ID: 906279121

View in Genome Browser
Species Human (GRCh38)
Location 1:44541574-44541596
Sequence ACTTCTGAGCACTAACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906279118_906279121 21 Left 906279118 1:44541530-44541552 CCACATTGTCTCCTAAACTGGAT 0: 1
1: 0
2: 2
3: 14
4: 240
Right 906279121 1:44541574-44541596 ACTTCTGAGCACTAACTGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 116
906279119_906279121 10 Left 906279119 1:44541541-44541563 CCTAAACTGGATCATGCTATCTC 0: 1
1: 0
2: 1
3: 6
4: 139
Right 906279121 1:44541574-44541596 ACTTCTGAGCACTAACTGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 116
906279116_906279121 26 Left 906279116 1:44541525-44541547 CCGTACCACATTGTCTCCTAAAC 0: 1
1: 0
2: 1
3: 15
4: 184
Right 906279121 1:44541574-44541596 ACTTCTGAGCACTAACTGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906279121 Original CRISPR ACTTCTGAGCACTAACTGGA AGG Intronic
906279121 1:44541574-44541596 ACTTCTGAGCACTAACTGGAAGG + Intronic
907799585 1:57751413-57751435 GCTCCTGAGCAGCAACTGGAGGG + Intronic
909643430 1:77891413-77891435 CCTGTTGAGCACTTACTGGATGG - Intronic
911702850 1:100974962-100974984 ACTCCCGAGCACTAAGTAGACGG + Intronic
912467031 1:109881416-109881438 ACTCCTCAGCACGACCTGGATGG - Intergenic
913382275 1:118225460-118225482 CCTTCTGAGCATGAACTGCAAGG - Intergenic
915251727 1:154594600-154594622 ACTTATGAGCACTAGCTGGTGGG - Intronic
916163136 1:161939737-161939759 ACTTCTGAGTCCTAAAGGGAAGG - Intronic
916532969 1:165675861-165675883 AATTCTGAGCTCTAATTAGAAGG + Intronic
920490998 1:206415320-206415342 ATTTCTGAGCACTCAGCGGAAGG - Intronic
1064156330 10:12906213-12906235 TCTTCTGAGGACTGTCTGGAGGG + Intronic
1065495426 10:26322478-26322500 ACTTCCAAGAACTAACTGTAAGG + Intergenic
1066802351 10:39206033-39206055 ACTTCTGACTTGTAACTGGAAGG - Intergenic
1070670967 10:78376956-78376978 ACTTCTGAGCTCAAACCAGAAGG + Intergenic
1070813275 10:79308993-79309015 ATTTCTGAGCTCTCACTAGAGGG + Intronic
1079211110 11:18461453-18461475 ACTTCTAAGCACTAACACAAAGG + Intronic
1081815233 11:45935469-45935491 AGGTCTGAACTCTAACTGGATGG + Intronic
1082893246 11:58162859-58162881 TCTTCTGAGGACAAAATGGAAGG + Intronic
1084471212 11:69360334-69360356 ACTTCTGGGAACTTACGGGAAGG - Intronic
1091727091 12:2853853-2853875 ACTTCTCAGCCCTGCCTGGAGGG + Intronic
1095370098 12:41456890-41456912 ACTTCTTGACACTAACTGAATGG + Intronic
1095852268 12:46823811-46823833 ACTTCTGAATAGTACCTGGAAGG - Intronic
1102742947 12:115224128-115224150 ACTTCTGAGCACTCTTTTGAAGG + Intergenic
1104856504 12:131904777-131904799 ACCTATGGGCACTCACTGGAGGG + Intronic
1106397058 13:29391316-29391338 ACTTCTGAGAACTATCTGAGGGG + Intronic
1107461145 13:40604588-40604610 ACTACAGAGAACTAACTGAAAGG + Intronic
1107646141 13:42496115-42496137 ACTTTTGAGCAAAGACTGGAAGG - Intergenic
1113374405 13:109750814-109750836 ACTTCTTAGAATTATCTGGAGGG - Intergenic
1113559948 13:111270925-111270947 ACTTCTGAGTAAGAACTGGGCGG + Intronic
1116473183 14:45309124-45309146 ACTCCAGAGAATTAACTGGAAGG + Intergenic
1117135950 14:52734245-52734267 ACTTCCCAGAACTAACTTGAAGG - Intronic
1117238739 14:53806198-53806220 ACTTCTGAGTAGGAACTTGATGG + Intergenic
1118149359 14:63173119-63173141 ACTTCTCTGCACAAACTGGCTGG + Intergenic
1131763758 15:95653060-95653082 ACCTCTGAGGACTAATTTGAGGG - Intergenic
1137730850 16:50688395-50688417 TCTTCTGAGCACTTCCTGCACGG + Intergenic
1139000144 16:62499602-62499624 AGTTTTCAGCACTCACTGGAGGG - Intergenic
1141289887 16:82708026-82708048 ACGTCTGAGCAACAGCTGGAAGG - Intronic
1147713457 17:42487339-42487361 CCTTCTGAGTGCAAACTGGATGG - Exonic
1149340043 17:55675952-55675974 CTTTCAGAGCATTAACTGGAGGG - Intergenic
1152563549 17:81090265-81090287 TCTTCTGAGCACTGACGGGAAGG + Intronic
1155169542 18:23257123-23257145 TCTCCTGAGCACTCACTGGCTGG + Intronic
1158758742 18:60358370-60358392 ACATCTGAGCAAAAACTTGAAGG + Intergenic
1159715776 18:71820686-71820708 GCTTCTGAGCAGTAAGTGGCCGG - Intergenic
1159891928 18:73961254-73961276 ACTTTTGAGCACAAACTTAAAGG + Intergenic
1165425692 19:35744290-35744312 ACTTCTGGGCCCTAAGTGGGGGG + Intronic
1165434441 19:35788422-35788444 ACTGCTGAGCACCAGCTGGGAGG + Exonic
925542367 2:4979675-4979697 AATCCTGAACACTAACTGAATGG + Intergenic
929680332 2:43987638-43987660 ACATCTAAGCACTCACTAGATGG - Intronic
934558514 2:95300184-95300206 GCTTGTGTGCACTCACTGGAGGG - Intronic
935142740 2:100368265-100368287 AGAGCTGAGCACTCACTGGATGG - Intergenic
936827345 2:116598506-116598528 ACATGTCAGCATTAACTGGAGGG - Intergenic
945307172 2:208269512-208269534 ACATATGAGGACTACCTGGAGGG - Intronic
945474383 2:210264145-210264167 ACTCCAGAGCACTGCCTGGAGGG - Intergenic
947233827 2:227919697-227919719 ACTTCAGATCACTGACTGGGTGG - Intronic
947714630 2:232333417-232333439 ACTGCTGAGCACCACCAGGAGGG - Intronic
1169151074 20:3289970-3289992 TCTTCTGAGCACTTCCTGTATGG - Intronic
1169797453 20:9479049-9479071 ACTTCTGAACACAAACTCCATGG + Exonic
1169820984 20:9709787-9709809 TCTTCTGAGCACAGACTTGAGGG + Intronic
1175140036 20:56854153-56854175 ACATTTGAGCAGAAACTGGAAGG - Intergenic
1180235446 21:46456817-46456839 TCTACTGAGCAGTAAGTGGAGGG + Intergenic
1180716486 22:17876069-17876091 CTCTCTGAGCACTAAGTGGAAGG - Intronic
1181789754 22:25255856-25255878 AATTCTGATCTCTAAGTGGATGG + Intergenic
1181824573 22:25504691-25504713 AATTCTGATCTCTAAGTGGATGG + Intergenic
949659493 3:6261597-6261619 AGTTTTGAGCAAAAACTGGAAGG - Intergenic
949695292 3:6687521-6687543 ACTTGTGAGAACTACCTGAAAGG - Intergenic
949790455 3:7786615-7786637 ACTTCTGAGCAGTTGCAGGATGG - Intergenic
951170413 3:19535242-19535264 ACTTCTGAGCTATAACTTGTGGG + Exonic
957351791 3:79032934-79032956 ACTTCTGTTCATTAACTAGATGG + Intronic
970878092 4:20896060-20896082 GCTTCTGAGGAGGAACTGGATGG + Intronic
973724496 4:53761548-53761570 ACTTCTGGGTATTTACTGGAAGG + Intronic
974762727 4:66299293-66299315 ACATATGAGCACTTACAGGAGGG + Intergenic
975992666 4:80275273-80275295 ACTTCTAAGAAATAAGTGGATGG - Intronic
976292127 4:83430493-83430515 ACATCTGAATACTAAATGGAGGG - Intronic
979732933 4:124046125-124046147 ACTTCTGTGACCTAACTGTATGG + Intergenic
980844811 4:138312010-138312032 TCTTCTGAGCAGTAACTCTAAGG - Intergenic
981426227 4:144606540-144606562 ACATCTGTGCAGTAACTTGAAGG - Intergenic
982057231 4:151564112-151564134 CCTTCTGAAAACTAACTTGAAGG + Intronic
983355786 4:166655911-166655933 ACTGCTGGGCACTTAGTGGATGG + Intergenic
986834927 5:11626234-11626256 ACTCCTGAGCATTAAGGGGAAGG - Intronic
987237799 5:15960544-15960566 ACTTCTGAGCAACAAAGGGAGGG + Intergenic
987899439 5:23992003-23992025 ACTTCTAATCACTAATTGCAAGG + Intronic
1000355087 5:160386636-160386658 AATTTTGAGCACTAACTGTCAGG - Intergenic
1001721722 5:173862385-173862407 AGTCCTGAGGACTAACAGGAAGG + Intergenic
1002649058 5:180678470-180678492 ACTTCTGAGTACTTACTGAAAGG - Intergenic
1002680587 5:180959884-180959906 AGTTCTGAGCACAAACTGCCTGG - Intergenic
1003130594 6:3392200-3392222 ACTTCTGAGCAGTGACCTGAAGG + Intronic
1006910763 6:37562038-37562060 ACTTCTGAGAATTAAATGAACGG + Intergenic
1012270350 6:97202292-97202314 ACTCCTGTGCACTAACAGAAGGG + Intronic
1012646465 6:101689775-101689797 AGTTCAGAGCACTAACTGGATGG - Intronic
1014411547 6:121128864-121128886 ACTTCTGAGTACTATCTGTTTGG - Intronic
1016012591 6:139153758-139153780 AATTCTGAGTACAAACTGAATGG - Intronic
1016713695 6:147201645-147201667 ATTTATGAGCATGAACTGGAGGG - Intergenic
1017998822 6:159560257-159560279 GCTTTTGAGCACCAACAGGAGGG + Intergenic
1021748677 7:23772908-23772930 ACTTCTGAGCACTGAATTGGGGG + Intronic
1021988612 7:26120852-26120874 ACTTCTGAGCCAAAACTTGAAGG - Intergenic
1024666423 7:51551364-51551386 ACTCATGAGCACTAGCAGGAAGG + Intergenic
1025203509 7:56977409-56977431 ACATTTGAGCACTGATTGGATGG - Intergenic
1025668434 7:63599519-63599541 ACATTTGAGCACTGATTGGATGG + Intergenic
1026571836 7:71538065-71538087 ACCACTTAGCACAAACTGGATGG - Intronic
1026678651 7:72448954-72448976 GCTTCTGAGCACCAATTGGCTGG - Intergenic
1031987585 7:128173125-128173147 ACTTCTCAGCAGTAACCAGAGGG + Intergenic
1034009639 7:147515189-147515211 ACATCTGGGCAATGACTGGATGG - Intronic
1035353371 7:158261888-158261910 CCTCCTGAGCACTAACTGTGTGG - Intronic
1038729859 8:30117007-30117029 ACTTCTGATCACCAAATGTATGG - Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041982704 8:63881508-63881530 AGTTCTGGGCACCAAGTGGACGG + Intergenic
1042311332 8:67381857-67381879 ATTTCTGAATACTATCTGGAAGG + Intergenic
1042501225 8:69511422-69511444 GATTCTGAGCCCTAACTGGCTGG + Intronic
1042894336 8:73650763-73650785 ACTTCTGTTCACTAATTTGATGG - Intronic
1043978546 8:86610780-86610802 ATTTCTGATCACTAACTTAAGGG - Intronic
1047832198 8:128647049-128647071 ACTTATGAGCTCTATGTGGACGG + Intergenic
1053358626 9:37466996-37467018 ACTTCCGACCAGTAACTGAAGGG - Intergenic
1055715681 9:79115370-79115392 TCTTCTGAGCAGTAAATGGAAGG + Intergenic
1058418393 9:104811606-104811628 ATTTCTCAGCAATAAATGGAAGG - Intronic
1059729039 9:117038374-117038396 TCTACAGAGCACTAACTGGAAGG + Intronic
1061058721 9:128239716-128239738 TCTGCTGAGCACTAATGGGAGGG - Exonic
1187769082 X:22675364-22675386 ACTTCTGAGAAAAGACTGGAAGG + Intergenic
1188524622 X:31075520-31075542 ACATCTGATCACCAGCTGGAAGG - Intergenic
1188569735 X:31569495-31569517 AATACTGATCACTAACTGTAGGG - Intronic
1193870625 X:86793540-86793562 ATTTCTGAGGACTGACTAGAAGG + Intronic
1196055574 X:111351486-111351508 ATTTCTGAGCACTTAATAGATGG - Intronic
1197616596 X:128698857-128698879 ACCTCTAACCACTAACTGCATGG - Intergenic
1199530196 X:148838111-148838133 GCTTGTGAGCAAGAACTGGAAGG - Intronic