-43294733 GATGGTGGTAATGTTGCTGGTGG - Intergenic
1007722219 6:43891746-43891768 GAGGGTGGCAGGCATGGCGGAGG + Intergenic
1007772747 6:44204253-44204275 AAGGATGGCAGGGCAGCTGGAGG + Intergenic
1007784099 6:44270548-44270570 GAGGGTGGGAGGCAGGCTGGGGG - Exonic
1007959447 6:45945706-45945728 CAGGATGGCATGGTAGCTGGGGG - Intronic
1009318369 6:62253473-62253495 GGAGGAGGCAGGGTTGCAGGGGG - Intronic
1009996663 6:70902895-70902917 AGGGGTGGCAGGGGGGCTGGTGG + Intronic
1010603658 6:77862504-77862526 CAAGGTGGCAGCGATGCTGGGGG + Intronic
1011360447 6:86518681-86518703 TAGGATGGCAGGCTTGCTGGGGG - Intergenic
1011507796 6:88067609-88067631 GGCGGTGGCAGGGGTGATGGGGG + Intergenic
1011533527 6:88351230-88351252 CAAGGTGGCAGGGAGGCTGGGGG + Intergenic
1011717870 6:90125874-90125896 GAGGGTGGCAGGGGTGGATGAGG - Intronic
1012175353 6:96075014-96075036 CAAGGTGGAAGGGTTGCTTGAGG - Intronic
1012279118 6:97308171-97308193 GATGGTGGCAGTGGTGCTGGTGG + Intergenic
1012522972 6:100143056-100143078 GAGGATGGGAAGGTTGGTGGTGG + Intergenic
1012958630 6:105598207-105598229 CAAGGTGGCAGGATTGCTTGAGG - Intergenic
1013579390 6:111518163-111518185 GAGGGTGGGAGTGATGCTGCAGG - Intergenic
1014185232 6:118427221-118427243 CAAGGTGGCAGGGAGGCTGGGGG + Intergenic
1014798576 6:125752115-125752137 GGGGGTGGCGGGGTGGGTGGGGG - Intronic
1015279928 6:131422143-131422165 GAGGGTGGCAGTGAAGATGGAGG + Intergenic
1015449110 6:133343547-133343569 GGTGGTGGCGGGGGTGCTGGTGG - Intronic
1016107815 6:140184816-140184838 AGGAGTGGCAGGGGTGCTGGGGG - Intergenic
1017446580 6:154511713-154511735 GAGGGTGGCAGGGGTTGGGGGGG - Intergenic
1017720203 6:157238480-157238502 GAGGGTGGCAGTGATGGTGGTGG + Intergenic
1018177049 6:161186321-161186343 GGAGGTGGCAGGGTTTCTCGTGG - Intronic
1018356239 6:163020848-163020870 GATGGTGGCAGGGCTGTTAGAGG - Intronic
1019308465 7:347458-347480 GAGGGGGTCAGTGTTGGTGGAGG - Intergenic
1019353218 7:564829-564851 GAGGGAGGAAGTGTTGCAGGCGG + Intronic
1019390918 7:786703-786725 GGGGGTGTCAGGGTTGGGGGAGG + Intergenic
1019391069 7:787165-787187 GAGGGTGTCAGGGTTGGGTGAGG + Intergenic
1019477188 7:1249639-1249661 GGGGGTGGGAGGGCTGCTGCTGG + Intergenic
1019694536 7:2437925-2437947 GAGGCTGGCAGGGCTGCCGTAGG + Intergenic
1020622365 7:10533630-10533652 GAAGGTGGCAGCGAGGCTGGGGG + Intergenic
1021185047 7:17554554-17554576 GAAGGTGGAAGAGTTGTTGGAGG - Intergenic
1021285453 7:18776173-18776195 CAAGGTGGCAGGATTGCTTGAGG - Intronic
1022823703 7:33987224-33987246 GAGGGTGGCAGTGCTCCTGTGGG + Intronic
1022977785 7:35574909-35574931 GAGTGTGGCAGGGAGGCTGAGGG - Intergenic
1023475663 7:40575111-40575133 GAGGGTGGCGGGGGTGGGGGTGG + Intronic
1023642770 7:42277066-42277088 GAGGGTGGCAGGGTTGATATTGG + Intergenic
1024213726 7:47228803-47228825 GAGGGAGGCGGGGTTGGAGGTGG - Intergenic
1024213760 7:47228891-47228913 GAGGGAGGCGGGGTTGTAGGTGG - Intergenic
1024606324 7:51025236-51025258 GAGGGTGGAGGGGGTGGTGGGGG + Exonic
1024933873 7:54691853-54691875 CAAGGTGGGAGGGTTGCTTGCGG + Intergenic
1025079292 7:55968019-55968041 GAGGGTGGGAGGACTGCTTGAGG - Intronic
1025173171 7:56779974-56779996 GAAGGTGGGAGGATTGCTTGAGG + Intergenic
1025184146 7:56844096-56844118 CAAGGTGGCAGCGATGCTGGGGG - Intergenic
1025698936 7:63798204-63798226 GAAGGTGGGAGGATTGCTTGAGG - Intergenic
1026023768 7:66729656-66729678 GATGGTGGCAGTGATGATGGTGG - Intronic
1026060357 7:67020145-67020167 GTGGGTGGGAGGATTGCTGGAGG + Intronic
1026133090 7:67636586-67636608 GAGGCTTCCAGGGCTGCTGGAGG - Intergenic
1026356502 7:69562314-69562336 CAGGGTGGGAGGATTGCTTGAGG + Intergenic
1026438008 7:70416817-70416839 GAGGGGAGCAGGGGTGCAGGAGG - Intronic
1026461031 7:70615228-70615250 GTGGGTGGCAGGGATGAGGGTGG + Intronic
1026650571 7:72212580-72212602 GAGGCTGACAGGATTGCTTGAGG + Intronic
1026671283 7:72392741-72392763 CAAGGTGGGAGGATTGCTGGAGG + Intronic
1026781076 7:73267885-73267907 GAGAGGGGCAGGGTGGCAGGTGG - Intergenic
1026826149 7:73583026-73583048 GAGGGCGGGAGGATTGCTTGAGG - Intergenic
1026888396 7:73967918-73967940 GATGGTGGCAGTGATGATGGTGG - Intergenic
1026905843 7:74062240-74062262 GAGGAGGCCAGGGCTGCTGGGGG - Intronic
1026988534 7:74569895-74569917 CAGGGTGGCAGGCAGGCTGGGGG + Intronic
1027021930 7:74821327-74821349 GAGAGGGGCAGGGTGGCAGGTGG - Intronic
1027066091 7:75124590-75124612 GAGAGGGGCAGGGTGGCAGGTGG + Intronic
1028497872 7:91482384-91482406 CAAGGTGGCAGGGAGGCTGGGGG - Intergenic
1028653755 7:93178738-93178760 GGGGGTGGCAGGGTTGGGGTGGG + Intergenic
1029382232 7:100221657-100221679 CAGAGTGGCAGGGGTGTTGGGGG + Intronic
1029466346 7:100727625-100727647 GAGGAAGGCAGGGATGATGGAGG + Intergenic
1029529988 7:101118932-101118954 CAAGGTGGCAGGATTGCTTGAGG - Intergenic
1030112817 7:106041089-106041111 GGGCTTGGCAGGGTTGCAGGAGG - Intergenic
1030113122 7:106043038-106043060 CAGGGTGACTGGGTTCCTGGAGG + Intergenic
1030197175 7:106863790-106863812 GTGTGTGGGAGGGTTCCTGGGGG - Intergenic
1030466106 7:109905842-109905864 CAGGGCGGCAGGGAGGCTGGGGG + Intergenic
1030521063 7:110598748-110598770 GAGGGTGGTATAGTTGCTGTAGG - Intergenic
1030930140 7:115512583-115512605 GATGGAGGCAGGATTGCTTGAGG - Intergenic
1030978371 7:116155438-116155460 GATGCTGGCAGGTTTGCTGTAGG - Intronic
1031995449 7:128227458-128227480 GGGGGTGGCAGAGTTGGTGCAGG - Intergenic
1032240147 7:130153766-130153788 GAGGGAGGCAGGGTGGCCGTGGG - Intergenic
1032487591 7:132299679-132299701 GAAGGTGGAATGGATGCTGGAGG - Intronic
1033358559 7:140621265-140621287 CAAGGTGGGAGGGTTGCTTGAGG - Intronic
1033763882 7:144466144-144466166 GAGGGTGGCAGGAGATCTGGAGG - Intronic
1033842057 7:145386743-145386765 GAGGGAGGCAGGGTTGCTGTTGG + Intergenic
1033943214 7:146681443-146681465 GAGGGTGGCAGGGTGGCGGGGGG + Intronic
1033962215 7:146928861-146928883 CAAGGTGGCAGGGAGGCTGGGGG + Intronic
1034277090 7:149828793-149828815 GAGGGTGGTAGGGCTGCAGGGGG - Intergenic
1034353900 7:150435604-150435626 GTGGGTGTCTGGGGTGCTGGTGG + Intergenic
1034411011 7:150942246-150942268 GAGGGTGGGACGGGAGCTGGAGG - Intergenic
1034444820 7:151108443-151108465 GAAGGCGGCAGAGGTGCTGGTGG - Intronic
1034507354 7:151504042-151504064 GAGGGAGACAGGGTAGCTTGAGG - Intronic
1034594486 7:152176616-152176638 GAGGCCGGCAGAGTTGGTGGTGG + Exonic
1034607456 7:152330152-152330174 GAGGGGGGGAGGGGTGGTGGGGG + Intronic
1034633525 7:152549245-152549267 CAGGGTGGGAGGATTGCTTGAGG + Intergenic
1034987179 7:155523590-155523612 TTGGGTGGCAGGGGTGTTGGGGG - Intronic
1035269741 7:157712118-157712140 AAGGGGGGCTGGGTGGCTGGGGG + Intronic
1035327404 7:158074028-158074050 GAGGACGGCAGGATGGCTGGCGG - Intronic
1035402471 7:158576507-158576529 GAGGCAGGCAGAGGTGCTGGTGG - Intronic
1035405436 7:158594086-158594108 GAAGGTGTCAGTGTTGGTGGTGG + Intergenic
1035580732 8:737922-737944 GAGGGCGTCAGGGTTGGGGGCGG + Intronic
1035828298 8:2668201-2668223 GAGGGTGGCAGGGGCGGGGGTGG + Intergenic
1035987853 8:4454216-4454238 GAGGGTGGCGGTGTTGGGGGTGG - Intronic
1036215815 8:6878771-6878793 GAGGATATCAGGGTTGGTGGGGG + Intergenic
1036784505 8:11677102-11677124 GTGGGAGGCTGGGATGCTGGGGG + Intronic
1036799735 8:11781484-11781506 GATGATGACAGGTTTGCTGGGGG - Intronic
1037426233 8:18757644-18757666 GATGGTGGCTCGGATGCTGGTGG - Intronic
1037772511 8:21810848-21810870 GGGGGTTGCTTGGTTGCTGGGGG - Intronic
1037906734 8:22719793-22719815 GGGAGGGGCAGGGTGGCTGGTGG + Intronic
1038653921 8:29431217-29431239 CAAGGTGGGAGGATTGCTGGAGG + Intergenic
1038734415 8:30156290-30156312 GAGCCTGGCAGGGTTGGGGGAGG - Exonic
1038737308 8:30182799-30182821 CAGGGCGGCAGGGGTGCAGGTGG - Intronic
1039802781 8:40974480-40974502 GAAGGAGGCAGAGCTGCTGGCGG - Intergenic
1039813622 8:41072180-41072202 CAAGGTGGGAGGGTTGCTTGAGG + Intergenic
1039895680 8:41715008-41715030 GCGGGTGGCAGAGCTGCTGCTGG - Exonic
1040018545 8:42720079-42720101 GAGTGGGGCAGGGTTGCGTGGGG - Intronic
1040334272 8:46408158-46408180 GAGGGTGGCAGGGACTCAGGGGG + Intergenic
1040341581 8:46443776-46443798 GCGGGTGGCAGGGACTCTGGGGG - Intergenic
1040632409 8:49230590-49230612 GGGTGTGGCAGGGGAGCTGGAGG + Intergenic
1040662615 8:49593804-49593826 GAACGTGGAAGGGTTGCTGAGGG + Intergenic
1041784859 8:61620731-61620753 GAGGGTTGCAGTGTTCCTGCAGG - Intronic
1042053672 8:64738963-64738985 GAACATGGCAGGGTTCCTGGAGG - Intronic
1042625036 8:70748497-70748519 GAGGGAGCCAAGGTTGCAGGGGG - Intronic
1043837046 8:85060250-85060272 GAGAGGGACAGAGTTGCTGGCGG + Intergenic
1043923723 8:86013338-86013360 GGGGGTGACAGGGATGATGGGGG - Intronic
1043984119 8:86673443-86673465 GAGGGTGGCAGGAGTGATGGTGG + Intronic
1044402432 8:91788214-91788236 CAGGGTGGCAGCGAGGCTGGGGG + Intergenic
1044792998 8:95866782-95866804 GAGGGTGGTGGGGTATCTGGGGG + Intergenic
1044838156 8:96315509-96315531 CATGGTGGCAGGGTTGTTGTAGG - Intronic
1045032930 8:98154584-98154606 GAGGGTGGGAAGGTGACTGGTGG + Intronic
1048142043 8:131804134-131804156 GAGAGGGGCAGGGTTGGAGGTGG + Intergenic
1048389516 8:133948167-133948189 GGGGGTGGGGGGGTGGCTGGGGG + Intergenic
1049229962 8:141476851-141476873 GCGTGCAGCAGGGTTGCTGGAGG - Intergenic
1049290062 8:141797145-141797167 GAGGGTGGTGGGGGTGCGGGTGG + Intergenic
1049468046 8:142762191-142762213 CAGTGTGGCTTGGTTGCTGGTGG + Intergenic
1049566345 8:143341119-143341141 GAGGGTGGCGGGGACGCTAGGGG - Intronic
1049600434 8:143505056-143505078 GAGGGAGGCAGGGTGACTAGTGG - Intronic
1049787779 8:144459305-144459327 GTGGGTGGCAGGAGGGCTGGTGG - Intronic
1049805544 8:144537177-144537199 GTGGGTGGGAAGGGTGCTGGTGG + Intronic
1051424450 9:16919509-16919531 CTTGGTGGCTGGGTTGCTGGGGG - Intergenic
1051644678 9:19256003-19256025 CAGGGTGGGAGGATTGCTTGAGG + Intronic
1052030451 9:23622271-23622293 GAGGGTGGAAGAGTGGGTGGTGG + Intergenic
1052049028 9:23824627-23824649 GAGGGCGGAAGGGGTGGTGGTGG - Intronic
1052269791 9:26615555-26615577 GGGGGTAGAGGGGTTGCTGGGGG + Intergenic
1052589209 9:30469306-30469328 GAGGGTGGAAGGGTGGCAAGAGG + Intergenic
1052835786 9:33248929-33248951 GAGGGTGGCAGGATTGCTTCAGG + Intronic
1053173436 9:35906608-35906630 GAGCGTGGCGGGGATGGTGGCGG - Exonic
1054971273 9:71090479-71090501 GAGGGTGACCAGGTTGGTGGTGG - Intronic
1055161732 9:73137806-73137828 GGAGGTGGTAGGGTTGTTGGGGG - Intergenic
1055773917 9:79747674-79747696 GAGGGTGGCAGGACCTCTGGAGG - Intergenic
1056167865 9:83956392-83956414 GAGGGTGGCAGAGCTGCTGCTGG - Exonic
1056596698 9:88013655-88013677 GATGGTGGCAGGGAGGGTGGGGG - Intergenic
1056617046 9:88177779-88177801 GAGGCTGTGAGTGTTGCTGGAGG + Intergenic
1056960407 9:91117747-91117769 GAGGATGGCAGGATGGCTGCTGG - Intergenic
1057052235 9:91934455-91934477 GTGGGTGGGTGGGTTGCTGGGGG - Intronic
1057514087 9:95706002-95706024 GATGGTGACAGTGGTGCTGGTGG - Intergenic
1057831276 9:98409136-98409158 GAGGGAGGCAGGGTTGTGGCTGG + Intronic
1057971926 9:99566964-99566986 CAGTGTGGCAGTGTTGGTGGGGG + Intergenic
1059395440 9:114031495-114031517 GTGGGTGCCAGGGTTGCGGATGG - Intronic
1059538778 9:115110406-115110428 GGGGAAGGCTGGGTTGCTGGGGG + Intronic
1059658025 9:116374145-116374167 GATGGTGGTAGTGTTGGTGGTGG + Intronic
1060024826 9:120162173-120162195 CAGGGTGCCAGGGCTGCTGTGGG - Intergenic
1060795918 9:126513278-126513300 GAGTGAGGAAGGGTTTCTGGAGG + Intergenic
1060811898 9:126614855-126614877 GCGGGTGGCAGGGGTGATGGAGG + Intronic
1061111758 9:128577378-128577400 GAGGGTGGGACTGTTGCAGGCGG - Exonic
1061219015 9:129238093-129238115 CAGGGTGGCAGGCCTGCCGGGGG - Intergenic
1061275558 9:129568029-129568051 GAGGGTGGCAGGCTGGCTCTGGG + Intergenic
1061295655 9:129675491-129675513 GAGGGTAGCAGGGGGGCAGGAGG - Intronic
1061634995 9:131902057-131902079 GAGGATTGCTGGGTGGCTGGAGG - Intronic
1061924498 9:133799305-133799327 GAGGGTGTCAGGGCCTCTGGCGG - Intronic
1062269663 9:135702666-135702688 GGGAGTGGCAGGGAGGCTGGGGG + Intronic
1062318032 9:135977907-135977929 GAGTGTCCCAGGGCTGCTGGGGG - Intergenic
1062318045 9:135977943-135977965 GAGTGTCCCAGGGCTGCTGGGGG - Intergenic
1062484620 9:136769185-136769207 GGGGGTGGCAGGGTGGCGGGGGG - Intergenic
1062484719 9:136769400-136769422 GGGGGTGGCGGGGTGGCGGGGGG - Intergenic
1062484736 9:136769434-136769456 GGGGGTGGCGGGGTGGCGGGGGG - Intergenic
1062484767 9:136769501-136769523 GGGGGTGGCGGGGTGGCGGGGGG - Intergenic
1062484798 9:136769568-136769590 GGGGGTGGCGGGGTGGCGGGGGG - Intergenic
1062498185 9:136841415-136841437 GCGGGGGGCAGGGCTGCAGGCGG - Intronic
1062506950 9:136882445-136882467 GAGGGTGCCAGTGTCCCTGGAGG - Intronic
1062612088 9:137379964-137379986 GAGGCTGGCAGGGGTGCAGTGGG - Intronic
1062686624 9:137817002-137817024 GAGGGTGGCAGGGGAGGTGGCGG - Intronic
1202788798 9_KI270719v1_random:63323-63345 GGGGGTGGCAGGGGGGTTGGGGG + Intergenic
1203759023 EBV:2387-2409 TTTGGTGGCAGGGCTGCTGGTGG + Intergenic
1203779906 EBV:95562-95584 GAGGGTGGGGGGGCTGTTGGAGG + Intergenic
1203365772 Un_KI270442v1:254434-254456 CAAGGTGGCAGTGTGGCTGGGGG + Intergenic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1185642463 X:1596442-1596464 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642478 X:1596489-1596511 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642492 X:1596536-1596558 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642507 X:1596583-1596605 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642522 X:1596630-1596652 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642537 X:1596677-1596699 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1186750213 X:12614058-12614080 TGAGGTGGGAGGGTTGCTGGAGG + Intronic
1186981853 X:14965510-14965532 CAAGGTGGGAGGATTGCTGGAGG - Intergenic
1187595672 X:20769969-20769991 CAAGGTGGGAGGATTGCTGGAGG + Intergenic
1187871300 X:23767126-23767148 GAGGGGGCCAGGGTGGCAGGGGG + Intergenic
1188208360 X:27387976-27387998 GGTGGTGGCAGTGTTGGTGGTGG - Intergenic
1188303201 X:28530637-28530659 GGGGGTGGCTGGATGGCTGGGGG - Intergenic
1189320007 X:40082229-40082251 GAGGGGGCCAGGGTTGGGGGTGG - Intronic
1189642877 X:43092923-43092945 GAGGGTGGGAGGATTGCTTGAGG - Intergenic
1190133054 X:47768742-47768764 GAGGGGGGCAGGGTGACTGGAGG - Intergenic
1190472283 X:50794587-50794609 GAGGGTGGTTGGGTAGTTGGAGG - Intronic
1190474612 X:50814077-50814099 GATGGTGGCGGAGCTGCTGGGGG - Intronic
1190993675 X:55582239-55582261 GAGGGTGGAAGTGTTGAAGGAGG + Intergenic
1191150136 X:57211702-57211724 CAGGGTGGCATGGTTGATGGTGG - Intergenic
1191227049 X:58054635-58054657 GAGGGTGGGAAGGTTGCATGGGG - Intergenic
1191273464 X:58510777-58510799 GAAGGTGGCAGAGAGGCTGGTGG + Intergenic
1191904716 X:66076262-66076284 GAGGATGGGAGGATTGGTGGAGG - Intergenic
1192176251 X:68887374-68887396 GAGGGAGGCAGGGTTAAGGGAGG - Intergenic
1193295883 X:79830481-79830503 GGAGGTGGCTGGGTGGCTGGAGG + Intergenic
1195043500 X:101035113-101035135 GAAGGTGGCAGAATTGCTTGAGG + Intronic
1195886583 X:109645072-109645094 CAAGGTGGCAGGGAGGCTGGGGG + Intronic
1195983661 X:110606243-110606265 CAAGGTGGCAGGGAGGCTGGGGG + Intergenic
1196189802 X:112782414-112782436 CAGGCTGGCAGGGGTGATGGTGG + Intronic
1196198552 X:112860188-112860210 GAGGGAGGGAGGGCTGATGGTGG - Intergenic
1196232590 X:113240898-113240920 GAGGGTGGAAAGGTTGCTTGGGG + Intergenic
1196703965 X:118700429-118700451 CAAGGTGGAAGGATTGCTGGAGG + Intergenic
1196861676 X:120034505-120034527 GAGGGTGGCACAGAAGCTGGTGG + Intergenic
1197173725 X:123462601-123462623 GAAGGTGGGAGGATTGCTTGAGG + Intronic
1197417329 X:126190815-126190837 CAGGGTGGCAGCGAGGCTGGGGG - Intergenic
1198010972 X:132553974-132553996 GAGGGTGGGAGGGTGGCTGGAGG - Intergenic
1199490686 X:148397212-148397234 CAAGGTGGGAGGATTGCTGGAGG - Intergenic
1199740325 X:150729606-150729628 CAGGGTGGCAGGGTGGTGGGTGG - Intronic
1200002061 X:153067218-153067240 GAGAGTGGCAGGCTGGCGGGAGG + Intergenic
1200005672 X:153082807-153082829 GAGAGTGGCAGGCTGGCGGGAGG - Intergenic
1200086129 X:153606834-153606856 GAAGATGGCAGAGATGCTGGTGG + Intergenic
1200103390 X:153699658-153699680 GATGCTGGCAGGGTAGCTGACGG - Intergenic
1200127976 X:153825982-153826004 GAGGCGGGCAGGATTGCTTGAGG + Intronic
1200910994 Y:8531287-8531309 GAGGGTGGCATGATTCCTGTAGG + Intergenic
1201527538 Y:14953171-14953193 CAAGGTGGCAGCGATGCTGGGGG + Intergenic
1201904494 Y:19076087-19076109 GCGAAAGGCAGGGTTGCTGGAGG - Intergenic
1201904501 Y:19076113-19076135 GCGAAAGGCAGGGTTGCTGGGGG - Intergenic