ID: 906278169

View in Genome Browser
Species Human (GRCh38)
Location 1:44533821-44533843
Sequence CAGAATGAGCAAAAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1031
Summary {0: 1, 1: 2, 2: 9, 3: 122, 4: 897}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906278169 Original CRISPR CAGAATGAGCAAAAGCAGAG AGG Intronic
900037084 1:423261-423283 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900058714 1:659002-659024 CAGCATGAGCAAATGCAAGGAGG + Intergenic
901126456 1:6932210-6932232 CAGACTGACAGAAAGCAGAGTGG - Intronic
902302277 1:15510682-15510704 CGGCATGAGCAAAGGCAGGGAGG + Intronic
902393567 1:16119980-16120002 CAGAATGGGCAAAGGCACAGAGG + Intergenic
902679508 1:18033178-18033200 CAGAATGAGCAAAGGCTAAGAGG - Intergenic
902965170 1:19995849-19995871 GAGGGTGAGCAAAAGCAGGGTGG - Intergenic
903101795 1:21036108-21036130 CAGGACGACCAAAGGCAGAGAGG + Intronic
903249950 1:22045630-22045652 CAGCATGAGCAGTGGCAGAGAGG + Intergenic
904490897 1:30858433-30858455 CAGCATGGGCAAAGGTAGAGAGG - Intergenic
904584433 1:31572102-31572124 CAGCATGAGCAAAAGCCCTGAGG - Intergenic
904614785 1:31743852-31743874 AAGAATCAGCAAATGCAGGGAGG + Intronic
904814186 1:33182739-33182761 CAGCCTGTGCAAAAGCATAGAGG + Intergenic
905267580 1:36765276-36765298 CACAGTGAGGAGAAGCAGAGGGG - Intergenic
905490646 1:38340872-38340894 CAGAATGAGCACCAGGAAAGAGG + Intergenic
905575733 1:39043177-39043199 CAGTATGAGCAAAAGCATGGAGG + Intergenic
905872119 1:41410716-41410738 CAGTGTGAGCAAAGGCACAGAGG + Intergenic
905879726 1:41455710-41455732 CAGCATCAGCAAAGGCACAGTGG - Intergenic
906278169 1:44533821-44533843 CAGAATGAGCAAAAGCAGAGAGG + Intronic
906468945 1:46110817-46110839 CAAAATGAAAAAAAGCGGAGGGG + Intronic
906856282 1:49308723-49308745 CAGAATGAGAAAAGGCAGGGTGG + Intronic
907074413 1:51565367-51565389 CAGCAGGAGCAAAGGCACAGTGG - Intergenic
907310262 1:53535016-53535038 AAGCATGAACAAAAGCAGGGAGG + Intronic
907356567 1:53879874-53879896 GAGAATGAAGAAAAGCAGGGTGG + Intronic
907386297 1:54127725-54127747 CAGCATGTGCAAATGCAAAGAGG - Intergenic
907519480 1:55013867-55013889 CAGCATGAGCCAAGGCAGGGTGG - Intergenic
907561779 1:55397608-55397630 CATCATGAGAAAAAGCATAGAGG - Intergenic
907770604 1:57459787-57459809 AAGAATGAGAAAGAGGAGAGAGG - Intronic
908611489 1:65865676-65865698 GAGGAAGAGCAGAAGCAGAGTGG - Intronic
908888431 1:68816682-68816704 GAGAATGAGAAAAATCAGTGAGG + Intergenic
909374393 1:74923686-74923708 CAGAATGAAGAAAAGCAGGGTGG + Intergenic
909493209 1:76248105-76248127 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
909658202 1:78054094-78054116 CAGCATGAGAAAAAGCACAATGG - Intronic
909899348 1:81113012-81113034 CATAATGAACAAAGGAAGAGTGG + Intergenic
910038715 1:82821256-82821278 CAAAAAGAGCAAAATCAGACTGG - Intergenic
910253301 1:85220794-85220816 CAGCATGAACAAAGGCAGAGAGG + Intergenic
911136753 1:94448863-94448885 CAGCAGTTGCAAAAGCAGAGGGG + Intronic
911196549 1:95000837-95000859 CAGAAAGAGAAGAAGAAGAGAGG + Intronic
911285466 1:95986713-95986735 CAACATGAGCAAAGGCACAGGGG + Intergenic
912031100 1:105245197-105245219 CTGAATGTTCAAAGGCAGAGAGG + Intergenic
912116565 1:106414497-106414519 CATAATGAACAAAAACAGTGAGG - Intergenic
912372831 1:109187043-109187065 CAGACTGAGCAGAACCAGTGCGG - Intronic
912748041 1:112262234-112262256 CAGAGTAAGCAAAGGCATAGAGG + Intergenic
912883183 1:113439366-113439388 CAGTATGTGCAAAGGCACAGAGG - Intronic
913212923 1:116596383-116596405 CAGGGAGAGCAAAAGAAGAGAGG + Intronic
913550695 1:119914757-119914779 CAGAATGATCAAAAGCACAAAGG + Exonic
913607359 1:120478307-120478329 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
913966216 1:143379745-143379767 CAGAATGGGAAATAGGAGAGAGG + Intergenic
914209074 1:145561832-145561854 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
914267993 1:146054198-146054220 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
914369101 1:147006661-147006683 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
914406414 1:147378287-147378309 CAGAATGAGGAAAAACATATAGG - Intergenic
914450849 1:147790154-147790176 TAAAATGAAGAAAAGCAGAGAGG + Intergenic
914556432 1:148768058-148768080 GAGAATGGGCAAAAGGAGATAGG + Intergenic
914583835 1:149043527-149043549 GAGGATGAGCCAAAGCAGGGTGG - Intronic
914616402 1:149362172-149362194 GAGAATGGGCAAAAGGAGATAGG - Intergenic
914811136 1:151029100-151029122 GAGAATGGGAAAAAGCAGAAAGG - Intronic
915412573 1:155714071-155714093 TAGAATGAGCAGAAGTATAGAGG + Intronic
915512912 1:156396376-156396398 CAGCATGTGCAAAAGCTCAGTGG + Intergenic
915968594 1:160335083-160335105 CAGAAAGAAAAAAAGCAGAAAGG + Intronic
916305739 1:163329583-163329605 CAGAGGGAGCAAAAGCACAATGG + Intronic
916453162 1:164940793-164940815 AAGAAGGAGGAAAGGCAGAGGGG - Intergenic
916790157 1:168117870-168117892 TCAAATAAGCAAAAGCAGAGTGG - Intronic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
917305118 1:173616873-173616895 AAGAATGAAGAAAAGTAGAGTGG + Intronic
917690962 1:177468598-177468620 CAGAACGAACAAAAGTACAGAGG + Intergenic
918121399 1:181544242-181544264 CAGAATGAGCAAATCCATAAAGG + Intronic
918159948 1:181889229-181889251 GAGGGTGAGCAACAGCAGAGTGG + Intergenic
918184187 1:182112666-182112688 CAGGGTGAGCAAAACAAGAGAGG + Intergenic
918537143 1:185586549-185586571 GAGGGTGAGCCAAAGCAGAGTGG + Intergenic
918784701 1:188750489-188750511 AGGAATGAGCCAAAGCAGAGAGG - Intergenic
919519802 1:198573526-198573548 CAGCATGTGCAAAATCACAGAGG - Intergenic
919876918 1:201876064-201876086 CAGAAGGAGCAAATGTAGAAAGG - Exonic
920092946 1:203467073-203467095 CAGACTGGGCAAAGGCATAGAGG + Intergenic
920101499 1:203519801-203519823 CAGAAAGAGGAAAGGGAGAGAGG + Intergenic
920390298 1:205595973-205595995 CAGAATCTAGAAAAGCAGAGAGG + Intronic
920415467 1:205796462-205796484 CAAAATGGGCAAAACAAGAGAGG - Intronic
920436327 1:205949354-205949376 CAAAAGGAGAAAAGGCAGAGGGG - Intergenic
920593491 1:207245399-207245421 CAGAATCAGTACAAGCAAAGAGG - Intergenic
920612989 1:207459985-207460007 CAGAAATAGCAAAAGCAGAAGGG - Intronic
921257263 1:213353917-213353939 CAGCCTGAGCAAAGGCACAGAGG + Intergenic
921780056 1:219152214-219152236 ATGAATGAGCAAGAGGAGAGCGG + Intergenic
922050348 1:221983426-221983448 CAGCATGAGCAAAGGCATGGAGG - Intergenic
922444083 1:225681909-225681931 CAGAAGAAGCAAAAGCTAAGGGG + Intergenic
922464374 1:225836737-225836759 CAAACTCAGCAGAAGCAGAGAGG + Intronic
922568976 1:226621387-226621409 CAGAATAAGCAAATCCATAGAGG - Intergenic
923033669 1:230268986-230269008 AAGGAAAAGCAAAAGCAGAGTGG - Intronic
923220209 1:231886025-231886047 CAGAAGGTGGAAAGGCAGAGAGG + Intronic
923305928 1:232688083-232688105 AATAATGAGCAAAGGCACAGAGG - Intergenic
923370325 1:233304644-233304666 GAGAAAAAGAAAAAGCAGAGTGG + Intergenic
923872156 1:238007275-238007297 CATAAGTAGCAAAACCAGAGTGG + Intergenic
924474055 1:244367835-244367857 CAGAAAGAGCAAACGCTGTGGGG + Intronic
924629442 1:245723550-245723572 GAGAGTGAGGAAAAGCAGGGTGG + Intergenic
924819300 1:247473159-247473181 AAGAATGACCAAAAAAAGAGGGG + Intergenic
924894120 1:248317260-248317282 GAGAGTGAGCAGAAGCAGAGTGG - Intergenic
1063013238 10:2047565-2047587 CAGAAAGAGAAAAACCAGAGAGG + Intergenic
1063782492 10:9341933-9341955 GAAAAAGAGGAAAAGCAGAGTGG - Intergenic
1064102136 10:12472988-12473010 CAGGATGAGCAGAAACACAGAGG + Intronic
1064193329 10:13226046-13226068 AAGGATGAGCAAATGCATAGAGG - Intronic
1065196363 10:23270223-23270245 GAGAATGAAGAAAAGCAGGGTGG + Intronic
1065781180 10:29169240-29169262 CAGAAAGAGCAAAAGGCCAGAGG - Intergenic
1065794897 10:29297558-29297580 CAGTATGAGACAAAGCAGAATGG - Intronic
1065890805 10:30119476-30119498 CAGATGAAGGAAAAGCAGAGAGG - Intergenic
1066379285 10:34887658-34887680 CAGAAATAGCAAAAGCAGGCAGG - Intergenic
1067251933 10:44593984-44594006 GACAGTGAGCAGAAGCAGAGTGG + Intergenic
1067461980 10:46465077-46465099 CAGCATGTGCAAAGGCACAGAGG + Intronic
1067521607 10:47011744-47011766 CAGGAAGAGCTAAAGGAGAGAGG - Intergenic
1067625215 10:47919521-47919543 CAGCATGTGCAAAGGCACAGAGG - Intergenic
1067775305 10:49160462-49160484 CATAAGGATAAAAAGCAGAGGGG + Intronic
1067923130 10:50480484-50480506 GAGAGTGAGGAAAAGCAGGGTGG + Intronic
1068055579 10:52009074-52009096 CTGAATGGGCAAAAGCTGAAAGG + Intronic
1068113376 10:52708040-52708062 CAAAATTACCAAAAGCACAGAGG - Intergenic
1068134076 10:52933943-52933965 CATAATAAGCAAAAAAAGAGTGG + Intergenic
1068302396 10:55161247-55161269 AAGAATGAGAATAAGCAAAGAGG + Intronic
1068381250 10:56255810-56255832 GAGAGTGAGAAAAAGCAGGGTGG - Intergenic
1068575076 10:58675980-58676002 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1068601872 10:58965253-58965275 CAGAATGTGCAAAGGCTCAGTGG - Intergenic
1068903061 10:62291624-62291646 CACCATGAGCAAAATCAGATGGG + Intergenic
1069351052 10:67527950-67527972 CAGAATGAGCAGGAGCATTGTGG - Intronic
1069759589 10:70799414-70799436 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1070064646 10:73021661-73021683 GAGAATGAGCCAAAGCAGGGCGG + Intronic
1070816660 10:79328681-79328703 CAGAAGGAGCAAGTGCAAAGAGG + Intergenic
1071759702 10:88587371-88587393 TAAAATCAACAAAAGCAGAGAGG + Exonic
1071807365 10:89138447-89138469 CAGCCTGAGCACAAGCACAGAGG + Intergenic
1071884768 10:89937487-89937509 GAGTGTGAGCCAAAGCAGAGCGG - Intergenic
1072287247 10:93927842-93927864 GAGCATGAGCCAAAGCAGGGTGG + Intronic
1072394356 10:95023472-95023494 GAGAGTGAGCTGAAGCAGAGTGG - Intergenic
1072394770 10:95027076-95027098 GAGAGTGAGCCAAAGCAGGGTGG - Intergenic
1072827251 10:98619673-98619695 CATTATGAGCAAAGGCACAGAGG - Intronic
1072953664 10:99870273-99870295 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1073534685 10:104266293-104266315 CTGAATGAGAACAAGCAGACAGG + Intronic
1073659166 10:105453608-105453630 AAGGATGAGCAAGACCAGAGTGG - Intergenic
1073817324 10:107222401-107222423 CAGCATGATTAAAGGCAGAGAGG - Intergenic
1074050600 10:109877874-109877896 CAGAAAGACAGAAAGCAGAGTGG + Intronic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1074769273 10:116722989-116723011 CAGCAAGGGCAAAAGCAGAGCGG + Intronic
1074809728 10:117091690-117091712 CAGCATGAGCAAATGCATACTGG - Intronic
1075122326 10:119673087-119673109 CAGCATGGGCAAAGGCACAGGGG - Intronic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075862064 10:125685401-125685423 CAAAAAGAGCCAAAGCATAGGGG - Intergenic
1076496292 10:130899821-130899843 CAGCATTGGCAAGAGCAGAGAGG + Intergenic
1076963810 11:61183-61205 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1077378077 11:2214961-2214983 GAGGATGAGCAGAGGCAGAGTGG - Intergenic
1077995314 11:7447449-7447471 CAGCATGAGCAAAAGCAAAGTGG - Intronic
1078130697 11:8611879-8611901 AAGAAGAAGAAAAAGCAGAGAGG + Intergenic
1078162945 11:8857634-8857656 CAGCATGAGCAAAGGCCCAGAGG - Intronic
1078361914 11:10675681-10675703 CAGGATGTGCAAAAGCACTGAGG - Intronic
1078501646 11:11885378-11885400 AAGAATGAAGAAAAGCAGGGTGG + Intronic
1078881387 11:15452427-15452449 CAAAATGTGCCAAAGCATAGTGG + Intergenic
1079017721 11:16883593-16883615 CAGAAGGAGCCAAAGCCCAGAGG - Intronic
1079131741 11:17750696-17750718 CGGAATAAGCAAAGGCAGAAGGG - Intronic
1079163995 11:18020447-18020469 TAGCATGAGCAAAAGTATAGAGG - Exonic
1079580458 11:22056476-22056498 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
1079706222 11:23622719-23622741 AAGAGAGAGCAAAAGCAGAGAGG + Intergenic
1080031417 11:27665443-27665465 GAGCATGAGCCAAAGCAGGGTGG + Intronic
1080060511 11:27951679-27951701 CAAAAGGAGCAAAAACAAAGTGG - Intergenic
1080350189 11:31375564-31375586 AATAATTAACAAAAGCAGAGAGG + Intronic
1080397039 11:31899612-31899634 GAGAATAAGCCAAAGAAGAGTGG - Intronic
1080693553 11:34580835-34580857 CAGCATGAGCAAAGGCTCAGGGG + Intergenic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081488717 11:43550416-43550438 CTGCATGAGCAAAGGCAGAGAGG + Intergenic
1081591775 11:44428051-44428073 AAGGTTGAGCAAAAGCACAGAGG - Intergenic
1081996959 11:47371911-47371933 CAGAAAATGCAAAAGCAGAAAGG - Intronic
1082124684 11:48418153-48418175 AAGAATGGGGAAAAGCAGAGTGG + Intergenic
1082251378 11:49984622-49984644 AAGAATGGGGAAAAGCAGAGTGG - Intergenic
1082558341 11:54589393-54589415 AAGAATGGGGAAAAGCAGAGTGG + Intergenic
1082679213 11:56148078-56148100 CAGACAAAGCAAAAGCAGACAGG - Intergenic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1083277578 11:61605896-61605918 CAGCTTAAGCAAAAGCACAGAGG - Intergenic
1083642933 11:64155211-64155233 CAGTATGTGCAAAAGCCCAGAGG + Intronic
1083991490 11:66248704-66248726 CAGAATGACCAAACGTAGTGTGG - Intergenic
1084020282 11:66413296-66413318 CAGCATGTGCAAAAGCACTGTGG + Intergenic
1084370200 11:68736744-68736766 CAGAAGGAGGAAAAGGAGAGAGG + Intronic
1084454601 11:69261188-69261210 CATAATCAGCAAAAGTGGAGGGG - Intergenic
1084842013 11:71861391-71861413 CATATAGAGCAAAAGAAGAGAGG - Intergenic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085104618 11:73831406-73831428 GAGCATGTGCAAAGGCAGAGAGG - Intronic
1085341609 11:75735054-75735076 CTGAGTGAGCAAACACAGAGGGG + Intergenic
1085352842 11:75811280-75811302 CAGCATGAGCAAAGGCACAGGGG - Intergenic
1085450711 11:76630416-76630438 CAGGAACAGCAAATGCAGAGAGG - Intergenic
1085704323 11:78772413-78772435 AAGACTGAGCAGCAGCAGAGAGG - Intronic
1085717148 11:78882358-78882380 CAGCATGGGCAAAAGCATGGTGG - Intronic
1085884369 11:80505397-80505419 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
1086151318 11:83613976-83613998 TACAATGAGATAAAGCAGAGAGG + Intronic
1087235358 11:95712068-95712090 CAGAATGAGCCCAAGCAAAATGG + Intergenic
1088212539 11:107472709-107472731 CAGAATGACCAAACGGACAGAGG + Intergenic
1088218828 11:107544961-107544983 AAGAATGAGAGAAAGGAGAGAGG + Intronic
1088532507 11:110826291-110826313 CAGAATGAGCAATATCACAAAGG - Intergenic
1088704230 11:112447575-112447597 CAGGAAGAGCAGTAGCAGAGTGG - Intergenic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090321049 11:125844258-125844280 GAGAGTGAGCAAAAGCAGGGTGG + Intergenic
1090534081 11:127621317-127621339 CAGTATGAGAGAAAGCAGAGAGG - Intergenic
1091116174 11:133015812-133015834 CAGCAGGAGCAAGGGCAGAGTGG - Intronic
1091960596 12:4690929-4690951 CAGCATGAGCAATTGCAGTGGGG + Exonic
1092064601 12:5579466-5579488 CAGTGTGAGCAAAAGCATGGTGG + Intronic
1092724112 12:11468092-11468114 CAGCATGTGCAAAGGCACAGTGG - Intronic
1092880824 12:12886607-12886629 CAGAATGCACAGAAGCACAGAGG - Intergenic
1093028710 12:14268433-14268455 CAAAAAAAGCAAAAGCAGAGAGG - Intergenic
1093351646 12:18109673-18109695 TAGCAAGAGAAAAAGCAGAGGGG + Intronic
1093608165 12:21119737-21119759 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1093662718 12:21775201-21775223 CGGACTGAATAAAAGCAGAGAGG + Intronic
1094070065 12:26403163-26403185 CAGGATGAGCAAAGGCAAACAGG + Intronic
1094306955 12:29031088-29031110 CAGAATGAACAAAAGCATAGAGG + Intergenic
1094695091 12:32809861-32809883 GAGAATAAAGAAAAGCAGAGTGG - Intronic
1094752069 12:33421884-33421906 CAGCATGAACAAAAGCACAGAGG + Intronic
1095595218 12:43950995-43951017 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1095598271 12:43984047-43984069 CAGAATGGTCAGAACCAGAGGGG + Intronic
1095660893 12:44734543-44734565 CAAAATAAGTAAAAGCAGGGGGG - Intronic
1095703557 12:45215606-45215628 GAGAATAAGCAAAAGAAGAAGGG - Intergenic
1096044944 12:48554166-48554188 GAGCATGAGCCAAAGCAGGGTGG - Intergenic
1096283296 12:50275702-50275724 CTGCATGAGCAAAGGCACAGAGG + Intronic
1096320444 12:50607651-50607673 TATAATCAGCAAAAGCAGAGTGG + Intronic
1096323233 12:50634058-50634080 CAGAATGAGCAAGAGATGGGAGG - Intronic
1096465547 12:51846392-51846414 CAGCGGGAGCAAAGGCAGAGAGG + Intergenic
1096750025 12:53752590-53752612 CAGATTGAGGAAAGGCAGAAGGG - Intergenic
1097197962 12:57254725-57254747 CAGAAGGAGCAAGGGCAGGGTGG - Exonic
1097654516 12:62343692-62343714 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1098579103 12:72077853-72077875 CAGAATGAGCACTAGCAGGAAGG - Intronic
1098631425 12:72727197-72727219 CAGTATTAACAAAAACAGAGGGG + Intergenic
1098638553 12:72813533-72813555 GAGCATGAGCCAAAGCAGGGCGG - Intergenic
1098906726 12:76170147-76170169 GAGGATGAGCCAAAGTAGAGTGG - Intergenic
1099806853 12:87531128-87531150 GAGCATGAGCCAAAGCAGGGTGG + Intergenic
1099858423 12:88200436-88200458 CAGAAAGAGAAAAAGAAGAGTGG - Intergenic
1100089630 12:90954375-90954397 GAGCAGCAGCAAAAGCAGAGAGG + Exonic
1100114999 12:91293996-91294018 GAGAGTGAGAAAAAGCAGGGTGG + Intergenic
1100450636 12:94702425-94702447 GGGAATGAGCAAAAGGAGAGGGG - Intergenic
1100492061 12:95090231-95090253 CAGCATGAGCAAAGGCAGAGAGG + Intronic
1100739962 12:97581235-97581257 GAGGGTGAGCAAAAGCAGGGTGG + Intergenic
1101454398 12:104815000-104815022 GAGAATGTGCAAAGGCAGAGAGG - Intronic
1101529398 12:105560322-105560344 CAGCATGAGCAAAAGCTCAGAGG - Intergenic
1102028862 12:109728575-109728597 CAGTCTGAGCAAAGGCACAGAGG - Intronic
1102204724 12:111082743-111082765 GAGCATGAGCAAAAGCTCAGAGG + Intronic
1102310328 12:111839916-111839938 CAGAAGGAGTAACAGCACAGGGG + Intergenic
1102624471 12:114223982-114224004 CAACGTAAGCAAAAGCAGAGAGG + Intergenic
1102821838 12:115915118-115915140 CAGCCTGAGCAAAGGCAGACAGG + Intergenic
1102826038 12:115948619-115948641 CAGGATGTGCAAAGGCCGAGAGG + Intergenic
1103203662 12:119110790-119110812 GAGCATGAGCCAAAGCAGGGCGG - Intronic
1103251442 12:119503313-119503335 CAGAATGACAAAGAGTAGAGGGG + Intronic
1103256204 12:119543578-119543600 CAGCATGTGCAAAGGCCGAGAGG + Intergenic
1103301761 12:119933058-119933080 GAGAATGAGCAAAGATAGAGGGG + Intergenic
1103696621 12:122820901-122820923 CAGCATGAGTAAAAGCACAGAGG + Intronic
1104310454 12:127650126-127650148 CAGAATCAGCACATTCAGAGAGG - Intergenic
1105216165 13:18286982-18287004 CAGGGAGAGCAAAAGAAGAGAGG + Intergenic
1106199292 13:27523160-27523182 CTGAGTGTGCAAAAGCACAGAGG - Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106434200 13:29709238-29709260 CAGAATAAGCAAATCCATAGAGG - Intergenic
1106580892 13:31017310-31017332 CAGCATGTGCAAAAGCACAGAGG + Intergenic
1107240192 13:38223671-38223693 CTGAATCCACAAAAGCAGAGTGG - Intergenic
1107692060 13:42963110-42963132 CTGGATGAGGAAAAGAAGAGTGG + Intronic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1108156910 13:47594635-47594657 AAGCATGAACAAAAGCATAGAGG - Intergenic
1108379016 13:49839294-49839316 CAGCTTGAGCAAAGGCTGAGAGG - Intergenic
1108801436 13:54100982-54101004 CAGAATGAGGAAAAAAAGGGGGG - Intergenic
1108888238 13:55218608-55218630 CTCAATTAGCAAAAGCAGAGAGG + Intergenic
1110000259 13:70188725-70188747 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1110895697 13:80749586-80749608 CAGCATGAGCAGAACTAGAGTGG + Intergenic
1111057520 13:82971057-82971079 CAGAATGAGCAGTAGAAAAGGGG - Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1111641543 13:90976844-90976866 GAGAATGAAGAAAAGCAGGGTGG + Intergenic
1111654313 13:91132817-91132839 CAGAAAGAGGCAAAACAGAGGGG - Intergenic
1112165766 13:96918541-96918563 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1112235934 13:97636790-97636812 CTAAATGAGCCAAAACAGAGAGG + Intergenic
1112787285 13:102965006-102965028 CAGAATGAGCATGAGCTGGGAGG - Intergenic
1113069072 13:106401468-106401490 GAGGAAGAGCAAAGGCAGAGTGG + Intergenic
1113159207 13:107360593-107360615 CAGAATGTGAAAAAGCAGGTAGG - Intronic
1113221699 13:108111817-108111839 CACAATGAGGAAAGGCAGAATGG - Intergenic
1114850153 14:26373811-26373833 CAGAAGGAGCAAGAGAGGAGAGG - Intergenic
1114871239 14:26661117-26661139 GAGAATGAGAAAAATAAGAGGGG + Intergenic
1114931930 14:27482271-27482293 CAGTTTCAGCAAAAGCACAGAGG + Intergenic
1115514443 14:34171505-34171527 GAGACTGAGAAAAAGGAGAGAGG - Intronic
1115664227 14:35530185-35530207 CTGAATGAGGAAAAGAGGAGTGG + Intergenic
1115839723 14:37455563-37455585 CAGCATGAGCAAAAGTATACTGG - Intronic
1115912249 14:38269255-38269277 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1115954590 14:38764196-38764218 GAGTGTGAGCCAAAGCAGAGAGG + Intergenic
1116139430 14:40971733-40971755 CAGAATGAGCAAAAAGAGTAGGG - Intergenic
1116238252 14:42308984-42309006 CAGCAGTTGCAAAAGCAGAGGGG - Intergenic
1116576283 14:46580434-46580456 CAGAATCAGGAAATCCAGAGAGG + Intergenic
1116803848 14:49471796-49471818 CAGAAAGAAAAAAAGCAGGGTGG + Intergenic
1117082995 14:52170695-52170717 CAGCAGTTGCAAAAGCAGAGGGG + Intergenic
1117490750 14:56244592-56244614 GAGGATGAGCATTAGCAGAGTGG - Intronic
1117503211 14:56374663-56374685 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1117721196 14:58630450-58630472 CAGAACAATGAAAAGCAGAGGGG + Intergenic
1118209778 14:63754538-63754560 CAGAACTATCACAAGCAGAGGGG + Intergenic
1118330196 14:64808938-64808960 CAGAATGAGTCCAAGCAGACAGG + Intronic
1118363926 14:65078043-65078065 CAATATGAGAAAAAGCACAGGGG + Intronic
1118570251 14:67187749-67187771 CAGTCTGAGCAAAGGCACAGAGG - Intergenic
1118729033 14:68653857-68653879 CAGCATGTGCAAAGGCACAGGGG + Intronic
1119189535 14:72671078-72671100 CACAATGACCAAAGTCAGAGGGG + Exonic
1119459244 14:74785430-74785452 CTGAGTGAGCAAAAGCAGCAGGG - Intronic
1120018699 14:79503466-79503488 CAGCATGTGCAGAGGCAGAGAGG - Intronic
1120285981 14:82502380-82502402 CAGAATGACCAAAAGAAAACAGG + Intergenic
1120319972 14:82947043-82947065 CTAAATGTGCAACAGCAGAGTGG + Intergenic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1120799041 14:88669023-88669045 GAGAGTGAGGAAAAGCAGGGTGG + Intronic
1120970802 14:90205354-90205376 AAGTATGAGAAAAAGCAGGGAGG + Intergenic
1121602219 14:95213766-95213788 CAGGATGAGCAGAAGCAATGGGG - Intronic
1121662171 14:95643422-95643444 CAGATTGAACAAAAACACAGAGG + Intergenic
1121678520 14:95773784-95773806 CAGCAAGAGCAAACGCAGGGAGG - Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122245199 14:100397722-100397744 CAGAGTGTGCAAAGGCAGGGAGG + Intronic
1122521728 14:102348854-102348876 CAGAATCAGCAACAGCACTGAGG + Intronic
1123576718 15:21676792-21676814 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
1123613340 15:22119260-22119282 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
1123739423 15:23221878-23221900 CAGAGTGAGAAAAGGCAAAGAGG - Intergenic
1123960385 15:25392727-25392749 GAAAATGAGTAAAAGCACAGGGG + Intronic
1124142600 15:27089742-27089764 CAGAACGAACAAATGCACAGAGG - Intronic
1124290643 15:28450830-28450852 CAGAGTGAGAAAAGGCAAAGAGG - Intergenic
1124292593 15:28466716-28466738 CAGAGTGAGAAAAGGCAAAGAGG + Intergenic
1125179903 15:36870796-36870818 CAGAATGTGCAAAAGCTCTGAGG + Intergenic
1126104798 15:45140574-45140596 CAGAATGTGCAAAAGTTGAATGG - Intronic
1127012008 15:54641805-54641827 GAGAATGAGGAAAAGCAGACTGG + Intergenic
1127037819 15:54938406-54938428 CATATTGAGCAATAGCAGAGGGG - Intergenic
1127373640 15:58362743-58362765 GAGAGTGAGCCAAAGCAGGGTGG + Intronic
1128463366 15:67888276-67888298 CAGAATGAGCAAAAGCCTGGAGG + Intergenic
1128649741 15:69401772-69401794 AAGATTGAGCAGGAGCAGAGAGG - Intronic
1128699431 15:69793619-69793641 CAGAGTGAGCAAAGGCACAGAGG - Intergenic
1129173016 15:73819306-73819328 GAGAATGTGCTGAAGCAGAGTGG + Intergenic
1129330554 15:74824897-74824919 CAGCATGAGAAAAGGCAGGGAGG + Intronic
1129355221 15:74986356-74986378 CCGCATGAGCAAAAGCAAGGAGG + Intronic
1129605269 15:77021882-77021904 CAGGATGAGCAATAGGGGAGTGG - Intronic
1129679849 15:77652618-77652640 CAGCAGGAGCAACAGCTGAGAGG - Intronic
1129851895 15:78798256-78798278 CAGAGTGAGCAAAGGCCCAGCGG - Intronic
1129904944 15:79179905-79179927 GAGCATGAGCAAAAACACAGTGG - Intergenic
1130101487 15:80897753-80897775 TAAATTCAGCAAAAGCAGAGGGG + Intronic
1131118730 15:89809905-89809927 CAGAATGAGCAAAGTCACAGAGG - Intronic
1131225844 15:90623888-90623910 CAGCATGCGCAAAAGCAGGGAGG - Intronic
1131585583 15:93689549-93689571 CATAATGAACAAGAGGAGAGAGG + Intergenic
1131830302 15:96350621-96350643 CATTAAGAGTAAAAGCAGAGTGG - Intergenic
1132000322 15:98172934-98172956 GAGAAAGAGTAAAAACAGAGAGG - Intergenic
1132385281 15:101396019-101396041 CACAAGGAGGAAAAGCAGATGGG + Intronic
1132444743 15:101903990-101904012 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1202985586 15_KI270727v1_random:411037-411059 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
1134144920 16:11753138-11753160 CACCATGAGGAAAAGCAGAAAGG + Intronic
1134267082 16:12701721-12701743 TAGAATGGGTAAGAGCAGAGTGG + Intronic
1135316650 16:21452139-21452161 CAGAATTAATAAAAGCACAGAGG + Intergenic
1135369573 16:21884384-21884406 CAGAATTAATAAAAGCACAGAGG + Intergenic
1135442241 16:22486743-22486765 CAGAATTAATAAAAGCACAGAGG - Intronic
1136313317 16:29430839-29430861 CAGAATTAATAAAAGCACAGAGG + Intergenic
1136326760 16:29532605-29532627 CAGAATTAATAAAAGCACAGAGG + Intergenic
1136362730 16:29791158-29791180 CTGAATAAGCAAGAGAAGAGTGG + Intronic
1136369518 16:29827345-29827367 CAGAATGAGGCAAGGCAGTGAGG + Intronic
1136441451 16:30272589-30272611 CAGAATTAATAAAAGCACAGAGG + Intergenic
1136600603 16:31284690-31284712 GAGTATGAGCCAAAGCAGGGTGG - Intronic
1137700625 16:50495420-50495442 GAGAAGGAGCAGAAGCTGAGAGG - Intergenic
1138579285 16:57929645-57929667 AAGAAAGAGCAAATGCGGAGGGG + Intronic
1138799673 16:60012812-60012834 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1139061552 16:63259232-63259254 CTGAATGAGCAAAAGCTGAAAGG - Intergenic
1139295357 16:65895714-65895736 CAGGATGTGCAACAGCAGTGTGG - Intergenic
1139566450 16:67780262-67780284 CAGAATGTGAAAAGGCATAGAGG + Intronic
1139773546 16:69298424-69298446 CCAAAGGAGCAAAGGCAGAGAGG - Intronic
1139888244 16:70226330-70226352 CAGAATTAATAAAAGCACAGAGG + Intergenic
1140123521 16:72102765-72102787 CAGAGTGAGCAGAAGAGGAGTGG - Intronic
1140253158 16:73312573-73312595 ATGCATGAGCAAATGCAGAGGGG + Intergenic
1140533153 16:75684192-75684214 AAGAATCAGCTAAAGCAGAGGGG + Intronic
1140878519 16:79175895-79175917 CAGCATGACCAAAAGCTCAGAGG - Intronic
1140890542 16:79281053-79281075 CAGAAGGAAAAAGAGCAGAGAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1143301340 17:5912714-5912736 CAGCATGAGCGAAAACACAGAGG + Intronic
1143738197 17:8929442-8929464 GAGAATTACCAGAAGCAGAGAGG + Intronic
1144431671 17:15198334-15198356 GAGAATGAGGAAAAGCGGAGTGG + Intergenic
1144507355 17:15843854-15843876 TAGAATGAGCAAAGGCACAGAGG + Intergenic
1144562202 17:16330038-16330060 CAGAAGGAGCAAAAGCAGGAAGG + Intronic
1144665117 17:17097090-17097112 CAGGATCAGCCAAAGCAGAGGGG + Intronic
1145119251 17:20241874-20241896 TAGAATGAGCAAAGGCACAGAGG + Intronic
1145171480 17:20661459-20661481 TAGAATGAGCAAAGGCACAGAGG + Intergenic
1145201801 17:20952203-20952225 TGGAATGAGCAAAGGCACAGAGG + Intergenic
1146570457 17:33948223-33948245 CAGAATGAGGTAAAGCAGGCTGG - Intronic
1146651703 17:34611162-34611184 CAGCATGTGCAAAGGCACAGAGG + Intronic
1146718109 17:35103328-35103350 CAGGAGGAGGAGAAGCAGAGAGG + Intronic
1146938668 17:36828311-36828333 CAGCATAAGCAAAGGCACAGAGG + Intergenic
1147030613 17:37632053-37632075 GAGAATGAGCAAACACACAGAGG + Intronic
1147588720 17:41667540-41667562 CAGCCTGAGCAAAGGCACAGGGG + Intergenic
1147738713 17:42657838-42657860 CAGAAGGAAAAAAAGCAGATGGG + Intergenic
1148725247 17:49784572-49784594 CAGAATGTGCAATAGTAGAGAGG - Intronic
1148920460 17:51027142-51027164 CAGAATGAGGCTAAGCACAGTGG + Intronic
1149026953 17:52037776-52037798 CAGGATGACCAAAGGCACAGAGG - Intronic
1149225569 17:54465901-54465923 GAGAGTGAGCCAAAGCAGGGTGG - Intergenic
1149242266 17:54663773-54663795 CAGAGGGAGGAAAAGCAGTGTGG - Intergenic
1149512193 17:57252665-57252687 CAAAAAGAGCAGAAGCAGAAGGG + Intergenic
1149601968 17:57898990-57899012 CAGCAGGAGCACAGGCAGAGTGG + Intronic
1149864935 17:60146148-60146170 CAGAATGAGAAAAGGCATGGAGG - Intergenic
1149866416 17:60153690-60153712 GAGACTGAGCAAAGGCAGAGCGG + Intronic
1149902198 17:60490798-60490820 CAGAATGAGCCAAATGAAAGGGG - Intronic
1150355466 17:64480824-64480846 AAGGATGAGAAAAAGGAGAGTGG + Intronic
1151202595 17:72479588-72479610 TAGAATGAGTTCAAGCAGAGTGG - Intergenic
1151518197 17:74610874-74610896 CAGCATAAGTGAAAGCAGAGAGG - Exonic
1152843471 17:82585208-82585230 CAGAAAGTTCAAAAACAGAGTGG - Intronic
1155074451 18:22342382-22342404 CAGAGAGAGGAGAAGCAGAGAGG + Intergenic
1155117606 18:22784468-22784490 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
1155270464 18:24136935-24136957 CCTAATGAGCAAAAGCACAGAGG + Intergenic
1155316035 18:24570992-24571014 CAGCATGGCCAAAAGCAGAAGGG - Intergenic
1156202887 18:34854484-34854506 CAGAAAGAGCTAAAGAAGAAAGG + Intronic
1156434420 18:37111698-37111720 GAGTATGAGCCAAAGCAGGGTGG + Intronic
1156635270 18:39020321-39020343 CAGTAAGAGGAAAAGAAGAGAGG - Intergenic
1156979368 18:43266070-43266092 CAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1157556607 18:48616881-48616903 CAGTGTGAGCAAAAGCACAGAGG + Intronic
1158050857 18:53217512-53217534 CAGAGAGAGAAAAAGGAGAGAGG - Intronic
1158606321 18:58899429-58899451 CAGAAAGAGGAAATGCAGAGAGG - Intronic
1158654761 18:59320819-59320841 TAGAATGAGCAAAGGGAGTGTGG - Intergenic
1158840384 18:61379827-61379849 CAAGAGGAGGAAAAGCAGAGAGG + Intronic
1159701771 18:71638140-71638162 CAAAATGACCAAAAGCAATGTGG + Intergenic
1159707446 18:71708901-71708923 AAGAAAGAGCAAAAACAGAGAGG - Intergenic
1160640613 19:130814-130836 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1161839706 19:6672127-6672149 CAGAGTGAGCAAAAGCACGAGGG - Intergenic
1162306888 19:9880242-9880264 CAGCATGGGCAAAGGCAGGGAGG + Intronic
1163442956 19:17330745-17330767 CTGCAGGAGCAAAGGCAGAGAGG - Intronic
1163502360 19:17684179-17684201 CAGCATGAGCAAAAGCATGGTGG - Intronic
1163989799 19:20988043-20988065 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1164234960 19:23323740-23323762 AAGAATGAGAAAAAGAGGAGAGG - Intronic
1164821487 19:31254632-31254654 CAAAATGTGGGAAAGCAGAGAGG - Intergenic
1165708902 19:37995673-37995695 CAGAATGAACAAAAGCGGGTTGG + Intronic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1166840876 19:45696184-45696206 CAGAGTGAGCAAGAGGTGAGGGG - Intronic
1167674520 19:50876046-50876068 GAGAAGGAGAAACAGCAGAGAGG - Intronic
1168163634 19:54530846-54530868 CAGCATAAGTAATAGCAGAGGGG - Intergenic
1168704427 19:58461066-58461088 CCAAATGAGAAAAAGCAGAAAGG - Intergenic
1202699997 1_KI270712v1_random:157240-157262 CAGAATGGGAAATAGGAGAGAGG + Intergenic
1202709247 1_KI270714v1_random:8048-8070 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
925079207 2:1048844-1048866 AAGAATGAACAAAATCAAAGAGG - Intronic
925328942 2:3043442-3043464 AAGAAGGAGGAAAAGGAGAGCGG + Intergenic
925641030 2:5985957-5985979 CAGGATGAGCTGAAGAAGAGGGG - Intergenic
925657443 2:6165174-6165196 CAGAATGAGAAACTGCAGTGGGG - Intergenic
925901980 2:8515436-8515458 CAGAAAGAGAGACAGCAGAGAGG + Intergenic
926417043 2:12659847-12659869 CAGAATGAGCAGAAACAGGTTGG - Intergenic
926706853 2:15843278-15843300 CAGAGGGAGCACAGGCAGAGAGG + Intergenic
926885102 2:17589933-17589955 CAGGAAGAGCGAAAGCAGGGAGG - Intronic
927117068 2:19916093-19916115 GAGGATGAGCCAAAGCAGGGTGG + Intronic
927412101 2:22838422-22838444 CAGAGAGAGAAAAAGAAGAGAGG + Intergenic
928062867 2:28132574-28132596 CAGCTTTAGCAAAAGCACAGAGG - Intronic
928883558 2:36123306-36123328 GAGAGTGAAGAAAAGCAGAGTGG - Intergenic
929868549 2:45738397-45738419 AGGCATGAGCAAAGGCAGAGAGG - Intronic
929875893 2:45796061-45796083 CAGCATGAGCAAAGGCACAGAGG - Intronic
929876498 2:45801053-45801075 CAGCATAAGTGAAAGCAGAGAGG + Intronic
930106955 2:47647836-47647858 CAGCATGAGCAAAGGCATAGAGG + Intergenic
930343112 2:50142834-50142856 CAGACTGAGCAAAAGCAAGAAGG + Intronic
930542837 2:52729053-52729075 CAGAAAGAACAAAAGCAGATTGG - Intergenic
930692770 2:54381252-54381274 CAGCATGAACAAAGGCATAGAGG - Intronic
931115935 2:59166861-59166883 CACAATGACCAAAAACACAGAGG + Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
931560344 2:63554834-63554856 GAGACTGAGGAAAAGCAGGGTGG + Intronic
932482790 2:72057630-72057652 CTGAATGGGCAAAAGCTGGGAGG - Intergenic
932702554 2:74001706-74001728 CAGGATGAGAAAGAACAGAGAGG - Intronic
932809789 2:74815199-74815221 CAGAATCTGCAAATACAGAGGGG - Intergenic
933051965 2:77611801-77611823 GAGAATGAGGAAAAGCAAATTGG + Intergenic
933168377 2:79098441-79098463 TAGAATGAGGAAAAAGAGAGAGG + Intergenic
933436633 2:82257647-82257669 GAGAATAAGGAAAAGCAGGGTGG - Intergenic
934170929 2:89540715-89540737 CAGAATGGGAAATAGGAGAGAGG + Intergenic
934281234 2:91615033-91615055 CAGAATGGGAAATAGGAGAGAGG + Intergenic
934298162 2:91759743-91759765 CAGGGAGAGCAAAAGAAGAGAGG - Intergenic
934548570 2:95240301-95240323 AAGAATGAAGAAAAGCAGGGTGG + Intronic
934780720 2:96968222-96968244 GGGAATGAGCAGGAGCAGAGGGG - Intronic
935532158 2:104247672-104247694 CAGGATGAGCAAAGGGAAAGAGG + Intergenic
935556378 2:104513752-104513774 GAGAGTGAGCAAGAGCAGGGAGG - Intergenic
935817687 2:106862229-106862251 TAAAATGAGCAAAAGCACACTGG - Intronic
936141908 2:109948021-109948043 GAGAAAGACCGAAAGCAGAGGGG - Intergenic
936178596 2:110245969-110245991 GAGAAAGACCGAAAGCAGAGGGG - Intergenic
936202782 2:110423463-110423485 GAGAAAGACCGAAAGCAGAGGGG + Intronic
936504225 2:113092253-113092275 AAGAACGCGCACAAGCAGAGAGG + Intergenic
936738609 2:115476287-115476309 CAGAATGAGGGAAAGTGGAGAGG - Intronic
936750516 2:115635482-115635504 GAGAGTAAGGAAAAGCAGAGTGG - Intronic
936769610 2:115895377-115895399 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
936798577 2:116237741-116237763 CAGAATACGCACAGGCAGAGCGG - Intergenic
936811142 2:116403900-116403922 CACAGTGAGCTAAAACAGAGTGG - Intergenic
937040531 2:118817247-118817269 CAGCATGTGCAAAGGCAGGGAGG - Intergenic
937486867 2:122324456-122324478 CAGTATGAACCAAAGCAGAGGGG - Intergenic
937562644 2:123244619-123244641 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
937679235 2:124626420-124626442 GAGAATGAGAAGAAGCAGAGTGG + Intronic
937790446 2:125955144-125955166 CAGCATTTGCAAAAGCAAAGAGG - Intergenic
938923008 2:136012425-136012447 AAGCACGAGCAAAGGCAGAGAGG - Intergenic
939026496 2:137020226-137020248 TAGCTTGAGCAAAAGCAGAGGGG + Intronic
939179111 2:138783365-138783387 CAGAATGAGCAAAGGCAGAGTGG + Intergenic
939198749 2:139007116-139007138 CAGTAAAAGCAAAAGCAGACTGG + Intergenic
939364883 2:141218936-141218958 CAGAGTGAGGAAAAGCAGGGTGG + Intronic
939398284 2:141660175-141660197 GAGAGTGAGGAAAAGCAGGGTGG + Intronic
939976346 2:148720775-148720797 GGGAATGAGGAAAAGCAGGGTGG - Intronic
940030639 2:149257941-149257963 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
940333500 2:152500980-152501002 CAGTATGGGCTAAAGCCGAGTGG - Intronic
940647353 2:156405533-156405555 CAGAATTAGCAAAAGAAGTGGGG - Intergenic
940940970 2:159560225-159560247 CAAAGTGAGAAAAAGCAGATAGG - Intronic
940992081 2:160107685-160107707 CAGAACGATCAAAAGCCAAGTGG - Exonic
941713452 2:168739338-168739360 CACCATGAGCAAAAGCGGAGAGG + Intronic
941734098 2:168953902-168953924 CAGGACAAGCCAAAGCAGAGAGG - Intronic
942044028 2:172088639-172088661 CAGACAGAGCAAAAGGAGACAGG - Exonic
942408850 2:175685351-175685373 CAGCATGAGCAAAGGAAGAAAGG - Intergenic
942779883 2:179629688-179629710 GAGGATGAGCCAAAGCAGGGTGG + Intronic
942856430 2:180555285-180555307 GAGAGTGAGGAAAAGCAGGGTGG + Intergenic
943041885 2:182813657-182813679 CAGATTAAGCAAAAAAAGAGAGG - Intergenic
943112427 2:183622248-183622270 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
943240465 2:185377314-185377336 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
943396807 2:187348458-187348480 AAGTATGAGAAAAAGCTGAGAGG + Intronic
943721987 2:191214348-191214370 TAGAATGTGCAAAGGCACAGAGG + Intergenic
944211108 2:197207470-197207492 CAGAATGATAAAAATCAGAGGGG - Intronic
944901768 2:204223201-204223223 CAGGGTGACCAACAGCAGAGAGG - Intergenic
945418831 2:209608850-209608872 AAGAAAGAGCAGAAGCAAAGGGG - Intronic
945428397 2:209736069-209736091 CGTAATGAGTGAAAGCAGAGGGG - Intergenic
946239781 2:218346440-218346462 CAGCATGAGCGAAGGCACAGAGG - Exonic
946786248 2:223246884-223246906 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
947033424 2:225824398-225824420 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
948481665 2:238254185-238254207 CAGCCTGAGCAAGATCAGAGGGG + Intronic
1169432013 20:5544914-5544936 CACAAGGAGCAACGGCAGAGAGG + Exonic
1169846843 20:10003149-10003171 CAGCAAGGGCAAAGGCAGAGAGG - Intronic
1169857195 20:10115782-10115804 CGGAAATAGCAAAGGCAGAGAGG - Intergenic
1170370926 20:15647310-15647332 CAGCCTGGGCAAAAGCACAGGGG + Intronic
1170487094 20:16829439-16829461 AAGATGGAGGAAAAGCAGAGAGG - Intergenic
1170509326 20:17060441-17060463 CAGTATGTGCAAATGCACAGAGG + Intergenic
1170623732 20:18015022-18015044 CAGAATGAGCAAAATCAGGCCGG + Intronic
1172214556 20:33225791-33225813 CAGCATGTGCAAAGGCACAGTGG - Intronic
1172983608 20:38964231-38964253 CAGCATGAACAAAGGCAGAATGG + Intronic
1173168086 20:40700287-40700309 CAGCACAAACAAAAGCAGAGAGG - Intergenic
1173318728 20:41968476-41968498 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
1173611366 20:44370714-44370736 CGGAATGAGCAAATACAGATGGG + Intronic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1173884535 20:46445804-46445826 TAGGATGACCAACAGCAGAGAGG - Intergenic
1173943907 20:46934771-46934793 CAGCATGAGCAAAGGCCCAGAGG + Intronic
1174065907 20:47866032-47866054 CAGCATGACCAGATGCAGAGAGG + Intergenic
1174179126 20:48664015-48664037 CAGAATGAACAAAGACAGAAAGG + Intronic
1174557701 20:51407602-51407624 CAGCATGAGCAAGAGCTCAGAGG - Intronic
1174670993 20:52307549-52307571 CAGAAGCAGAAAAAGCAGAAGGG - Intergenic
1177388016 21:20432871-20432893 CAGAGTGAGGAAAAGCAGGGTGG + Intergenic
1178182104 21:30173212-30173234 TACAATGAGCAATAACAGAGTGG - Intergenic
1178260693 21:31097476-31097498 CAGAAGGAACACAAGGAGAGAGG - Intergenic
1178296921 21:31417902-31417924 ATGAATGAGCAACAGCTGAGTGG + Intronic
1178393482 21:32219322-32219344 GAGGGTGAGCAAAAGCAGGGTGG + Intergenic
1178522475 21:33298008-33298030 CAGCTTGAGCAAAAGCAGTCTGG + Intergenic
1178586655 21:33876207-33876229 AAGAAAGAGAAAAAGAAGAGAGG - Intronic
1178630259 21:34253409-34253431 TAAAATGGGCAGAAGCAGAGCGG + Intergenic
1179775889 21:43661840-43661862 CAGGAGAAGCAAAGGCAGAGAGG - Intronic
1180640077 22:17291238-17291260 AAGATTGAGCAGAAACAGAGGGG + Intergenic
1180978768 22:19868829-19868851 CAGCATGGGCAAAGGCACAGAGG + Intergenic
1181265346 22:21627962-21627984 CAGCATGAACAAAACCAGAATGG + Intergenic
1181487650 22:23241643-23241665 CAAAAGGAGGAAGAGCAGAGGGG - Intronic
1181791948 22:25275122-25275144 TAATATGAGTAAAAGCAGAGAGG + Intergenic
1181817284 22:25448104-25448126 CAGAATGAGAAGAAGGAAAGCGG + Intergenic
1181873172 22:25919112-25919134 CTTAATGAGCAAAGGCGGAGAGG - Intronic
1182122162 22:27795239-27795261 AACAAAGAGAAAAAGCAGAGAGG + Intronic
1182133359 22:27876359-27876381 CAAGAGGAGAAAAAGCAGAGAGG - Intronic
1182461121 22:30484798-30484820 CAGCATGAGCAAAGGCAGAGGGG + Intergenic
1183756814 22:39774911-39774933 CAGCATGAGCAAAAACACAGAGG - Intronic
1183770901 22:39924993-39925015 TAGAGTGAGTAAAGGCAGAGTGG + Intronic
1184309114 22:43629759-43629781 CAGAATGTGCAAACGCTTAGAGG + Intronic
1184495950 22:44841573-44841595 CATAATTAGCAAAAGCTGACTGG - Intronic
1203296105 22_KI270736v1_random:44445-44467 CAGAAGCAGCACAGGCAGAGGGG - Intergenic
949594668 3:5531270-5531292 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
949777324 3:7647487-7647509 CAGATTGTGCAGAAGCAAAGTGG + Intronic
949881065 3:8661211-8661233 CAGAGTGAGTGAAAGCACAGAGG - Intronic
950387547 3:12672096-12672118 CAGTATGGGCAAAGGCATAGAGG + Intergenic
950648621 3:14393306-14393328 AAGAATGAGCAAGAAGAGAGGGG - Intergenic
950900308 3:16491549-16491571 CACAATGCACAAAAGCAGTGTGG + Intronic
950995876 3:17495055-17495077 GAGAGTGAGGAAAAGCATAGTGG - Intronic
951109132 3:18781000-18781022 CAACATAAGCAAAAGCAGACTGG + Intergenic
951270303 3:20616299-20616321 CAGCATTTGCAAAAGCAGAAAGG - Intergenic
951275429 3:20679398-20679420 TAGCATGTGCAAAGGCAGAGAGG + Intergenic
951384022 3:22023225-22023247 GAGAATGAGAGGAAGCAGAGTGG + Intronic
951521392 3:23613996-23614018 CAGAATAGGCAAACGCATAGAGG - Intergenic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951687679 3:25362767-25362789 AAGGATGAGCCAAAGCAGGGTGG - Intronic
951826017 3:26869602-26869624 CAGAATGAGACACAGAAGAGAGG + Intergenic
952514035 3:34085681-34085703 GAGCATGAGCCAAAGCAGGGCGG - Intergenic
952572201 3:34731437-34731459 GAGAGTGAGGAAAAGCAGGGTGG + Intergenic
952574455 3:34758632-34758654 GAGAGTGAGGAAAAGCAGGGTGG + Intergenic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
952679580 3:36074922-36074944 AAGAGAGAGGAAAAGCAGAGTGG - Intergenic
952747056 3:36791368-36791390 CAGAATCAGCAGAAGAGGAGTGG - Intergenic
952855772 3:37769654-37769676 CAGCATGTGCAAAAGCATAGAGG - Intronic
952863405 3:37833644-37833666 CATGATGAGCAAAAACAGAAAGG + Intergenic
953269152 3:41423725-41423747 GGGAGTGAGGAAAAGCAGAGTGG + Intronic
953658810 3:44875464-44875486 CAGAGTGGGGAATAGCAGAGCGG + Intronic
953847631 3:46440667-46440689 TAGAAGGAGCAGAAGCAGAAGGG + Intronic
955118971 3:56036617-56036639 GAGAGTGAGAAAAAGCAGGGTGG + Intronic
955547171 3:60043236-60043258 AAGAATTGGCAAAAGCAGACTGG - Intronic
955630341 3:60966403-60966425 GAGCATGAGCCAAAGCAGGGCGG - Intronic
955833701 3:63030887-63030909 CAGCGTGGGCAAAGGCAGAGAGG - Intergenic
956689347 3:71861462-71861484 CAGGATGTGCAACAGGAGAGTGG - Intergenic
957268960 3:78003721-78003743 GAGAAGGAGGAAGAGCAGAGTGG - Intergenic
957303443 3:78423885-78423907 GAGAATTAGAAAATGCAGAGTGG + Intergenic
957540937 3:81568039-81568061 CAGAATGTTCAAAAGCCCAGGGG - Intronic
957576743 3:82017261-82017283 GAGCATGAGCAAAGGCAGTGAGG + Intergenic
958483546 3:94675900-94675922 GAGAGTGAGCAAAAACAGGGTGG + Intergenic
958896304 3:99833409-99833431 CATAATGAGCAAAAGAAGTATGG + Intronic
959091891 3:101911680-101911702 AAGGATGAGCCAAAGCAGAGTGG - Intergenic
959120201 3:102223371-102223393 GAGGTTGAGCAAAAGCAGGGTGG - Intronic
959154418 3:102649176-102649198 CAGAATGCCCAAAAGCAAAGTGG - Intergenic
959278136 3:104304157-104304179 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
959299059 3:104576100-104576122 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
959356988 3:105344333-105344355 CAGAGTGAGCAAACCCAGAGAGG - Intergenic
959615136 3:108338812-108338834 CAGAATGAGATAAAACAGGGAGG + Intronic
959653930 3:108779696-108779718 CAGCATGACTTAAAGCAGAGAGG - Intergenic
959766005 3:110029196-110029218 CAGCATGATCAAAGGCATAGAGG - Intergenic
959837442 3:110936701-110936723 AAGAATGTGCAAAGGCACAGAGG + Intergenic
960002646 3:112749071-112749093 GATAATGAGCAAAAGGAAAGGGG + Intronic
960675341 3:120188733-120188755 GATAATGAGCAGAAGCATAGAGG + Intronic
960690203 3:120338916-120338938 TAGAAGGAGGAAAAGCAGACTGG + Intronic
960764702 3:121112432-121112454 GAGAGCCAGCAAAAGCAGAGTGG - Intronic
961150004 3:124629565-124629587 CAGCAGGAACAAAAGCACAGAGG - Intronic
961189670 3:124948043-124948065 CAGAATAAGCAAATCCACAGAGG + Intronic
961423765 3:126828865-126828887 CAGAATGAGCAAAACAAAAAGGG - Intronic
962357238 3:134705313-134705335 GAGAAGGAGCAAAACCTGAGTGG + Intronic
962580701 3:136795359-136795381 CAGCTTGAGCAAAGGCCGAGAGG + Intergenic
963297550 3:143562385-143562407 CAGTAAGAGCAAAGGGAGAGAGG + Intronic
963429112 3:145174441-145174463 CAATGTGAGCAAAAGAAGAGAGG + Intergenic
963454229 3:145522950-145522972 CAGAATGACCAGTTGCAGAGAGG - Intergenic
963464417 3:145660687-145660709 CAGCATGTGCAAATGCACAGAGG - Intergenic
963483378 3:145904447-145904469 CAGAATGACCGACTGCAGAGAGG + Intergenic
963853953 3:150235293-150235315 CAGCATGGGCAAAGGCAGATTGG - Intergenic
964183233 3:153913056-153913078 GAGAATGAAGAAAAGCAAAGTGG + Intergenic
964295254 3:155225880-155225902 AAGAGTGAGGAAAAGCAGGGTGG - Intergenic
964309524 3:155377635-155377657 CAGAATGAAAAAGACCAGAGGGG - Intronic
964394730 3:156233624-156233646 CAGCAAGGGCAAAAGCAGAAAGG + Intronic
965721345 3:171665748-171665770 CATAATAAGAAAAAGCGGAGGGG + Intronic
966154494 3:176901227-176901249 CAGAAAGAGAAAAAGAAGAGAGG + Intergenic
966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG + Intronic
966364266 3:179165789-179165811 CAGCATGAGCACAAGAACAGGGG - Intronic
966454674 3:180101876-180101898 GAGAATGAAGAAAAGCAGGGTGG + Intergenic
966652467 3:182315970-182315992 GAGAGTGAGGAAAAACAGAGTGG - Intergenic
966921341 3:184613607-184613629 CAGGATGTGCAAATGCAGAGAGG + Intronic
966941604 3:184751491-184751513 AAGTGTGAGCAAGAGCAGAGGGG + Intergenic
967574590 3:191076146-191076168 GAGAATGAAGAAAAGCAGAATGG + Intergenic
968403341 4:317248-317270 CAGCATGTGCAAAAGCACAGCGG - Intergenic
969028841 4:4195164-4195186 CAGAATGGGAAATAGGAGAGAGG - Intronic
969043582 4:4320327-4320349 CAGAGTGAGCAGAAGCTGTGAGG + Intronic
969061225 4:4436869-4436891 CAGCATGAGCAAATGCTCAGAGG - Intronic
969166407 4:5319608-5319630 CAGCATGAACAAAGGCTGAGAGG - Intronic
969288671 4:6224405-6224427 CAGCAGGAGCAAAAGCAAACAGG - Intergenic
969377381 4:6771777-6771799 CAGCATTTGCAAAGGCAGAGAGG + Intergenic
969662245 4:8537077-8537099 CAGCCTGAGCAAAGGCTGAGAGG + Intergenic
969783121 4:9427422-9427444 CATATAGAGCAAAAGAAGAGAGG - Intergenic
970027992 4:11644360-11644382 AAGAAGGAGAAAAAGGAGAGGGG - Intergenic
970324066 4:14904828-14904850 TAGCATGTGCAAAAGCAAAGAGG - Intergenic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970937644 4:21593348-21593370 CTGAAAGAGCAAAGACAGAGTGG + Intronic
970989287 4:22193789-22193811 CAGAATGGGCAAAAGCTGGAAGG - Intergenic
971163776 4:24161277-24161299 AATTATGAGCAAAAGCTGAGAGG - Intergenic
971677680 4:29654821-29654843 CAAGAAGAGAAAAAGCAGAGTGG - Intergenic
971935361 4:33140675-33140697 CAAAATTAGCACAAGCAGATGGG + Intergenic
972538387 4:40018293-40018315 CAGAATGAAGAAGAGAAGAGAGG - Intergenic
972797632 4:42437882-42437904 CAGAATGAGCGGAAGCAAAAGGG + Intronic
973240236 4:47948900-47948922 TAGAATGAGTAGAAGCGGAGAGG + Intronic
973894256 4:55396230-55396252 CAGAAAGAGCAGAAGCAGCCGGG - Exonic
973901520 4:55478395-55478417 GAATATGTGCAAAAGCAGAGAGG - Intronic
974560014 4:63505805-63505827 GAGAGTGAGCAGAAGCAGAGTGG + Intergenic
974816580 4:67012748-67012770 TAGCATGAGCAATAGCATAGAGG + Intergenic
974964463 4:68744450-68744472 GAGAGTGAGAAAAAGCGGAGTGG + Intergenic
974966263 4:68763988-68764010 CTGAATGAGCAAAAGCTCAAAGG - Intergenic
975177822 4:71308569-71308591 GAGGGTGAGCAGAAGCAGAGGGG + Intronic
975202859 4:71611419-71611441 GAGAAAGGGCAAAAGCAGAGGGG + Intergenic
975462463 4:74670358-74670380 AACAATGAGCTACAGCAGAGTGG + Intergenic
975487248 4:74948020-74948042 TGGCATGAGCAAAGGCAGAGAGG - Intronic
975500598 4:75080227-75080249 GAGAGTGAGCCAAAGCAGGGCGG - Intergenic
975727204 4:77303560-77303582 GAGGATGAGCCAAAGCAGGGTGG - Intronic
975733789 4:77362773-77362795 CAGAAAGAGGGAAAGCAGAAAGG + Intronic
976527944 4:86115328-86115350 CAGAGTGAGGAAAAGCAGGGTGG - Intronic
977084588 4:92576844-92576866 CAGAATGAAAAAAAGCAGGGTGG - Intronic
977471882 4:97452626-97452648 CAAGATGACCAACAGCAGAGAGG + Intronic
977524456 4:98126541-98126563 GAGAGTGAGGAAAAGCAGAGTGG - Intronic
977963815 4:103118897-103118919 CAGAATAAGCAAGAGGATAGAGG - Intronic
978063751 4:104370700-104370722 CATACTGATCAAAAGCACAGAGG + Intergenic
978065358 4:104392438-104392460 TAATATGAGCAAAAGCACAGAGG + Intergenic
978182935 4:105823171-105823193 CAGAATGAGGAAAAGCTGTGGGG + Intronic
978265987 4:106824469-106824491 CGGAATCACCAAAAGCAAAGGGG + Intergenic
978885356 4:113761467-113761489 CAGGAGGAGTAGAAGCAGAGGGG + Intronic
978902549 4:113970137-113970159 CAGAATGAGCCAAAGAAGAGAGG + Intronic
979023045 4:115526975-115526997 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
979140591 4:117168968-117168990 AAAAAAGAGGAAAAGCAGAGAGG + Intergenic
979549815 4:121978013-121978035 CTGAAAGTGCAAAGGCAGAGGGG + Intergenic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
979649471 4:123114062-123114084 CAGGATGATCAACATCAGAGAGG - Intronic
979732910 4:124045813-124045835 GAGAATGAGGAAAAGCAGGGTGG - Intergenic
980151736 4:129056080-129056102 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
980159419 4:129141376-129141398 CAGAATGAACAAAGGCACAGAGG + Intergenic
980196811 4:129599986-129600008 CAGAATGAACAAAAGAAAATGGG - Intergenic
980239509 4:130155424-130155446 AAGAATGTGCAATGGCAGAGTGG + Intergenic
980645425 4:135636606-135636628 GGGAATGAAGAAAAGCAGAGTGG - Intergenic
980905430 4:138944081-138944103 CAGTAAGAGCAAAGGCACAGAGG + Intergenic
981290762 4:143071818-143071840 GAGAATGAGGAAAAGCCGGGTGG - Intergenic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
982693371 4:158572476-158572498 CAGCATGAACAAAGGCAAAGAGG + Intronic
982848079 4:160276409-160276431 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
982962338 4:161856261-161856283 CAGCATGAGAAAAGGCATAGAGG + Intronic
983249259 4:165326555-165326577 CAGTTTGAGCAAAAGCATGGAGG + Intergenic
983321048 4:166197537-166197559 CATAATCAGAAAAAGGAGAGAGG - Intergenic
983597227 4:169483364-169483386 CAAAATGAGCAAAAGCTGTTGGG + Intronic
983677770 4:170316555-170316577 GAGAGTGAGCCAAAGCAGGGTGG + Intergenic
983836147 4:172387841-172387863 CAGCATGAGCAAAAAAACAGAGG - Intronic
983957504 4:173715525-173715547 GAGAGTGAGGAAAAGCAGGGTGG + Intergenic
983970054 4:173860387-173860409 GAGAATGAACAAAAGAAGACAGG - Intergenic
983986577 4:174066998-174067020 CATTTAGAGCAAAAGCAGAGTGG + Intergenic
984013867 4:174403253-174403275 CAGTATGAGGAAAAGGGGAGAGG + Intergenic
984735334 4:183102780-183102802 CATGGTGAGCAAAAGAAGAGGGG - Intronic
985287198 4:188348444-188348466 CAGAGTTAGGTAAAGCAGAGAGG + Intergenic
985317328 4:188672336-188672358 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
986607657 5:9538207-9538229 CAAAATGTGCCAAAGCAGAATGG + Intronic
987002421 5:13673283-13673305 TTGAAAGAGCAAAACCAGAGTGG + Intergenic
987239489 5:15979964-15979986 AAGTATGAGTAAAAGTAGAGGGG - Intergenic
987260094 5:16194891-16194913 AAGAATGAAGAAAAGCAGGGTGG + Intergenic
988202596 5:28086618-28086640 GAGAATGAGCTACAGCAGGGCGG + Intergenic
988204007 5:28110806-28110828 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
988453222 5:31364075-31364097 AACAATCAGCAAAAACAGAGGGG - Intergenic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
988996452 5:36719492-36719514 CAGAATCAGGAAAAGTACAGAGG - Intergenic
989465747 5:41753446-41753468 CAGCATGAACAAAAGCTGAAAGG - Intronic
990135353 5:52638145-52638167 GAGCAAGAGCAAAACCAGAGGGG + Intergenic
990183851 5:53191630-53191652 GAGGGTGAGCAAAAGCAGAGTGG - Intergenic
990619379 5:57543323-57543345 TAGAATGAGTGAAAACAGAGAGG - Intergenic
990660557 5:58009697-58009719 CAGAATGGGGAAAAGCAAAGTGG + Intergenic
990931767 5:61099809-61099831 CAGAATAGGCAACAGAAGAGAGG - Intronic
991153150 5:63396211-63396233 CAAAAAGAGCAAAAGAAGAACGG + Intergenic
991227876 5:64293264-64293286 AAGAATGAAGAAAAGCAGAGTGG - Intronic
991473355 5:66993640-66993662 CAGGATGTGCAAAGGCAGTGAGG + Intronic
991651692 5:68862216-68862238 CAGAATGAGTAGAGGCAGAGAGG + Intergenic
991651982 5:68865097-68865119 GAGAGTGGGCAGAAGCAGAGTGG + Intergenic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
992486767 5:77204687-77204709 CAGCATGAACAAAGGCACAGAGG - Intergenic
992580975 5:78175192-78175214 GAGGGTGAGCTAAAGCAGAGTGG - Intronic
992735392 5:79714197-79714219 CAACATGTGCAAAAGAAGAGGGG - Intronic
993040124 5:82804904-82804926 CAGAATGAAAAAAAGGAGAGGGG + Intergenic
993055623 5:82976037-82976059 CAGAATGAGCCAAGGCAGGCAGG + Intergenic
993112698 5:83678179-83678201 GAAAATGAGGAAAAGTAGAGAGG - Intronic
993337881 5:86683999-86684021 CAAAATGAGCATAAGAAGAGAGG + Intergenic
993495883 5:88608365-88608387 CAGAATGAACCAAAACAAAGAGG + Intergenic
993530631 5:89020336-89020358 GAAAATGGCCAAAAGCAGAGGGG + Intergenic
993837753 5:92835599-92835621 GAGAAGGAGGAAAAGCAGGGTGG - Intergenic
993861786 5:93145264-93145286 CACACTGAGCAGACGCAGAGTGG - Intergenic
994039634 5:95244350-95244372 GAGGATGAGCCAAAGCAGGGCGG + Intronic
994298681 5:98121172-98121194 GAGAGTGAGGAAAAGCAGGGTGG + Intergenic
994344069 5:98664349-98664371 GAGAGTGAGGAAAAGCAGGGCGG + Intergenic
994737132 5:103569206-103569228 TGGAATGAGCACAAGCAGTGAGG - Intergenic
994785449 5:104155628-104155650 CACAATGAGAAAAATCAGCGTGG - Intergenic
994794054 5:104270845-104270867 TAGCATGAGCAAATGCAGAGAGG + Intergenic
995258395 5:110073230-110073252 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
995375598 5:111470987-111471009 CAGGCTAAGCAAAAGCAGATTGG - Intronic
995417872 5:111930165-111930187 CTGATTTAGCAAGAGCAGAGGGG + Intronic
995451651 5:112308882-112308904 CTGATTGAGCAAAAAAAGAGGGG + Intronic
995785816 5:115826197-115826219 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
995843413 5:116467269-116467291 CAGAATGAGACTAAGAAGAGTGG + Intronic
996054477 5:118968487-118968509 GAGAGTGAGGAAAAGCAGGGTGG + Intronic
996644970 5:125802989-125803011 CAGAAAAAACAAAAGCATAGTGG - Intergenic
997533769 5:134599815-134599837 CAGCATCAGAAAAAGCTGAGAGG + Intergenic
997598412 5:135122608-135122630 CAAAATGAGGCTAAGCAGAGAGG - Intronic
997751900 5:136354825-136354847 CAGAATGCGCCAGAGCAGGGAGG - Intronic
997791817 5:136768932-136768954 GAGAAAGAGCAAGTGCAGAGAGG + Intergenic
998063622 5:139138790-139138812 TAGGATAAGCAAAAGCAGCGAGG + Intronic
998072465 5:139208783-139208805 CAGAATGTGGAAAGGGAGAGGGG + Intronic
998319721 5:141217804-141217826 CAAAATGAGTAAAAGTATAGAGG + Exonic
998445372 5:142194407-142194429 CACAATGAGCGAATCCAGAGAGG - Intergenic
999085454 5:148884759-148884781 CAGCATGAGCAAAGACTGAGTGG - Intergenic
999119355 5:149197297-149197319 ATGAATGAGCCAAAGCACAGAGG - Intronic
999571779 5:152926845-152926867 GAGAATGAACTAATGCAGAGAGG + Intergenic
999636301 5:153626242-153626264 CTGATTGAGCAAATGCTGAGAGG + Intronic
999694601 5:154178008-154178030 CAGCATGAGCAAAGGCATGGGGG + Intronic
999714488 5:154349193-154349215 CAGCATAAGCAAAAGCACTGAGG + Intronic
1000786440 5:165550046-165550068 CAGGGTGAGCTGAAGCAGAGTGG - Intergenic
1001039955 5:168327254-168327276 AAGAATGAGGGAAAGGAGAGGGG - Intronic
1001164977 5:169356290-169356312 CAGCATGAGCAAAATCTGTGTGG + Intergenic
1001658278 5:173370903-173370925 CAAGATGACCACAAGCAGAGAGG - Intergenic
1001747313 5:174101500-174101522 CAGAATGAGGAAATGCACAGAGG - Intronic
1001875198 5:175194303-175194325 CAGCATGGGCAAAGGCAGGGAGG + Intergenic
1002192944 5:177488270-177488292 CAGAGGGAGCACACGCAGAGAGG + Intronic
1002736737 5:181395605-181395627 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1002747962 6:79217-79239 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1002967059 6:1977609-1977631 GAGAATGAAGAAAAGCAGGGTGG + Intronic
1003460527 6:6324077-6324099 CACAATTAGCAACAGCAGAGAGG + Intergenic
1004366049 6:15013606-15013628 CAGTATGGGCAAAGGCAGAGAGG - Intergenic
1004453756 6:15771833-15771855 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1004984028 6:21059587-21059609 GAGAGTGAGGAAAAGCAGGGCGG - Intronic
1005102749 6:22191164-22191186 CAGAGTTAGAAAAAGAAGAGAGG - Intergenic
1005319337 6:24637155-24637177 CAGTCAAAGCAAAAGCAGAGTGG + Intronic
1006241203 6:32680280-32680302 GAGAGTGAAGAAAAGCAGAGTGG - Intergenic
1006706269 6:36024106-36024128 CAAAATTAACAAAAGCAGTGGGG + Intronic
1006712078 6:36083192-36083214 GAGAGTGAGGAAAAGCAGGGTGG + Intronic
1006779960 6:36625740-36625762 CAGCATGAGCAAAGGCAGAGAGG + Intergenic
1006818754 6:36873715-36873737 CAGCATGAGCAAATAGAGAGAGG + Intronic
1007084980 6:39137219-39137241 TAGCATGAGAAAAAGCAGAGTGG + Intergenic
1007290233 6:40780256-40780278 AAGAAGCAGAAAAAGCAGAGAGG + Intergenic
1007300101 6:40861492-40861514 GAGAATCAGCAAAGGGAGAGAGG + Intergenic
1009629051 6:66170840-66170862 CTGAATGAGCAAAAGCTGGAAGG + Intergenic
1009990992 6:70842753-70842775 CAGAATGAGGAGAAGCAAAGAGG - Intronic
1010148799 6:72705056-72705078 TAGATTGAGCAAAGGCAGAGAGG - Intronic
1011130062 6:84043501-84043523 CTGAATGGGCAAAAGCTCAGAGG + Intronic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1011706129 6:90003234-90003256 CAGAGTGAGCCAAGGCAGGGTGG - Intronic
1011782180 6:90801812-90801834 CAGCATCAGCAAAGGCACAGAGG + Intergenic
1012006906 6:93724176-93724198 CAGAATGAGCTAAGAGAGAGGGG + Intergenic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012389766 6:98724475-98724497 TAGAATGAGCAAAAGGTGAAAGG - Intergenic
1012479698 6:99652844-99652866 CAAAATGTGCAAATGCAGAGAGG - Intergenic
1013075445 6:106766703-106766725 GAGAATGGGTGAAAGCAGAGGGG - Intergenic
1013400339 6:109789058-109789080 CATAATGATCAAAAACACAGTGG - Intronic
1013475567 6:110504264-110504286 CAGAAGTTGCAAAAGCAGAAAGG + Intergenic
1013722576 6:113048610-113048632 CAGCATGTGCAAAAGCACAAAGG - Intergenic
1013896219 6:115091621-115091643 CAGAGTGAGCAAAGGCACAATGG - Intergenic
1014227213 6:118862024-118862046 CAGAAGGAGCCAAGGCAGTGGGG + Intronic
1014350448 6:120336800-120336822 AAAAATGATCAAAATCAGAGTGG + Intergenic
1014681409 6:124435076-124435098 CAGAGTGAGCTAAAAGAGAGTGG + Intronic
1014890913 6:126845132-126845154 CAGAGTGAGCAAAGGCATTGAGG + Intergenic
1015186674 6:130424925-130424947 AAGGAGGAGGAAAAGCAGAGAGG - Intronic
1015290986 6:131538399-131538421 GAGGGTGAGCCAAAGCAGAGTGG + Intergenic
1015690098 6:135912660-135912682 TAAAATGAGCAACAGCTGAGAGG + Intronic
1015846913 6:137530527-137530549 CAGAATTAGCAAGAGGAGAGTGG - Intergenic
1016913113 6:149218444-149218466 AAGAACAAGCAAAAGAAGAGTGG + Intergenic
1017289671 6:152721233-152721255 CAGAAAGAGCAAAGGAAGTGAGG + Intronic
1017798352 6:157868777-157868799 GAGAAGGAACAAAAGCAGATAGG + Intronic
1017868804 6:158468839-158468861 TAGAATGAGTAAAAGCAGGGAGG + Intronic
1018184212 6:161251812-161251834 CAGGAGGAACAAAAGCAGAGAGG + Intronic
1018435167 6:163752673-163752695 CAGCAGGAGCAAGGGCAGAGAGG + Intergenic
1019090050 6:169521871-169521893 CAGAAAGAAAAAAAGAAGAGAGG + Intronic
1019091002 6:169533569-169533591 CAGAAACAGAAAAGGCAGAGAGG + Intronic
1019241836 6:170671134-170671156 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1020478102 7:8623013-8623035 CAGAAAGAGCAAAAGCAGAGTGG + Intronic
1021186904 7:17575593-17575615 CAAAGAGAGGAAAAGCAGAGTGG + Intergenic
1021420884 7:20443524-20443546 GAGAGTGAGGAAAACCAGAGGGG + Intergenic
1021816914 7:24456097-24456119 CATTTTGAGGAAAAGCAGAGTGG - Intergenic
1022163070 7:27731388-27731410 CAGAAGAAGCAGAAACAGAGAGG - Intergenic
1022317354 7:29257740-29257762 CAGAATGGATAAAAGAAGAGAGG - Intronic
1022472480 7:30690294-30690316 CAGCATGTGCAAAGGCAGAGAGG + Intronic
1022499689 7:30874710-30874732 CAGCAAGAACAGAAGCAGAGAGG - Intronic
1022597713 7:31728472-31728494 CAGCATAGGCAAAAACAGAGGGG - Intergenic
1022925092 7:35048746-35048768 CAGGATGAGGAAAAGCACACTGG - Intergenic
1022960095 7:35418112-35418134 CAGTGTGATCTAAAGCAGAGAGG - Intergenic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1023164375 7:37328747-37328769 CAGAGTGAGCTTGAGCAGAGAGG - Intronic
1023271763 7:38470570-38470592 TGGAATGTGCAAAAGAAGAGGGG - Intronic
1023328508 7:39086624-39086646 CACAATGTGGAAAAGGAGAGGGG - Intronic
1023464108 7:40434859-40434881 CAGCATCAGAAAAAGCATAGGGG - Intronic
1023544587 7:41305036-41305058 CAGAGAGAGTAAAAGCAGTGAGG + Intergenic
1023568990 7:41553118-41553140 GAGGGTGAGCCAAAGCAGAGTGG - Intergenic
1024398215 7:48893496-48893518 CAGAAGGAACAAAAGGAGATGGG + Intergenic
1024660129 7:51485494-51485516 CAAAATGAGTCAAAGCAGTGAGG + Intergenic
1024859559 7:53823196-53823218 GAGAGTGAGGAAAAGCAGGGTGG + Intergenic
1025114500 7:56246098-56246120 GAGAAGGAGCAAGAGCGGAGAGG + Intergenic
1025626454 7:63226717-63226739 CAGAATGAACAAAGGCAGCTTGG - Intergenic
1025655669 7:63516409-63516431 AAGAATGAACAAAGGCAGATTGG + Intergenic
1026390328 7:69894812-69894834 AAGCATGAGCAAATGAAGAGTGG - Intronic
1026434418 7:70382624-70382646 CACAATGGGCAAAGGCAGAGTGG - Intronic
1026463186 7:70632396-70632418 AAGAATGAGCAAAGGCCAAGGGG - Intronic
1026537943 7:71255771-71255793 CAGCATGAGTAAAGGCATAGTGG + Intronic
1028325191 7:89515230-89515252 CAGAAGGAGCCAAATCAGAATGG - Intergenic
1028326941 7:89539806-89539828 GAGGATAAGCCAAAGCAGAGTGG + Intergenic
1028367252 7:90048238-90048260 GAGAGTGAGCAAAAACAGGGTGG + Intergenic
1028522913 7:91752382-91752404 GAGAGTGAGGAAAATCAGAGTGG + Intronic
1029051812 7:97697538-97697560 CAGCTTCAGCAAAGGCAGAGGGG - Intergenic
1029220571 7:98985992-98986014 CAGAATAAGCAAATCCATAGAGG - Intronic
1030084602 7:105805767-105805789 CAGCAAGAGCAAATGCAGTGTGG + Intronic
1030142568 7:106320319-106320341 GAGCATGAGCCAAAGCAGGGAGG + Intergenic
1030171530 7:106607635-106607657 GATAATGAGCAAAAGTAAAGAGG + Intergenic
1030409791 7:109161770-109161792 AAGAAAGAGGAAAGGCAGAGAGG - Intergenic
1030500898 7:110357078-110357100 GAGGATGAACAAAAGCAGGGTGG - Intergenic
1030547409 7:110914091-110914113 CAGGAAGAGCAAAAGCAGGCTGG - Intronic
1030692279 7:112547605-112547627 GAGAACGAGGAAAAGCAGAGTGG - Intergenic
1031150101 7:118044366-118044388 CAGAAAGAGCAAATGAAGAGTGG + Intergenic
1031257754 7:119478327-119478349 AAGAATGAGCAGAAATAGAGTGG + Intergenic
1031422863 7:121570053-121570075 AAGCAAGAGGAAAAGCAGAGGGG - Intergenic
1031942737 7:127806476-127806498 CAGAAAAACCAAAAGAAGAGAGG - Intronic
1032238433 7:130143061-130143083 GAGAGTGAGCAAAGGCACAGTGG - Intergenic
1032774098 7:135091744-135091766 CAGTATGAGCAGAAGCAAGGAGG - Intronic
1032921721 7:136556635-136556657 TAGAATGAGAAAGAGAAGAGTGG - Intergenic
1033155940 7:138957107-138957129 CAGCATGTGCAAAGGCACAGGGG + Intronic
1033179778 7:139164897-139164919 AAGAAGGATCAAAAGCAGAGAGG + Intronic
1033247101 7:139726837-139726859 CAGAATGAGAAATAGCAAATGGG + Intronic
1034017854 7:147606837-147606859 GGGACTAAGCAAAAGCAGAGTGG + Intronic
1035456280 7:159011037-159011059 CAAAAAGAGCAAAAGATGAGTGG + Intergenic
1035506281 8:136962-136984 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1035959821 8:4124869-4124891 CAGAAAAAGGAAAAGCGGAGGGG + Intronic
1036835932 8:12066628-12066650 CATATAGAGCAAAAGAAGAGAGG + Intronic
1036857775 8:12313197-12313219 CATATAGAGCAAAAGAAGAGAGG + Intergenic
1037109989 8:15154366-15154388 CAGGCTGAGCAAAAGCTGGGTGG - Intronic
1037212530 8:16408852-16408874 CAGAATAGGCAAATTCAGAGAGG + Intronic
1037228222 8:16621523-16621545 CAGGTTGAGCTAAAGAAGAGAGG - Intergenic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1037739254 8:21592290-21592312 CAGCATGAGCAGAAGGACAGAGG + Intergenic
1037777857 8:21847595-21847617 CAGAATGACCAACAGTAGGGAGG - Intergenic
1038317904 8:26503179-26503201 CAAAATGAGTCAAGGCAGAGGGG - Intronic
1038376291 8:27043181-27043203 GAAAAGGAACAAAAGCAGAGGGG - Intergenic
1038423145 8:27446357-27446379 CAGCCTGAACAAAAGCAGAAAGG - Intronic
1039025473 8:33253211-33253233 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
1040800905 8:51338805-51338827 CAAAATAAGCAAAAGTATAGCGG + Intronic
1041150028 8:54922558-54922580 CAGCATATGCAAAAGCAAAGAGG + Intergenic
1041620812 8:59966451-59966473 CTGAATTAGCCAAAGCAGAATGG - Intergenic
1041972831 8:63761993-63762015 GACAATGAGGAAAAGCAGTGTGG - Intergenic
1042106603 8:65333938-65333960 AAGAAGGAGGAAAAGGAGAGTGG + Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1043071211 8:75638095-75638117 GAGTGTGAGCCAAAGCAGAGCGG - Intergenic
1043080838 8:75763177-75763199 GAGGGTGAGCAAAAGCAGAGTGG + Intergenic
1043118240 8:76286849-76286871 GACGATGAGCAGAAGCAGAGTGG - Intergenic
1043314538 8:78903874-78903896 CAGTATGAGCACAAGCTGAGAGG - Intergenic
1043529417 8:81133373-81133395 CAGAGTGAGCAAAAGCTCAGAGG - Intergenic
1044018462 8:87074720-87074742 GAGAATGAAGAAAAGCAGGGTGG - Intronic
1044043714 8:87402542-87402564 GAGCATGAGCAAAGGCACAGAGG + Intronic
1044113234 8:88302861-88302883 GAGAATGAAGAAAAGCAGGGAGG + Intronic
1044312458 8:90709335-90709357 GAGGATGAACAGAAGCAGAGTGG - Intronic
1044409109 8:91865652-91865674 CAGACTGACCTCAAGCAGAGGGG - Intergenic
1044447682 8:92297463-92297485 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1044504895 8:93006304-93006326 GAGAGTGAGGAAAAGCTGAGTGG + Intronic
1044515780 8:93136793-93136815 GAGTAGGAGCAAGAGCAGAGAGG + Intronic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1045200047 8:99971273-99971295 CTGAATGGGCAAAAGCTGAAAGG + Intronic
1045367325 8:101488657-101488679 CAGCATGAGAAAGAGGAGAGAGG + Intergenic
1045799421 8:106084905-106084927 GAGAAAGAGCAGAAGCAGAGTGG - Intergenic
1045839269 8:106560855-106560877 GAGGATGAGCAAAAGCAGGATGG + Intronic
1046513190 8:115224534-115224556 CAGAGTGAGCAAAATCACAGAGG - Intergenic
1046601050 8:116317284-116317306 GAGAGTCAGGAAAAGCAGAGTGG + Intergenic
1046935032 8:119877549-119877571 CAAAGTGAGAGAAAGCAGAGGGG - Intronic
1047351208 8:124076357-124076379 CAGCAGGAGCAAATGCAGAAAGG - Intronic
1047436929 8:124842600-124842622 CTTAATGAGCAAGGGCAGAGAGG + Intergenic
1047478153 8:125255542-125255564 CAGTGTGATCACAAGCAGAGAGG + Intronic
1047809292 8:128390900-128390922 CAGAATGTGAATGAGCAGAGAGG + Intergenic
1047995782 8:130334116-130334138 CAGAAGGAGCAGAAGCAAACTGG - Intronic
1048001492 8:130383003-130383025 CAGCATGTGCAAAGGCACAGAGG + Intronic
1048245805 8:132797469-132797491 TAGCATGAGCAAAGGCAGAGAGG + Intronic
1048317304 8:133371680-133371702 AAGAATGAGGAAGAGCAGAAAGG + Intergenic
1048421680 8:134283954-134283976 CAGAATGATCAACTGCAGAGAGG - Intergenic
1049169078 8:141147248-141147270 GAGAATGAACCAAAGCAGACAGG - Intronic
1049281933 8:141753820-141753842 CTGAATGAACAAAAGGGGAGAGG - Intergenic
1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG + Intergenic
1050130518 9:2407002-2407024 CAAGATGACCAACAGCAGAGAGG + Intergenic
1050488515 9:6162067-6162089 CATCATGAGTGAAAGCAGAGAGG - Intergenic
1050546216 9:6711446-6711468 CTTTATGATCAAAAGCAGAGTGG - Intergenic
1050644611 9:7705611-7705633 ATGAATGAGTAAAAGCAAAGTGG + Intergenic
1050681166 9:8113411-8113433 CAGGATGAGCAAAGGCAGAATGG + Intergenic
1051146515 9:14032888-14032910 CAGATTGAGCAAAAGCTGAGTGG + Intergenic
1051199355 9:14599292-14599314 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
1051205164 9:14680994-14681016 CAGAATAAGCAAAGGCATAAAGG + Intronic
1051322025 9:15914941-15914963 GAGGGTGAGCAGAAGCAGAGTGG - Intronic
1051347474 9:16165263-16165285 CAGAATGAGTATGAGCTGAGAGG + Intergenic
1051857993 9:21591657-21591679 CAGACTGATCAAAAGCTCAGAGG + Intergenic
1052176884 9:25473007-25473029 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1052473455 9:28929043-28929065 CAAATTCAACAAAAGCAGAGGGG + Intergenic
1052884823 9:33634597-33634619 TTGAATGAGAAAAAGCAAAGAGG + Intergenic
1052937840 9:34108105-34108127 CAGCAAGAGCAAAGGCAGGGAGG - Intronic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1053465972 9:38308814-38308836 CAGCATGATCAAAGGCACAGGGG + Intergenic
1053582926 9:39425791-39425813 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1053720612 9:40943272-40943294 AAGAAAGAGCAAAAGCAGGCCGG + Intergenic
1053847109 9:42250656-42250678 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1054104505 9:60984534-60984556 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1054933847 9:70665863-70665885 CAGAATGAGTAAAAGAAAAAGGG - Intronic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055498923 9:76884087-76884109 CAGAATAGGCAAATGGAGAGAGG - Intronic
1055571686 9:77623615-77623637 GAGAGTGAGCCAAAGCAGGGTGG + Intronic
1055710981 9:79061855-79061877 CAGAATGAGCAAATGCCTGGAGG + Intergenic
1056456274 9:86764002-86764024 CAGCATGAGCAAAGGCACAGAGG + Intergenic
1056632270 9:88303709-88303731 GTGAATGAGGAAAGGCAGAGGGG - Intergenic
1056750242 9:89345385-89345407 TTGAATGAGCCAAAGCAGAGCGG + Intronic
1057057124 9:91972174-91972196 GAGAATGAAAAAAAGCAGGGCGG + Intergenic
1057470999 9:95356144-95356166 CAGAGAAAGCAACAGCAGAGAGG - Intergenic
1058865496 9:109158538-109158560 CAGAATAAGCAAATCCATAGAGG - Intronic
1059262785 9:112994283-112994305 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
1059541446 9:115134423-115134445 CAGCATATGCAAAAGCAAAGAGG + Intergenic
1059687653 9:116652883-116652905 CAGAGTGAGCAAAGGCACAGAGG - Intronic
1059918052 9:119125735-119125757 CAGAATGAGCAAAGACACAGAGG - Intergenic
1059933970 9:119289189-119289211 CAGAATGAGAAAAATCACAGAGG + Intronic
1060252121 9:121995001-121995023 GGGAATGAGGAAAGGCAGAGGGG + Intronic
1060273326 9:122163583-122163605 CAGCATGAGCAATAGCCCAGAGG + Intronic
1060630295 9:125151776-125151798 CAGAATGAGACAATGCAGATAGG - Intronic
1060733734 9:126053335-126053357 CAGCATGGGCAAAAGCAAGGAGG - Intergenic
1062203481 9:135321555-135321577 CAGAATGAGCCACGGCAGAGTGG - Intergenic
1203454518 Un_GL000219v1:152611-152633 AAGAAAGAGCAAAAGCAGGCCGG - Intergenic
1203602027 Un_KI270748v1:20368-20390 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1186490514 X:9968743-9968765 TAAAATGTGCAAAAGTAGAGAGG + Intergenic
1187284354 X:17889635-17889657 GAGACTCAGCTAAAGCAGAGAGG + Intergenic
1187597369 X:20787726-20787748 CAGAATAACTAAAAACAGAGGGG - Intergenic
1187620445 X:21047354-21047376 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1187704549 X:21996631-21996653 AAAAGTCAGCAAAAGCAGAGGGG - Intergenic
1188151191 X:26678005-26678027 CAGTTAGAGCAAAAGCAGACTGG - Intergenic
1188153840 X:26716133-26716155 CAGTCAGAGCAAAAGCAGACTGG - Intergenic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1188504988 X:30873013-30873035 GAGGATGAAAAAAAGCAGAGAGG + Intronic
1188981661 X:36732386-36732408 CAGAATGTGCATAAGTGGAGTGG - Intergenic
1189189554 X:39088650-39088672 CAGAGGGAGCCAAAGCAGGGTGG + Intergenic
1190119594 X:47649615-47649637 CAGACTGATTCAAAGCAGAGAGG + Intronic
1190738252 X:53269886-53269908 CAGTAGGAGGAAAAGCAGTGGGG - Intronic
1190744261 X:53312126-53312148 CAGCATGAGCAAACACACAGAGG - Intronic
1190944045 X:55073351-55073373 GAGGGTGAGCAAAAGCAGGGTGG - Intergenic
1190960288 X:55240486-55240508 AAGAGTGAGGAAAAGCAGGGTGG + Intronic
1191034297 X:56008374-56008396 GAGAATAAGGAAAAGCAGGGTGG + Intergenic
1191065643 X:56343942-56343964 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191168619 X:57418525-57418547 GAGGATGAGCCAAAGCAGGGTGG - Intronic
1191766804 X:64706345-64706367 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1191815744 X:65242147-65242169 GAGAATGAAAAAAAGCAGGGTGG - Intergenic
1192277593 X:69649044-69649066 GAGAATGAAGAAAAGTAGAGAGG - Intronic
1192450564 X:71242130-71242152 GAGAAGGGGCAAAAGCACAGGGG + Intronic
1192545041 X:72006167-72006189 CAGAGAGACCAAAAGCAGAAAGG - Intergenic
1192897400 X:75458937-75458959 GAGAATGAAGAAAAGCAGGGTGG + Intronic
1192964079 X:76159169-76159191 GAGGGTGAGCCAAAGCAGAGTGG + Intergenic
1192998102 X:76533692-76533714 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1193010558 X:76670876-76670898 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1193164432 X:78264621-78264643 GAGAATGAGGAAAAGCAGGGTGG - Intergenic
1193289479 X:79754637-79754659 CAAAATGAACAAAAGGAAAGAGG - Intergenic
1193409279 X:81143516-81143538 CAGGGTGAGCCAAAGCAGAATGG + Intronic
1193542409 X:82788415-82788437 GAGGGTGAGCCAAAGCAGAGAGG + Intergenic
1194203441 X:90983151-90983173 AAGAGTGAGCAAAAGCAGGCTGG + Intergenic
1194435748 X:93867522-93867544 GAGAATGAGGAAAAGCTGAGCGG + Intergenic
1194961132 X:100236775-100236797 GAGAATGAGCCGAAGCAGGGTGG - Intergenic
1195118471 X:101724053-101724075 CAGAATAAGAAAATTCAGAGGGG - Intergenic
1195383184 X:104290159-104290181 GAGAATGAGGAAAGACAGAGGGG + Intergenic
1195820519 X:108940503-108940525 CTGAATGGGCAAAAGCTGAAAGG - Intergenic
1195844358 X:109209872-109209894 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1196091130 X:111744693-111744715 CAGCATGAGGAATAGCAGAATGG - Exonic
1196599821 X:117589426-117589448 GAGAATGAGGAAAAGCAGGGTGG + Intergenic
1197172366 X:123448530-123448552 CAGCTTAAGGAAAAGCAGAGAGG - Intronic
1197180767 X:123533661-123533683 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1197424116 X:126273505-126273527 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
1197489747 X:127102390-127102412 AAGGATGAGCCAAAGCAGGGTGG + Intergenic
1197640076 X:128958150-128958172 CAGTATGAGCAAAGACATAGAGG - Intergenic
1197779094 X:130141834-130141856 CAGACTGAGCGAAAGCTGAAGGG - Intronic
1197779390 X:130144507-130144529 CAGCATAAGCAAAAGCACAAGGG - Intronic
1197834167 X:130677061-130677083 CAGCATGAGCAAAAGTACAAAGG - Intronic
1197840449 X:130740631-130740653 CAGCATGAGCTAAACCAAAGGGG + Intronic
1198018233 X:132633137-132633159 CAGCATGAGCAGAGGCACAGAGG + Intronic
1198060648 X:133042490-133042512 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG + Intergenic
1198853789 X:140994935-140994957 CAGGATATGCAAAGGCAGAGAGG - Intergenic
1199230409 X:145430779-145430801 TCCAATCAGCAAAAGCAGAGAGG + Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199533038 X:148871102-148871124 CTGCATGAGAAAAAGCAGTGTGG + Intronic
1199564461 X:149199517-149199539 AAGAGTGAGGAAAAGTAGAGTGG - Intergenic
1199608504 X:149594854-149594876 CAGAATGTGCACATGCAGATGGG - Intergenic
1199630618 X:149774506-149774528 CAGAATGTGCACATGCAGATGGG + Exonic
1199758640 X:150888472-150888494 CAGAATGGGCAAATCCAGATAGG + Intronic
1200378434 X:155808939-155808961 GAGGGTGAGCAAAAGCAGGGCGG + Intergenic
1200549272 Y:4558585-4558607 AAGAGTGAGCAAAAGCAGTCTGG + Intergenic
1201298434 Y:12485668-12485690 AAGAAGGAGCAAAAGGAAAGAGG - Intergenic
1201460516 Y:14217644-14217666 CAAAATGTGCAAAAGGAGAATGG + Intergenic
1201611801 Y:15851524-15851546 GAAAGTGAGCAGAAGCAGAGTGG + Intergenic
1201953136 Y:19587086-19587108 CAAAATGTACAAAAGCATAGAGG + Intergenic
1202057348 Y:20848667-20848689 AAGCATGGGCCAAAGCAGAGTGG - Intergenic
1202335109 Y:23800819-23800841 CAGCATGAGCTGAAGCAGGGTGG + Intergenic
1202535658 Y:25869240-25869262 CAGCATGAGCTGAAGCAGGGTGG - Intergenic