ID: 906280258

View in Genome Browser
Species Human (GRCh38)
Location 1:44548447-44548469
Sequence GCTGAATGAAGGAGTCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906280258_906280265 28 Left 906280258 1:44548447-44548469 CCACCTAGACTCCTTCATTCAGC 0: 1
1: 0
2: 0
3: 16
4: 162
Right 906280265 1:44548498-44548520 TTTTTTTTTCTTTTTAGACAAGG 0: 11
1: 1064
2: 19833
3: 120446
4: 124110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906280258 Original CRISPR GCTGAATGAAGGAGTCTAGG TGG (reversed) Intronic
902465409 1:16614347-16614369 GCTGACGGATGGAGTATAGGAGG - Intergenic
902563714 1:17295875-17295897 GCTGAAGGAGGGATTGTAGGAGG - Intergenic
903036837 1:20498551-20498573 GGTGAATGAAGTGGCCTAGGGGG - Intergenic
903185430 1:21626310-21626332 GTAGAGTGAAGGAGTATAGGAGG + Exonic
904059990 1:27701408-27701430 GCTGAAGGTAGAAGTCTAGGGGG + Intergenic
904391700 1:30190244-30190266 GCTGCATGAAGGTCTGTAGGAGG + Intergenic
905034887 1:34911561-34911583 GGTGACTGAAGGAGTCTGGGAGG + Intronic
905136940 1:35807685-35807707 GCTGAATGAAGGGATGAAGGAGG + Intergenic
905271262 1:36789290-36789312 GCTGCAGGAAGGAGTGTGGGGGG + Intergenic
906280258 1:44548447-44548469 GCTGAATGAAGGAGTCTAGGTGG - Intronic
908337870 1:63145721-63145743 GCTGAGTAAAGGAGTTTGGGAGG - Intergenic
908685331 1:66712016-66712038 TCTGCAATAAGGAGTCTAGGAGG - Intronic
909283419 1:73785937-73785959 GCTAAATGAAAGAGTCAAGTGGG + Intergenic
909600124 1:77452678-77452700 GCTGAATGAAGGACTGAATGTGG - Intronic
910353176 1:86323341-86323363 AATGAATGAAGGAGAATAGGAGG - Intergenic
911094888 1:94047079-94047101 GTTCAAAGAAGGAGTCTTGGAGG + Exonic
913374430 1:118134863-118134885 GCTGAATGAAGAAGTCATGAAGG - Intronic
913679766 1:121178597-121178619 GATGAATGAATGAATATAGGCGG - Intronic
914031600 1:143966247-143966269 GATGAATGAATGAATATAGGCGG - Intronic
914157845 1:145101718-145101740 GATGAATGAATGAATATAGGCGG + Intronic
916958226 1:169862540-169862562 GCTGAAAGAAAGAGTTTTGGAGG - Intronic
918076305 1:181173869-181173891 GCTGATAGAAGGACTCTGGGAGG + Intergenic
918531955 1:185532668-185532690 GATAAATGAATGAGTCTAGGGGG - Intergenic
920467075 1:206197133-206197155 GATGAATGAATGAATATAGGCGG - Intronic
921372981 1:214444619-214444641 GCAGATTGCAGGAGTCTAAGGGG + Intronic
921567694 1:216739916-216739938 GAGGAATGAAGGAGTCTGGCAGG - Intronic
923336713 1:232977253-232977275 GGACAATGAAGGAGTCTGGGGGG - Intronic
1063408394 10:5817542-5817564 GCTGTATGAAGAAGTGCAGGGGG - Intronic
1063557491 10:7094667-7094689 GCTGAATGAGGAAGTGCAGGTGG - Intergenic
1065187526 10:23183382-23183404 TCTGAGTGTAGGAGTCCAGGAGG - Intergenic
1065797851 10:29323524-29323546 GCTGCATGAAGGAGTTTATCTGG + Intergenic
1067071778 10:43138040-43138062 GTTGAATGAGGGAGTTGAGGCGG - Intergenic
1069910583 10:71756647-71756669 GCTGACTGCAGGAGTTTAGCTGG + Intronic
1073033716 10:100548374-100548396 ACTGAATGCAGGACTTTAGGCGG - Exonic
1073696887 10:105879578-105879600 GCTGAATTAAAAAGTCTTGGAGG - Intergenic
1073726332 10:106235349-106235371 GCTGAATGATGGATTCTGGAAGG + Intergenic
1074891046 10:117736870-117736892 GCGGAATGAGGGAGTCTGAGGGG + Intergenic
1075215105 10:120525721-120525743 GCTGCATGTAGAATTCTAGGAGG + Intronic
1075399498 10:122150766-122150788 GCTGAGCGCTGGAGTCTAGGTGG + Intronic
1077705770 11:4483683-4483705 GTTGAATGGAGGAATCTAGGGGG + Intergenic
1078287227 11:9969323-9969345 GTTGAATGAAGGAGTACAGGTGG - Intronic
1080003455 11:27378365-27378387 GATGAAAGAAGGAGACTATGAGG + Intronic
1080886657 11:36374465-36374487 GTTGAATGAGGGAGACTGGGAGG + Intronic
1081737294 11:45412887-45412909 GCTGGGTGAAGGAGTGGAGGGGG - Intergenic
1081941503 11:46946312-46946334 GCTAAATGAATAATTCTAGGAGG + Intronic
1083332463 11:61905334-61905356 GCAGAATGAGGGAGGCTGGGAGG + Intronic
1083714525 11:64567929-64567951 TCTGAATGAGGGAGGCTATGAGG + Intronic
1084097390 11:66920652-66920674 ACAGAAGGAAGGAGTCAAGGCGG - Intronic
1084443497 11:69189909-69189931 GCTGGATGAATGAGGCCAGGAGG + Intergenic
1085039552 11:73318758-73318780 GCTGATTGCAGAGGTCTAGGTGG + Intronic
1087163459 11:94973812-94973834 CCGGAATGAAGGAGTCTGGGAGG - Exonic
1088577155 11:111283408-111283430 GTTGAGTGAAGGAGTCCATGAGG + Intronic
1088735158 11:112722815-112722837 GCTGAGTGAAGGTGGCTAGGGGG + Intergenic
1088911738 11:114197390-114197412 TCAGTGTGAAGGAGTCTAGGAGG + Intronic
1089535299 11:119157215-119157237 GCTGAATGAATAAGTCAATGAGG - Intronic
1090319234 11:125827678-125827700 GCTAAATGAAGGAGTTGGGGAGG + Intergenic
1091741454 12:2962931-2962953 GTTGGATGAAGGCGGCTAGGGGG - Intronic
1092148194 12:6229200-6229222 GCTGAATGAGGGCATCTAGGGGG + Intronic
1092803524 12:12196897-12196919 GGTGAACGAATGGGTCTAGGTGG - Intronic
1093908269 12:24717078-24717100 GCTGAACAAAAGAATCTAGGTGG + Intergenic
1094158861 12:27368591-27368613 TCTGAAGAAAGGTGTCTAGGAGG + Intronic
1096187520 12:49591432-49591454 GCTGGATGTAGAATTCTAGGTGG - Intronic
1096921641 12:55093521-55093543 TCAGAATGAAGGACTCTAGAGGG - Intergenic
1098947921 12:76608885-76608907 GAAGAATGAAGGAGACTTGGAGG + Intergenic
1102541451 12:113622372-113622394 GCTGAAGGAAGGGGGCTTGGTGG - Intergenic
1104771994 12:131369354-131369376 GCTGAAGGAAGGAGTCCTGAAGG - Intergenic
1105059601 12:133136714-133136736 CATGAATAAAGGAGTCTAAGGGG - Intronic
1111395712 13:87666672-87666694 GATGAATGAAGGATTCCAGTTGG + Intergenic
1112058914 13:95717487-95717509 GTTGAATGAAGGAGTTCAGTTGG + Intronic
1112984714 13:105434186-105434208 ACTGAGTGAACTAGTCTAGGAGG - Intergenic
1113246405 13:108401737-108401759 GATGAATGAAGGACTCTACAGGG + Intergenic
1114459331 14:22876876-22876898 GCTGAATGAAGGAGGGTACAGGG - Intronic
1120501473 14:85302714-85302736 GATGAACCAAGGAATCTAGGAGG - Intergenic
1121865033 14:97354946-97354968 GCTGATTGAAGGGTTCTAGCTGG + Intergenic
1125476234 15:40049905-40049927 GCTGGAAGAAGGAGTGAAGGTGG + Intergenic
1135944656 16:26855244-26855266 GCTGATGGAATGAGGCTAGGTGG + Intergenic
1136478059 16:30525539-30525561 CCTGAGTGAAGGAGTCCAGGGGG + Exonic
1137509586 16:49087246-49087268 TGTGAATGAAGGAGGCAAGGGGG + Intergenic
1138535817 16:57659783-57659805 GATGAGTGAAGGAGGCCAGGAGG - Intronic
1138592519 16:58009854-58009876 GCTGAATGAAGAAGCCCAGAAGG - Intronic
1143424630 17:6824861-6824883 GGTGCCTGAAGGAATCTAGGTGG + Intronic
1144832249 17:18138310-18138332 GAGGAATGAAGGAGTCAGGGTGG - Intronic
1146522547 17:33537350-33537372 GCTCAAGGAAGGCCTCTAGGAGG - Intronic
1149808039 17:59637824-59637846 GCTGAATTAAGCAGCCCAGGAGG + Intronic
1150136710 17:62699806-62699828 GCTGAATTAAGGAGTCAATAGGG - Intergenic
1151099500 17:71540453-71540475 GCTGAATGAAGGGGTTTTAGAGG + Intergenic
1153699456 18:7678031-7678053 ACTGAATGAAGGAGTCATAGGGG + Intronic
1158391734 18:57050365-57050387 GCTGAAGGAAGGAGTCTTCTGGG - Intergenic
1159234557 18:65653988-65654010 ACTGCATGAAGGAATCAAGGAGG + Intergenic
1159441891 18:68491462-68491484 AGTGAATGAATGAGTCTAAGAGG - Intergenic
1162841720 19:13361635-13361657 GCTGAATGAATGAATCTTGTTGG + Intronic
1166364889 19:42273312-42273334 GCTGCATGAAGGAGTCACAGCGG + Intronic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
924980661 2:217688-217710 GCTGAAGCAAGGAGTCTACGCGG + Intergenic
926693697 2:15755398-15755420 ACTGAATGAAGGAATCAATGAGG + Intergenic
927059527 2:19403141-19403163 GGTGAGTGAGGGAGGCTAGGAGG - Intergenic
931471924 2:62546893-62546915 GGGTAATGAAGAAGTCTAGGGGG + Intergenic
933463638 2:82621955-82621977 GCAGAATAAAGGAGTCTCTGTGG + Intergenic
933998235 2:87685648-87685670 GCTGAAGGAAGGAGGAAAGGGGG + Intergenic
935501171 2:103841301-103841323 GATGAATCAAGGAGTCAAAGAGG - Intergenic
935804088 2:106729422-106729444 GCACAATGAAGGAGGCTTGGGGG + Intergenic
936295615 2:111265225-111265247 GCTGAAGGAAGGAGGAAAGGGGG - Intergenic
937348166 2:121140907-121140929 GCTGAATGAAGGAGGGGTGGAGG + Intergenic
939902774 2:147870027-147870049 GCTGTATGAAGGGGTATAGGTGG + Intronic
942862137 2:180627580-180627602 GATGTATGAAGGAGTCAAGTTGG - Intergenic
949028863 2:241779004-241779026 GCTAAAGGGAGGAGTCTAGCTGG - Intronic
949030279 2:241792793-241792815 GCTAAAGGGAGGAGTCTAGCTGG + Intronic
1172449193 20:35009876-35009898 GCTGAATGCACGAGACAAGGCGG + Intronic
1174051424 20:47769999-47770021 GCTGAGTGAAGGGGGCTGGGGGG + Intronic
1175385615 20:58593073-58593095 GCTGAATGAAGGAGGCACAGGGG + Intergenic
1179632195 21:42685409-42685431 GCTGAATGACGAAGTCGAAGAGG - Intronic
1181310400 22:21941590-21941612 GCGGAATGAATGAGGATAGGGGG + Intronic
1183348173 22:37319327-37319349 GATGGATTAAGGAGGCTAGGTGG + Intergenic
1184272859 22:43394741-43394763 GGTGCATGAAGGGGTCTAGGAGG - Intergenic
1184926539 22:47644719-47644741 GGTGAAAGAAGAAGTCTCGGGGG + Intergenic
950157980 3:10738291-10738313 CCAGAATGAGGGAGGCTAGGGGG + Intergenic
955499814 3:59572629-59572651 GCTGAAGGAAGGCCTCCAGGAGG - Intergenic
956219079 3:66882971-66882993 GGTGAATCAAGGAGTCTAGAGGG + Intergenic
956787292 3:72653202-72653224 GGTGGATCAGGGAGTCTAGGTGG + Intergenic
958476546 3:94591256-94591278 CTTGAATGAGGGAGTCTAGAGGG + Intergenic
960385821 3:117020616-117020638 CCAGCATGATGGAGTCTAGGAGG + Intronic
961311839 3:126007335-126007357 GCTGGATGAAGGAGGCTGGCTGG - Intronic
961757695 3:129139580-129139602 GCTGAAAGAAGGAGGAAAGGTGG + Intronic
962910779 3:139847632-139847654 GGTGAGTGCAGGAGTCAAGGGGG + Intergenic
962944106 3:140151926-140151948 GAAGAAGGGAGGAGTCTAGGTGG + Intronic
963505913 3:146184269-146184291 GATGAATGAAGACTTCTAGGAGG + Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
967787681 3:193514960-193514982 GCAGAGTGAAGGAGTTGAGGAGG + Intronic
970591797 4:17566363-17566385 GGTGAAAGAATGAGTCTTGGTGG - Intergenic
974922101 4:68254687-68254709 GCTGAAAGATCAAGTCTAGGTGG + Intergenic
975534038 4:75430138-75430160 GCAGAATGTAGGAGTATTGGGGG + Intergenic
976832219 4:89328384-89328406 ATTAAATGAAGAAGTCTAGGTGG + Intergenic
977414979 4:96721663-96721685 CCTGAATGAAGGTGTAGAGGCGG + Intergenic
977783199 4:101003495-101003517 CCTGAATGTAGGATTTTAGGTGG + Intergenic
981826314 4:148946003-148946025 GCTGAAAGAGGGAGTCATGGAGG + Intergenic
983224472 4:165073098-165073120 GCTGAAATAAAGAGTCAAGGAGG + Intergenic
984211809 4:176859031-176859053 GTATAATGAAGGAGTCTATGGGG + Intergenic
984508817 4:180654306-180654328 GCTGAATAGGGCAGTCTAGGAGG + Intergenic
986027780 5:3866538-3866560 GGTGAGTGAAGGAGTGTGGGTGG - Intergenic
986195674 5:5534860-5534882 GCTGAATGCAGGGGTGTGGGGGG - Intergenic
987059335 5:14226937-14226959 GCTTAAAGTAGGAGTCCAGGAGG + Intronic
988986480 5:36624301-36624323 ACTGACTGAAGGAGTCTAAATGG - Intronic
991031496 5:62086783-62086805 GTTGCATGATGCAGTCTAGGTGG - Intergenic
991071248 5:62483688-62483710 GATGAATGAAGAAGTCTTGGTGG + Intronic
991143521 5:63274115-63274137 GCTGAATCCAGGAGGCTAAGCGG - Intergenic
995694843 5:114867138-114867160 GCTTAAAGAAGCAGTCTAGTGGG - Intergenic
997426366 5:133805312-133805334 GCTGAAGGAGGGAGTGGAGGCGG - Intergenic
998176358 5:139904380-139904402 GCAGAATGTCGGAGTCCAGGAGG - Intronic
1001652983 5:173328468-173328490 CTTGAATGAAGGAGTCGAGCAGG + Exonic
1003217273 6:4125780-4125802 GCTGAAGGTAGGAGACTCGGAGG - Intronic
1004872935 6:19925494-19925516 GTTGAATGAAGGACTGTAGAAGG - Intergenic
1006419135 6:33922587-33922609 GCTGAAAGAAAGGGTCTCGGTGG - Intergenic
1006673333 6:35743754-35743776 GGTGGATAAAGGAGTCTGGGTGG + Intronic
1007251783 6:40500215-40500237 GCTGGGTGAAGGAGTCTCTGAGG - Intronic
1010002698 6:70963650-70963672 GTAGAATGAATGAGTGTAGGTGG + Intergenic
1022012851 7:26323916-26323938 GCTGAATGAGGGAATCCAGTTGG + Intronic
1024748725 7:52437750-52437772 GCTGAGTGAAAGAAGCTAGGTGG - Intergenic
1028379891 7:90188351-90188373 GCTAAGTGAAGGAGTTTACGAGG + Intronic
1030788222 7:113689189-113689211 GCTGAAAGAAAATGTCTAGGTGG + Intergenic
1030788414 7:113692493-113692515 GCTGAAAGAAAATGTCTAGGTGG - Intergenic
1030988094 7:116265656-116265678 AGTGAATCAAGGAGTTTAGGGGG + Intergenic
1032870304 7:135977535-135977557 GCAGAATGAAGGAGGCCCGGGGG + Intergenic
1035797827 8:2375776-2375798 GATGCATGAAGGAATCTACGTGG + Intergenic
1037974190 8:23198076-23198098 ACTGAATGGAACAGTCTAGGTGG + Intronic
1039315024 8:36361740-36361762 GCTAGATGAAAAAGTCTAGGTGG + Intergenic
1039700115 8:39953361-39953383 TCTGAATGAACTATTCTAGGTGG - Intronic
1046518424 8:115293255-115293277 ACTGAATCAATTAGTCTAGGTGG - Intergenic
1047416243 8:124666905-124666927 GGTCAATGGAGGAGTTTAGGGGG + Intronic
1053399278 9:37802815-37802837 GCTGAAGGAAGGAGGCTGCGAGG - Intronic
1053595565 9:39557543-39557565 GTTGTTTAAAGGAGTCTAGGCGG + Intergenic
1054972836 9:71108424-71108446 GCTAGATGAATGGGTCTAGGTGG + Intronic
1059660923 9:116399251-116399273 TCTGAATGAAAGAGACTGGGTGG - Exonic
1061075985 9:128341509-128341531 GCTGATTGAGGGAGGCGAGGAGG - Intronic
1062262946 9:135671880-135671902 GCTGGCTGGAGGACTCTAGGAGG + Intergenic
1189281552 X:39822617-39822639 GATGAAGGAAGGAGGGTAGGTGG - Intergenic
1190257722 X:48776066-48776088 GATGAATTAAGGCGTCGAGGTGG - Intergenic
1190761670 X:53442316-53442338 GCTGACTGAAGGACTCCAAGGGG - Intergenic
1198051259 X:132955651-132955673 GCTGAAGCAGGGAGTCCAGGGGG - Intronic
1201239993 Y:11949353-11949375 TCTGAATGCATGAGTCTAGGGGG + Intergenic