ID: 906280407

View in Genome Browser
Species Human (GRCh38)
Location 1:44549598-44549620
Sequence ATGGGGAAGCAGAACTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 593}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906280407_906280421 22 Left 906280407 1:44549598-44549620 CCCTCCCAGTTCTGCTTCCCCAT 0: 1
1: 0
2: 6
3: 64
4: 593
Right 906280421 1:44549643-44549665 TCCTCCTGCTGCTTCTTAACTGG 0: 1
1: 1
2: 1
3: 21
4: 252
906280407_906280425 25 Left 906280407 1:44549598-44549620 CCCTCCCAGTTCTGCTTCCCCAT 0: 1
1: 0
2: 6
3: 64
4: 593
Right 906280425 1:44549646-44549668 TCCTGCTGCTTCTTAACTGGGGG 0: 1
1: 1
2: 1
3: 20
4: 230
906280407_906280424 24 Left 906280407 1:44549598-44549620 CCCTCCCAGTTCTGCTTCCCCAT 0: 1
1: 0
2: 6
3: 64
4: 593
Right 906280424 1:44549645-44549667 CTCCTGCTGCTTCTTAACTGGGG 0: 1
1: 1
2: 1
3: 17
4: 249
906280407_906280423 23 Left 906280407 1:44549598-44549620 CCCTCCCAGTTCTGCTTCCCCAT 0: 1
1: 0
2: 6
3: 64
4: 593
Right 906280423 1:44549644-44549666 CCTCCTGCTGCTTCTTAACTGGG 0: 1
1: 1
2: 3
3: 45
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906280407 Original CRISPR ATGGGGAAGCAGAACTGGGA GGG (reversed) Intronic
900375409 1:2352220-2352242 AGGGGGAAGCATAAGTGGCAAGG - Intronic
901749641 1:11397828-11397850 ATTGGGAACCAGCCCTGGGAAGG - Intergenic
902279334 1:15362852-15362874 AAATGGAAGCAGCACTGGGAAGG - Intronic
902279350 1:15362934-15362956 AAGTGGAAGCAGCACTGGGAAGG - Intronic
902292661 1:15445523-15445545 CTTGGGAAGCAGGACTGGGTTGG - Intronic
902797279 1:18807885-18807907 ACCGGGAAGGAGAACTGGGAAGG - Intergenic
902935212 1:19760043-19760065 CTGGGGGAGCAGGACTTGGAGGG - Intronic
903055767 1:20634918-20634940 ATGAGCAATAAGAACTGGGATGG - Intronic
903328683 1:22585999-22586021 ATGAGGAAGCAGGCCAGGGATGG - Intronic
904078314 1:27856404-27856426 AAGCGGAAGCAGAACTGGGGAGG + Intergenic
904162954 1:28534947-28534969 ATGGGGATGGAGAAGTGGGCAGG - Intronic
904823787 1:33261777-33261799 TTGGGGAAACTGAAGTGGGAAGG + Intronic
904911475 1:33937454-33937476 ATGGGGAAGTGGAAGTGGGCAGG + Intronic
905011152 1:34747914-34747936 TGGGGGAAGCAGGTCTGGGAGGG - Intronic
905025583 1:34847243-34847265 CTGGGCAAACAAAACTGGGAGGG + Intronic
906077000 1:43059052-43059074 TTTGTGAAGCAGAACTGGGCAGG - Intergenic
906138992 1:43522110-43522132 AAGGGGAAGCCGAACAGAGAAGG - Intergenic
906156189 1:43615361-43615383 ATGGGGAAGCAGGGCTGCGCTGG - Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906477933 1:46182333-46182355 ATGGAGAAGGAGCAGTGGGAGGG + Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907275028 1:53312175-53312197 ATGGGGAAACAGGCCAGGGAGGG + Intronic
907297968 1:53467631-53467653 AAGGGGAGGTAGAACAGGGAGGG - Intergenic
907627435 1:56043816-56043838 TCTGGGAAGCAGAACTGAGAAGG - Intergenic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908448822 1:64229490-64229512 ATGGGGAAACAGACCTGGAGAGG + Intronic
909333082 1:74438509-74438531 ATGAGGATTTAGAACTGGGAGGG + Intronic
909494113 1:76259024-76259046 ATAGGGAAACAGAATTGAGAAGG - Intronic
911058561 1:93728579-93728601 ATGGGGAAGCCAAAAAGGGATGG + Intronic
911069084 1:93817878-93817900 TAGGGGAAGGTGAACTGGGAGGG - Intronic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
911864770 1:103004004-103004026 ATGAGGAAACTGATCTGGGAAGG - Intronic
912386373 1:109273088-109273110 CTTGGGAAGCAGGACTGGGGTGG + Intronic
912560997 1:110551484-110551506 ATGGGGAAGAGGGAGTGGGAGGG + Intergenic
912875565 1:113355199-113355221 CTTGGGAGGCAGAAGTGGGAGGG - Intergenic
913057896 1:115179117-115179139 TTGGGGGAGGAGAATTGGGAAGG + Intergenic
913217734 1:116634664-116634686 ATGGGTAAGCAGAGCAGGCACGG - Intronic
914214604 1:145613892-145613914 ATGGGGAGGCTGAAGTGGAAGGG - Intronic
914466546 1:147934282-147934304 ATGGGGAGGCTGAAGTGGAAGGG - Intronic
914542820 1:148632287-148632309 TTTGGGAGGCAGAAGTGGGAGGG + Intronic
914818852 1:151084152-151084174 TTAGGGAGGCAGAAGTGGGAGGG - Intronic
915167578 1:153957128-153957150 GTGGGGAGGCAAATCTGGGAGGG - Intronic
915565699 1:156711457-156711479 ATGGGGTAGGAGTACTGGGCAGG - Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
916502160 1:165396508-165396530 GTGGGGAGGGAGAGCTGGGAGGG - Intergenic
916960423 1:169882946-169882968 ATGTGGAAGCGGACCTGAGAGGG - Intronic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
919557634 1:199079498-199079520 ATTGGGAAGTTGAAATGGGATGG - Intergenic
919802416 1:201361704-201361726 ATGGGGAAAGAGAACTGAGCAGG - Intronic
920133739 1:203753200-203753222 GTGGGGGACCAGAACAGGGAAGG - Intergenic
920370443 1:205475690-205475712 ATAGGGAAGGGAAACTGGGAAGG - Intergenic
920507158 1:206524725-206524747 ATGGGGCAGAAGAGATGGGAAGG + Intronic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
920979013 1:210814565-210814587 ATGAGAAAGCAGCACTGGAATGG + Intronic
921403533 1:214753476-214753498 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
921456807 1:215380803-215380825 AAGGGGAGGAAGAAGTGGGAAGG + Intergenic
921932538 1:220766349-220766371 GTGGGAAACTAGAACTGGGAGGG - Intronic
922223761 1:223627926-223627948 GTGGGGAGGCAGACGTGGGAGGG + Intronic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923040265 1:230314979-230315001 AAGGGGAAGAAGAGCTTGGAGGG + Intergenic
923260549 1:232264006-232264028 ATGGAGAGGCAGAACTGGACTGG - Intergenic
923536002 1:234852293-234852315 TTGGGGAAGCTGGTCTGGGAAGG - Intergenic
1062915819 10:1240659-1240681 ATGGGGAACCAGCACAGGGGAGG - Intronic
1064205378 10:13319593-13319615 CTGGGAAAGCTGAAGTGGGAGGG - Intronic
1064569867 10:16681683-16681705 ATGGGGAAGCTGAGGTGGGTGGG + Intronic
1064682459 10:17824830-17824852 ATGGGGAAACAGAAAGGGTAGGG - Intronic
1065408727 10:25397740-25397762 ATGTGGAAGCAGAACCTGGGAGG - Intronic
1066269479 10:33808398-33808420 CAGGTGAAGCAGAACTGGGGAGG - Intergenic
1067691306 10:48504047-48504069 ATGGGGAAGGAGGGATGGGAAGG + Intronic
1067752250 10:48979337-48979359 AAGTGGAAGCAGATATGGGAGGG - Intronic
1068886749 10:62105446-62105468 GTGGGGAAGCAGGACTTGTAGGG + Intergenic
1069422700 10:68261117-68261139 ATGGCTGAGCAGAACTAGGAGGG + Intergenic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070077077 10:73146993-73147015 TTTGGGAAGCAGAGGTGGGAGGG + Intronic
1070170508 10:73929356-73929378 AGGGAGATGCAGATCTGGGAAGG + Intergenic
1070817950 10:79336949-79336971 GTGGGGAAGCAGGGCTGGGCAGG - Intergenic
1071273513 10:84030808-84030830 ATGGGAAAGCAGATCTTGTAGGG + Intergenic
1071508308 10:86246080-86246102 CTGGGAGAGCAGAGCTGGGAAGG - Intronic
1072158693 10:92746835-92746857 AGGAGACAGCAGAACTGGGAAGG - Intergenic
1072415899 10:95246641-95246663 ATGAGAAAACAGACCTGGGAAGG + Intronic
1072808804 10:98444236-98444258 GTGGGGAAGGAGATTTGGGAGGG - Intronic
1073190375 10:101646599-101646621 CAGGGGACGCAGAGCTGGGAGGG + Intronic
1073768415 10:106708769-106708791 GTGGAGAAGCAGGAATGGGAAGG - Intronic
1074966607 10:118496352-118496374 ATGGGGTGGCAGGCCTGGGAAGG - Intergenic
1075347745 10:121696700-121696722 ATGGAAAAGCAGATCTTGGATGG - Intergenic
1075589142 10:123678780-123678802 CAGGGGAAGCAGAACTCTGATGG - Intronic
1076258673 10:129048802-129048824 TTGGGGACACAGAACAGGGAGGG + Intergenic
1076412488 10:130262041-130262063 CTGGGGAGGCAGAACCGGGCAGG - Intergenic
1077440860 11:2568357-2568379 ATGGGTCAGCAGAGCTGGGCTGG + Intronic
1078015090 11:7606397-7606419 ATGGGGAAGTAGAGCTGGACTGG + Intronic
1078267685 11:9767037-9767059 ATGGCGAAGGGGGACTGGGAGGG - Intergenic
1078508038 11:11966516-11966538 CTGGGGATGCAGAGCTGGGGAGG + Intronic
1079074493 11:17375548-17375570 ATGGGCAAGGAGAACTAGAAAGG - Exonic
1079277972 11:19059332-19059354 ATGGGGAAATAGAAATTGGAAGG + Intronic
1079392116 11:20031628-20031650 AGTGGGAAGCAGAGCTGAGAGGG - Intronic
1080755985 11:35199418-35199440 AAGGAAAAGCAGAACTGTGATGG - Intronic
1081426266 11:42929604-42929626 AGGGAAAAGCAGAGCTGGGATGG - Intergenic
1081520138 11:43873537-43873559 AGGTGGAAGCAGAGCTTGGAGGG - Intergenic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1082813917 11:57495883-57495905 ATGAGAAAGCAGAGCTTGGAGGG + Intronic
1083208823 11:61169963-61169985 GCAGGGAAGCAGGACTGGGAAGG + Intergenic
1083261408 11:61524980-61525002 ATGGGGAAGCATCGGTGGGAGGG + Intronic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1084884679 11:72195932-72195954 GTGGGGAAGTAGAAATGGAAAGG - Exonic
1085084732 11:73659428-73659450 ATGGGGGAGCAGACCTGGAGAGG - Intronic
1086344106 11:85878333-85878355 ATGAGGGGGCAGAACTGGGAGGG - Intronic
1086371992 11:86164196-86164218 ATCGGGAAGTTGAAGTGGGATGG + Intergenic
1086596147 11:88573656-88573678 ATGGGGATACAGAACTGACAAGG + Intronic
1087208307 11:95419631-95419653 ATGGGGTAGGAGAACTGCCAGGG + Intergenic
1087345195 11:96963208-96963230 ATAGGGGAGAAGAAATGGGATGG + Intergenic
1087641895 11:100763963-100763985 AAGAGGAAGAAGAACTGGGAAGG - Intronic
1087953736 11:104257736-104257758 AGGGGGCAGCAGAGCTGGAAAGG + Intergenic
1088176407 11:107057418-107057440 ATGGGGAACAAAGACTGGGAGGG + Intergenic
1089201054 11:116724964-116724986 AGGGGGAAGGAGGACAGGGAGGG - Intergenic
1090338446 11:125992511-125992533 ATGGGAAAGCAGAGCCTGGAAGG - Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1092087246 12:5773215-5773237 ATGGGGAAGCAACAATGGGAGGG - Intronic
1092950386 12:13498256-13498278 GGGGGGAAGCAGAACTGAGAGGG + Intergenic
1093929233 12:24938212-24938234 ATGTGGAAACAGTACTGGGCAGG + Intronic
1094111395 12:26866458-26866480 CTGGGGAGGCTGAAGTGGGAGGG - Intergenic
1095669738 12:44844531-44844553 ATGGGGAAGGAGGAGTGGCAGGG + Intronic
1095930005 12:47615877-47615899 ATGAGGAAGGAGGACTGGGGAGG + Intergenic
1096093839 12:48921291-48921313 ATGCTGAAGCAGTACTTGGATGG + Exonic
1096103637 12:48984122-48984144 GTGAGGAATCAGAACTGAGATGG - Intergenic
1096869987 12:54587149-54587171 ATTGGGAAGCTGAAGTGGTAGGG + Intronic
1097166605 12:57089445-57089467 GTGGGGAAGCAGGACGGGGGTGG + Intronic
1097658286 12:62396649-62396671 AAGGGGAAGGAGAACGTGGAGGG - Intronic
1097787522 12:63778234-63778256 ATAGGGAACCAGACCTGAGAAGG - Intergenic
1098739537 12:74154951-74154973 CTGGGGAAGCTGAAGTGGGAGGG - Intergenic
1099147522 12:79065274-79065296 CTAGGGAAGCTGAAGTGGGAGGG + Intronic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1102230239 12:111257225-111257247 AAGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230290 12:111257385-111257407 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230297 12:111257404-111257426 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230304 12:111257423-111257445 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230311 12:111257442-111257464 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230318 12:111257461-111257483 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230325 12:111257480-111257502 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102275034 12:111575418-111575440 ATGGGGAGGCTGAAATGGGAAGG - Intronic
1103426950 12:120844276-120844298 ACGGGGAAACAGAAGTGGAAGGG - Intronic
1103662701 12:122534200-122534222 GTGGGGATGCAGCACTGGCATGG - Intronic
1103793796 12:123489840-123489862 GTGGGCCAGCAGCACTGGGATGG - Intronic
1103985627 12:124765595-124765617 AGAGGGCAGGAGAACTGGGAGGG - Intergenic
1106764216 13:32897702-32897724 ATGAGGAAGCAGAGCTCGCAGGG - Intergenic
1107436612 13:40385987-40386009 AAGGGGAAGGAGACCTGGGAAGG - Intergenic
1108176512 13:47798213-47798235 ATGGGGAGGGAAAACTGGGAGGG + Intergenic
1108206024 13:48091540-48091562 ATGGGGAAGTAGTAGTGGGAAGG - Intronic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1109453545 13:62551383-62551405 ATGCTGAAGCAGAACTGTCATGG - Intergenic
1110743341 13:79023282-79023304 ATTGGGAAGAAAAAATGGGATGG + Intergenic
1110776303 13:79411928-79411950 GGGGGGAAGCAGAATTGGGTGGG - Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113129319 13:107017677-107017699 AGATGGAAGCAGCACTGGGAAGG - Intergenic
1114231902 14:20790718-20790740 ATGGGGAGCCAGAAGAGGGAAGG - Intergenic
1114238768 14:20846857-20846879 ATGGGGAAAGATAACTGGTACGG + Intergenic
1114262268 14:21045836-21045858 TTGGGGAAGTATAACTGTGAAGG + Intronic
1114625333 14:24125296-24125318 ATGGGAAAGGAGATCTGGCACGG - Intronic
1114753967 14:25237657-25237679 ATGAGGAAGCAGGACAGGAAAGG - Intergenic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1117898418 14:60510137-60510159 GTGGGGAAGCAGAGCCGGCAAGG - Intronic
1119442137 14:74635571-74635593 ATGTGGATGCAGAATTGGAAGGG + Intergenic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120823526 14:88934785-88934807 AGAGCAAAGCAGAACTGGGAGGG - Intergenic
1121921723 14:97888275-97888297 ATGGACAAGCAGGCCTGGGATGG + Intergenic
1121940100 14:98062491-98062513 ATGGGCAAGGAGAACTTGGAAGG - Intergenic
1122069971 14:99199981-99200003 TTGGGGAAACAGAACTGGTGAGG - Intronic
1122282003 14:100629102-100629124 AGCAGGAAGCAGAACAGGGAAGG + Intergenic
1122698456 14:103570371-103570393 ATGGGCAAGAAGAACTGTCAGGG - Intronic
1124232357 15:27956442-27956464 ATGAGGAAACAGACCTGGGGAGG - Intronic
1124654546 15:31497851-31497873 GTGGGGAAGAGGAAATGGGAAGG + Intronic
1125886781 15:43235312-43235334 AGGGGGAAGGAGAAGAGGGAAGG + Intronic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1127712272 15:61611242-61611264 ATGGTGTAGGAGAACAGGGAGGG + Intergenic
1127819581 15:62643313-62643335 ATGGGGAGCCAGAAGTGAGAAGG + Intronic
1127836111 15:62792599-62792621 ATGGGGAAGGAGAAGCGTGATGG - Intronic
1127854317 15:62942162-62942184 ATAAGGAAACAGACCTGGGAAGG + Intergenic
1128314297 15:66650607-66650629 ATGGGGAAGTGGGACAGGGAGGG + Intronic
1128622597 15:69162662-69162684 GATGGGAAGCTGAACTGGGAGGG - Intronic
1128706121 15:69838466-69838488 TTGGGGCAGCAGAATTGTGAGGG - Intergenic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1131413239 15:92228826-92228848 AAGGGGAAGCAGAACAAGAAAGG + Intergenic
1131641209 15:94295805-94295827 TTTGGGAGGCTGAACTGGGAGGG + Intronic
1132066164 15:98732887-98732909 GTGGGGAAGGATCACTGGGAAGG + Intronic
1132629738 16:911504-911526 ATGGGGAGGCAGCACTGGGGAGG + Intronic
1132629744 16:911518-911540 CTGGGGAGGCAGCACTGGGGGGG + Intronic
1132629795 16:911647-911669 ATGGGGGGGCAGCACTGGGGGGG + Intronic
1132629807 16:911689-911711 CTGGGGGAGCAGCACTGGGGAGG + Intronic
1132629811 16:911703-911725 CTGGGGAGGCAGCACTGGGGAGG + Intronic
1133013590 16:2928777-2928799 ATGGGGAACCAGCACAGGGCTGG - Intronic
1133050055 16:3112534-3112556 ATGGGGAATGGGATCTGGGAGGG + Intergenic
1133414454 16:5595454-5595476 ATGAGGGAGCAGAACTTGCAGGG + Intergenic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1133738439 16:8633094-8633116 CTGGGGAAGAGGAACTGGGCAGG + Intronic
1134005618 16:10817377-10817399 AGCTGGAAGCAGAACTGGGTGGG + Intronic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1134401405 16:13913672-13913694 TGGGGGAAGCAGAACAGGAAAGG - Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134843148 16:17417478-17417500 ATGAGCAAGCAGGAATGGGAAGG - Intronic
1134891573 16:17845913-17845935 ACGGGGAAGGAGGACAGGGAGGG + Intergenic
1135125285 16:19804543-19804565 CTTGGGAGGCTGAACTGGGAGGG - Intronic
1135674848 16:24406635-24406657 ATGGGGAATTAGAAAGGGGATGG - Intergenic
1136224708 16:28851294-28851316 TTGGAGAATCAGAACTGGGGAGG - Intronic
1136412953 16:30087473-30087495 ATGCAAAAGCAGAACTGTGACGG - Intronic
1136930253 16:34411808-34411830 ATGGGAAAGGAGAGATGGGAGGG + Intergenic
1136974321 16:34999997-35000019 ATGGGAAAGGAGAGATGGGAGGG - Intergenic
1137250960 16:46740657-46740679 CTCGGGAGGCTGAACTGGGAGGG - Intronic
1137551200 16:49438720-49438742 GTGGGGGAGCAGAACTGAGAGGG + Intergenic
1138706935 16:58924788-58924810 TTGGGGAGGCAGAAGTGGGCTGG - Intergenic
1138748420 16:59390469-59390491 AAGAGAAAGCAGAACTGGGGAGG - Intergenic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139645617 16:68327542-68327564 ATGGGGGAGGAAGACTGGGAAGG + Intronic
1139837265 16:69849203-69849225 ATTGGGAAGCAGAGCTAGCAGGG + Intronic
1140131586 16:72166593-72166615 AGGGGGAAGCAGGACAGGGAAGG + Intronic
1140461928 16:75146830-75146852 CTTGGGAGGCTGAACTGGGAGGG + Intergenic
1141008003 16:80371327-80371349 ACGGGAAAACAGGACTGGGAAGG + Intergenic
1141047998 16:80734542-80734564 ATAGGGAAGCAGGTTTGGGAAGG + Intronic
1141082117 16:81061707-81061729 CAGGGGAGGCAGAACTAGGAGGG + Exonic
1141662302 16:85448007-85448029 AGGGAGAAGCAGAGCTGGGAAGG + Intergenic
1141883333 16:86874403-86874425 GTGGGGAGGCAGGACAGGGAAGG - Intergenic
1142141823 16:88476013-88476035 ATGGGGCACCAGCATTGGGAGGG - Intronic
1142194151 16:88731897-88731919 ATCAGGAAGCAGATCTGGGGAGG + Exonic
1143855637 17:9846371-9846393 TTTGGGAAGCTGAAGTGGGAGGG + Intronic
1144067375 17:11636767-11636789 AGGAGGAAGCAGAACTTGGTAGG + Exonic
1144080929 17:11763166-11763188 AGAGGGAAGAAGAAGTGGGAGGG + Intronic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144373645 17:14617545-14617567 GTGAGGAAGTAGAACAGGGAAGG + Intergenic
1144594041 17:16551157-16551179 AAGGGGAAGTAAAACAGGGAAGG + Intergenic
1144711791 17:17406079-17406101 ATGAGGAAGCAGCCCAGGGAGGG - Intergenic
1144838330 17:18170079-18170101 CTGCAGAAGCAGATCTGGGAAGG - Intronic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1147996262 17:44362044-44362066 CTGGGGAAACAAAACTGGGGTGG + Intronic
1148116094 17:45175984-45176006 AGTGAGAAGAAGAACTGGGATGG - Intergenic
1149003543 17:51781074-51781096 TTGGGGAGGAAGAACTGGGAGGG + Intronic
1150120725 17:62599512-62599534 ATGGGAAGGCAGAAATGGGAGGG + Intronic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1150724731 17:67642433-67642455 AGGGGGTAGCAGAAGAGGGAAGG - Intronic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151185880 17:72363607-72363629 GTGGGGAAGCTGAGCTAGGAAGG - Intergenic
1151390555 17:73784191-73784213 ACGGGGAAGGGGAGCTGGGAGGG + Intergenic
1151898808 17:76998097-76998119 TGGGGAAAGCAGAACAGGGACGG + Intergenic
1152172263 17:78759518-78759540 ATGGGGAAGCTAAAGTGGGTAGG + Intronic
1152231551 17:79116543-79116565 ATTGGAAAGCAGAAGTGAGAGGG + Intronic
1152315679 17:79579105-79579127 AGTGGGAAGCAGAGCTGGGCAGG - Intergenic
1152377963 17:79928394-79928416 ATGGGGAAGTGGGAGTGGGAGGG + Intergenic
1152397067 17:80039933-80039955 AAGGGGAAGCAGCAGTGGAAGGG + Exonic
1153842753 18:9021945-9021967 CTGGGGAGGCTGAAGTGGGAGGG - Intergenic
1154060552 18:11055959-11055981 CTGGGGAACCAGATCTCGGAAGG - Intronic
1154139172 18:11808067-11808089 ATGGGTAAGAAGACCTGTGAGGG - Intronic
1155171319 18:23268662-23268684 CTGGGGCAGCAGGACTAGGATGG + Intronic
1156656915 18:39299267-39299289 ATTTGGAATCACAACTGGGAAGG - Intergenic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG + Intergenic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1159482224 18:69004293-69004315 AGGGAGAAGTAGGACTGGGAGGG + Intronic
1160951276 19:1668816-1668838 ATGGGGAAGGAGAATTTCGAAGG + Intergenic
1160964871 19:1742921-1742943 TTGGGGGATCAGATCTGGGAGGG - Intergenic
1161290894 19:3492764-3492786 ATGGGGAAGCAGCGGTGGAAAGG + Intronic
1164966021 19:32484729-32484751 AAGAGGAAGCAGAACTTGCATGG - Exonic
1165101571 19:33441539-33441561 GTGGGGAAGGAGGACTGGGTGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166459573 19:42974373-42974395 ATGGGGATGGAGAATTGGAATGG - Intronic
1166476891 19:43134409-43134431 ATGGGGATGGAGAACTGGAATGG - Intronic
1166677720 19:44749409-44749431 ATGAGGAAGCTGAGCTGGGCTGG + Intronic
1167483631 19:49747507-49747529 GTTGGGAGGCAGAACTGGAATGG - Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167607942 19:50491460-50491482 ATGGAGAGGCGGAGCTGGGAAGG + Intergenic
1167874631 19:52401480-52401502 CTGGGGAAGCAGATCAGGCAGGG - Intronic
1168326194 19:55539664-55539686 CTGTGGGAGCAGAACTGGGAAGG + Intergenic
1168651907 19:58097355-58097377 ATGGGGAAGGAGTGATGGGAGGG + Intronic
1168709398 19:58490051-58490073 CTGGGGAGGCTGAAGTGGGAGGG - Intronic
925065503 2:926508-926530 ACAGGGCCGCAGAACTGGGAAGG + Intergenic
925411443 2:3642068-3642090 ATCGGTTGGCAGAACTGGGAGGG + Intronic
927190190 2:20512112-20512134 ATGGGGAAGAAGAACCAGGGTGG + Intergenic
927260469 2:21083499-21083521 ATGGGGAAGCAGAAGAGTGCTGG + Intergenic
927576818 2:24207586-24207608 GGGTGGAAGAAGAACTGGGAAGG + Intronic
927578298 2:24219077-24219099 AGGAGGAAACAGAAGTGGGATGG - Intronic
928276351 2:29903873-29903895 ATGCTGAAGCATGACTGGGAAGG - Intronic
928333707 2:30377654-30377676 ATGGGGAAGTGGAACAGGGACGG - Intergenic
928891952 2:36214710-36214732 AGGAGGAAGCAGGACTGGGGAGG + Intergenic
929568601 2:43006038-43006060 AAGGAGAAGCAGAAATGAGAAGG - Intergenic
929692644 2:44087302-44087324 CAGGGGAAGCGGACCTGGGACGG - Intergenic
930672681 2:54167992-54168014 ATTGGGATGGAGAAATGGGATGG - Intronic
930977323 2:57479092-57479114 ATGGGGAGGCTGTATTGGGATGG - Intergenic
931343141 2:61422244-61422266 CTGGGGAAGGAAAACTGGCATGG - Intronic
932428967 2:71662074-71662096 ATGGGGAAACAGGCATGGGAGGG - Intronic
932452894 2:71827064-71827086 TTAGGGATGCAGGACTGGGAAGG + Intergenic
932666475 2:73702456-73702478 ATGGAGAAGCCTAGCTGGGAAGG - Intergenic
932824065 2:74924475-74924497 ATGGGGTGGCAGAACTGGGAAGG + Intergenic
933374343 2:81460396-81460418 ATGAGGGAGGATAACTGGGAAGG - Intergenic
933633347 2:84680907-84680929 ATGGGGAAGCTGAAGTGTGAGGG + Intronic
934785222 2:97000223-97000245 GTGGGGAGGCTGAAGTGGGAGGG - Intronic
934851961 2:97707285-97707307 GTGGGGAAGAAGAACTGGGTGGG + Intergenic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
935239034 2:101162199-101162221 ATGAGGGAGCAGAACTAGGCAGG + Intronic
935681742 2:105644295-105644317 CTGGGAAACCATAACTGGGACGG - Intergenic
936090375 2:109498291-109498313 CTGGGGAAGCAGAACAGGCCAGG - Intronic
936582604 2:113716496-113716518 ATGAGGAGGCAGAACTGATATGG + Intronic
936977878 2:118237459-118237481 TTTGGGAAGCAGGACAGGGAAGG + Intergenic
937286661 2:120758379-120758401 AGGGGAAAGCGGAAGTGGGAAGG + Intronic
937337160 2:121069102-121069124 ATGGTGCAGCAGGGCTGGGAGGG + Intergenic
937398148 2:121556948-121556970 ATTTGGTAGCAGAACTAGGATGG - Intronic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
938775613 2:134538823-134538845 ATGGGGAAGGAGACCTGGGAGGG + Intronic
939075249 2:137594066-137594088 GAGGGGAAGCAGAACTGAAAAGG + Intronic
939187526 2:138878368-138878390 CTTGGGAAGCAGGACAGGGAAGG + Intergenic
939817723 2:146916880-146916902 TTGGGGAAGTAGAACAGGTATGG + Intergenic
940256775 2:151739292-151739314 ATGGGGAAGCTCACCTGGCAAGG + Intergenic
940915780 2:159254315-159254337 ATTGGGAGGCCGAGCTGGGAGGG + Intronic
941158737 2:162010900-162010922 CTGGGGAAGCATAATAGGGAGGG - Intronic
941309619 2:163912599-163912621 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
941866774 2:170343563-170343585 ATGGGGAAGGAACAGTGGGAAGG + Intronic
942480662 2:176384877-176384899 ATGGGGAAACAGAAGTGATAGGG + Intergenic
942578345 2:177390233-177390255 ATAGGGAAGCATAAAAGGGAGGG + Intronic
942983174 2:182106525-182106547 ATGGGGAGCCAGAAGTGGGATGG - Intronic
943055149 2:182968214-182968236 ATAGGGAAGCATGACTGGGAAGG + Intronic
943354811 2:186839878-186839900 AGGGGGAAGCAGCAAAGGGATGG - Intronic
943621899 2:190158071-190158093 ATAGAGAAACAGAACTGGGCAGG - Intronic
944104947 2:196069516-196069538 ATGTGGAAGCTGAAATGTGAAGG + Intergenic
944825925 2:203483095-203483117 ATGGGAAAGCAGATCAGGCAAGG + Intronic
944860833 2:203814505-203814527 ATGGGGAAGCACAGCTGGATGGG + Intergenic
945827173 2:214736398-214736420 ATTGGGAAGGAGATTTGGGAAGG - Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946179712 2:217942152-217942174 ATGGGGAAGCAGAGCCAGAAGGG + Intronic
946199599 2:218064195-218064217 ATGGGGAAGCAGAGCCAGAAGGG + Intronic
946602755 2:221370211-221370233 ATTGGGAGGCTGAAGTGGGAGGG + Intergenic
946974960 2:225138541-225138563 AAGAGGAAGCAGAATTGGGTAGG + Intergenic
947911190 2:233802060-233802082 CTGGGGAAGCAGGGATGGGATGG + Intronic
948594998 2:239074055-239074077 GTGGGGAAGCAGGACTGAGGGGG + Intronic
948671222 2:239570098-239570120 ATTTGAAAGCAGACCTGGGAGGG - Intergenic
948919351 2:241054174-241054196 GTGGGGAAGTAGCATTGGGAGGG - Intronic
949000566 2:241610582-241610604 CTGGGGAAGCAGGAGTGGGGAGG - Intronic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169994949 20:11546210-11546232 CAGGGGAAGCTGAACTGTGAGGG + Intergenic
1170010127 20:11713838-11713860 ATTGGGAAGCAGATGTGGGAGGG + Intergenic
1170308223 20:14963358-14963380 CAGGGGAAGGAGACCTGGGAGGG + Intronic
1170351652 20:15448004-15448026 AAGGGGAGGCAGAGATGGGATGG - Intronic
1170626018 20:18030805-18030827 ATGGGGAAGCAGAAGTGCTGGGG - Intronic
1170984042 20:21242223-21242245 ATAGGGAGTCAGAAGTGGGAAGG + Intronic
1171041419 20:21767398-21767420 ATGGGTTAGCAGCTCTGGGAAGG + Intergenic
1171073780 20:22102258-22102280 CATGGGAATCAGAACTGGGATGG + Intergenic
1171372322 20:24669783-24669805 ATGGGGCATCAGAACAGGGTGGG + Intergenic
1172080801 20:32339080-32339102 ATGGGGATGGAGAACGGGGCTGG + Intergenic
1172242555 20:33423153-33423175 AGGGGGACCCAGATCTGGGATGG - Intronic
1172523390 20:35583433-35583455 ATGGGGAGGCAGGGCTGTGAGGG - Intergenic
1172601878 20:36189665-36189687 GTGGTGCAGCAGAACTGGGAAGG - Intronic
1172733469 20:37108414-37108436 AAGGGGAAACTGGACTGGGATGG + Intronic
1172785597 20:37466328-37466350 ATGGGGAAGCAGGACAGGAAAGG - Intergenic
1172873817 20:38152230-38152252 ATGGAGAAGCTGGCCTGGGAAGG + Intronic
1172882026 20:38208309-38208331 AAAGGCAAGCAGAACAGGGAAGG - Intergenic
1172882119 20:38208876-38208898 AGAGGGAAGCAGGACTGGAAGGG + Intergenic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1174096969 20:48097330-48097352 ATGGGGAAGGAGCACTGGCATGG - Intergenic
1174769106 20:53281729-53281751 GTAGGGAAGCAGGACAGGGAAGG + Intronic
1175166344 20:57047283-57047305 ATGAGGAGGCCGAATTGGGAAGG - Intergenic
1175246432 20:57584997-57585019 ATGGGGAGGCTGGAATGGGAGGG + Intergenic
1175324096 20:58110550-58110572 GAGGGGAACCAGAACAGGGATGG - Intergenic
1175920522 20:62448625-62448647 CTGGGGGAGCTGAGCTGGGAGGG + Intergenic
1176086589 20:63298033-63298055 ATGGGGAAGGGGGCCTGGGAGGG - Intronic
1176214416 20:63941502-63941524 AAGAGGAAGCAGAAGTGGGCCGG + Intronic
1176222122 20:63974662-63974684 TTGGGAAAGCAGCAATGGGAAGG + Exonic
1176269309 20:64227388-64227410 AGAGGGAAGCAGAACTGGAACGG - Intronic
1177212900 21:18091873-18091895 AAGGGGAAGGAAAAGTGGGAAGG + Intronic
1177856864 21:26409255-26409277 ATGGGAAAGTACAAATGGGAGGG + Intergenic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178821227 21:35977064-35977086 ATGGGGAAGCAGGCTTGGGGAGG - Intronic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179250012 21:39664556-39664578 ATGGGGCAGCGGGACGGGGAAGG - Exonic
1179830311 21:43992348-43992370 AAGGGGCTGCAGAACTGGGTGGG + Intergenic
1179908221 21:44435069-44435091 ATGGGGGAGCAGGACAGGGCAGG - Intronic
1180819044 22:18812734-18812756 ATGGGTAAGCAGAGCAGGCATGG - Intergenic
1181205268 22:21247182-21247204 ATGGGTAAGCAGAGCAGGCATGG - Intergenic
1181296716 22:21846024-21846046 ATGGGGAAACAGACCTAGGCAGG + Intronic
1181296783 22:21846694-21846716 ATGGGGAAACAGACCTAGGCAGG - Intronic
1181336817 22:22141435-22141457 ATGGGGAAACAGAACTAGGCAGG - Intergenic
1181868936 22:25882678-25882700 TTGGGGAAGATGAAGTGGGAAGG - Intronic
1181909662 22:26228575-26228597 AGGAGGAAGCAGAACTGGGAAGG - Intronic
1182543998 22:31062399-31062421 GTGGGGAAACAGCACTGGGGTGG - Intergenic
1182544202 22:31064166-31064188 AGGAAGAAGCAGAACTGGGCAGG + Intronic
1183010537 22:34943138-34943160 AGGGGGAAGCAGAACTGGCAGGG + Intergenic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1183413232 22:37667601-37667623 TTGGGGATTCAGAACTGAGAAGG - Intergenic
1183477300 22:38042639-38042661 TTGGGGAAGCTGGGCTGGGAAGG + Intergenic
1184146941 22:42617345-42617367 ATGGGGAAACAGACCTGGAGAGG + Intergenic
1185409773 22:50675336-50675358 GTGGGGAAACACAAGTGGGAGGG + Intergenic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
1203221657 22_KI270731v1_random:48233-48255 ATGGGTAAGCAGAGCAGGCATGG + Intergenic
1203269169 22_KI270734v1_random:38587-38609 ATGGGTAAGCAGAGCAGGCATGG - Intergenic
949183455 3:1163058-1163080 TTGGGTAATCAGAACTGGAAAGG - Intronic
949411826 3:3773911-3773933 TTGGGGAAGAAGAAGTGGGGAGG - Intronic
949414330 3:3799638-3799660 AGGGGGAGGCAGGACTGGGAAGG - Exonic
950119106 3:10470079-10470101 ATGGGAAAACAGACCTGGGAGGG + Intronic
950528926 3:13541201-13541223 AAGGGGAAGAAGGACTGGGCAGG + Intergenic
951106521 3:18750222-18750244 GTTGGGAGGCAGAATTGGGAGGG + Intergenic
951281374 3:20754004-20754026 ATTGGGAGGAAGCACTGGGATGG - Intergenic
951454819 3:22878623-22878645 TTGGGGAAGCAGGGCAGGGAAGG - Intergenic
952224433 3:31360480-31360502 ATTGGGAAACAGAAATGGCAAGG - Intergenic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
952769095 3:36981251-36981273 ATTGGGAAGCCAAAGTGGGAGGG - Intergenic
952931674 3:38365599-38365621 ATGGAGAAACAGTCCTGGGAAGG - Exonic
953197189 3:40745691-40745713 ATGGAGAAGCAAGACTGGGAAGG - Intergenic
953625505 3:44567583-44567605 ATGAGGAACCACAACTGTGAGGG + Intronic
953957621 3:47243933-47243955 ATCCGGAAGCAGAACAGAGAGGG + Intronic
954290161 3:49645465-49645487 GTGGGGAGGCAGAGCTGGCAGGG - Intronic
954583811 3:51717957-51717979 GTGGGGAAGCAGGGCTGTGAGGG - Intronic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956606333 3:71076490-71076512 ATGGGCAGGCAGGACCGGGAAGG + Intronic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
956778717 3:72587721-72587743 AGAGGGAAGCAGGACTGGGAGGG + Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
959450685 3:106496065-106496087 AAGGGGAAGGAGATCTGGGTAGG - Intergenic
959502066 3:107118179-107118201 ATGGGGAAGCAGCAGTTGGCAGG - Intergenic
959951822 3:112187743-112187765 ATGTGGAAGAAGAAATGAGAAGG - Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960260177 3:115558553-115558575 ATGGGGGTGAAGAACTTGGAAGG + Intergenic
960454205 3:117850398-117850420 ATGGGGAACCAGCACTTGGTTGG + Intergenic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960709983 3:120518496-120518518 AGAAGGAAGCAGAACTGGGCAGG + Intergenic
960723477 3:120647313-120647335 AAGGGGTAGCAGAAATAGGATGG + Intronic
961175228 3:124829939-124829961 AAGGGGAAGCAGGAATGAGATGG + Intronic
961192356 3:124972532-124972554 ATGGGGATGCAGACTTTGGATGG - Intronic
961203919 3:125066067-125066089 ATGGGGAGGAAGAACTTGGGTGG - Intergenic
961398962 3:126620785-126620807 ATAGGGAAGTACAATTGGGAAGG - Intronic
961511123 3:127404471-127404493 ATTGGGAAGCAGAAATGGCTGGG - Intergenic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
962134882 3:132722596-132722618 GCGGGGCAGCAGAACTGGGCGGG + Intergenic
962244967 3:133784794-133784816 ATGGGGCAGAAGACCTGAGAAGG + Intronic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
962391351 3:134975324-134975346 CAGGGGATGCAGAACTGGGGTGG + Intronic
962452320 3:135530608-135530630 ATGTGGAAGCAGGATTGGAAGGG - Intergenic
963052275 3:141152314-141152336 AGGGGGAAGAAGGGCTGGGAGGG - Intergenic
963068367 3:141281665-141281687 ATGGGGTGGCAGATCAGGGAAGG + Intronic
963322187 3:143821008-143821030 CTGGGGAAGCTGGACTGGGAAGG + Intronic
964158369 3:153614777-153614799 ATGGAGAAATAGATCTGGGAAGG + Intergenic
964784062 3:160374104-160374126 AAGTGGAAGAAGCACTGGGAGGG + Intronic
965723678 3:171689742-171689764 TTTGGGAAGCTGAAGTGGGAGGG - Intronic
966070855 3:175876114-175876136 ACGTGCAATCAGAACTGGGATGG + Intergenic
966268037 3:178070415-178070437 TGGGGGAAGCAGAATTGGCAAGG + Intergenic
966705786 3:182912003-182912025 ATTGGGAAGCAGAGCAGGAAAGG + Intronic
968299039 3:197599386-197599408 GAGGGGAAGCAGAGCTGGGCTGG + Intergenic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
969849148 4:9943040-9943062 CTGGGGCACCAGAACTGGCAGGG + Intronic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
970808063 4:20059446-20059468 ATGGGGAAGCAGACATAGAAAGG + Intergenic
971399503 4:26263045-26263067 CTGGGGCAGGAAAACTGGGAAGG - Intronic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
975891368 4:79032631-79032653 ATGGAGAGGCAGAGGTGGGAGGG + Intergenic
976756230 4:88500573-88500595 AAGGGGCAGGAGAACTAGGATGG + Intronic
976982126 4:91244186-91244208 AAGGGGAAGGAAAAGTGGGAAGG + Intronic
978580674 4:110228541-110228563 ATGGGGAAGCAGATCCCAGATGG + Intergenic
978775879 4:112506487-112506509 TTTGGGAAGCTGAAGTGGGAGGG + Intergenic
979537180 4:121836349-121836371 ATGAGGAGGCATAAGTGGGATGG - Intronic
981642327 4:146958913-146958935 ATGGTTATGCAGAACTGGCAAGG + Intergenic
981696762 4:147566724-147566746 TTTGGGAAGCAGAGGTGGGAGGG - Intergenic
982091928 4:151887663-151887685 AATGGGAAGCAGAACTAGGCTGG - Intergenic
982607272 4:157530515-157530537 ATGGGAAAACAGAAATGGGGTGG - Intergenic
984490045 4:180422435-180422457 ATTGGGAACCAGAACTGTGAGGG + Intergenic
984913421 4:184698178-184698200 AAGAGGAAGGAGCACTGGGAAGG - Intronic
985854852 5:2416794-2416816 ATAGGGAACCAGAAGGGGGATGG - Intergenic
986156049 5:5177019-5177041 AAGGAGAAGCAGGACTGGGAAGG - Intronic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
988584093 5:32493888-32493910 ATAGTGAAGCAAAACTTGGAAGG + Intergenic
988785897 5:34565153-34565175 ATGGGGAAGGAGACCCGGAAGGG - Intergenic
990429425 5:55719608-55719630 CTGGGGAAGCTGAAGTGGGGGGG - Intronic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
991170963 5:63625603-63625625 TTGGGGAAGTAGAACTGGGGTGG - Intergenic
991186824 5:63818469-63818491 ATGGGGAAGCTGAAATGTTAAGG + Intergenic
992191304 5:74294633-74294655 ATAGGGAAGAGGAACTGAGAGGG - Intergenic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992950486 5:81852542-81852564 ATGGCGAGGCAAAGCTGGGAGGG + Intergenic
993188104 5:84645940-84645962 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
993693598 5:91033646-91033668 ACAGAGAATCAGAACTGGGAAGG - Intronic
995176942 5:109189012-109189034 AGGTGGAAGTAGAAATGGGAGGG - Exonic
995259952 5:110091939-110091961 AAGGGGAAGCAGAATTGATAAGG - Intergenic
997358437 5:133279386-133279408 GTGGGGGAGCAGAACAGAGATGG - Intronic
998365833 5:141630173-141630195 ATGGGGAGGGAGATATGGGAAGG - Intronic
998400169 5:141844627-141844649 ATGGGGCTGCAGCGCTGGGAAGG - Intergenic
998797055 5:145831795-145831817 ATGAAAAGGCAGAACTGGGAAGG - Intronic
999050947 5:148523378-148523400 ATGGGCAAGGAGGAATGGGAGGG + Intronic
999767636 5:154753787-154753809 ATGGGGGAGAAGTACTGGTAGGG - Intronic
1000113869 5:158135209-158135231 ATGGGGCAGGAGAAAGGGGATGG + Intergenic
1000217462 5:159175595-159175617 ATGGGGAAGCAGGGCAGGAAGGG - Intronic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1000967101 5:167670835-167670857 ATGGGGAAGGAAAAATGGCAAGG - Intronic
1001116675 5:168946374-168946396 ATGGGGCAGCAGCATTGGGCTGG + Intronic
1001162425 5:169332388-169332410 ATTGGGAAGTGGTACTGGGAAGG - Intergenic
1001619564 5:173071945-173071967 CTTGGGAGGCAGAAGTGGGAGGG + Intronic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1002569874 5:180134244-180134266 ATGGGGAAGCACTACTGGCCGGG + Intronic
1003080528 6:3017532-3017554 CTGGGGAAGCAGGCCTGGGAGGG - Intronic
1003485796 6:6578049-6578071 TTTGGGAGGCAGAAGTGGGAGGG + Intergenic
1004313014 6:14562512-14562534 ACAGGGAAGCAGAATTGGGCAGG - Intergenic
1004702662 6:18093512-18093534 ATGGGGAAGCTGCACGGGGCAGG - Intergenic
1005169565 6:22967299-22967321 ATGGGGAAGAAGCACCAGGAAGG - Intergenic
1005341840 6:24850646-24850668 AATGGCAAGCAGAGCTGGGATGG - Exonic
1006809753 6:36812244-36812266 ATGAGGAAGCAGAGCTCAGAGGG - Intronic
1007350383 6:41269182-41269204 ATGGGGAGGTGGAACTGGGATGG - Intronic
1007553372 6:42746675-42746697 ACGGGGAGGCAGAAATGGGTTGG - Intergenic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1007907412 6:45476197-45476219 ATGAGAATGCAGAAATGGGATGG + Intronic
1008465249 6:51822868-51822890 ATGGGAAAGCAGAATTGATAGGG - Intronic
1009650998 6:66478469-66478491 ATAGAGAAGCAGGACTGGGAAGG - Intergenic
1009698485 6:67142583-67142605 ATGGGGAACTAGAAAGGGGATGG - Intergenic
1009796570 6:68476893-68476915 CTGGGGAAGGAGAAGTGGCAAGG - Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010780834 6:79944833-79944855 AAGGGGAAACAGAAATGGGCGGG - Intronic
1011232540 6:85178868-85178890 ATGGGTAAGAAAAAGTGGGAAGG - Intergenic
1012216855 6:96597751-96597773 ATGCAGCAGCAGAACTGGGAAGG - Intronic
1012319046 6:97819806-97819828 AAGGGGAGGCAGAACAGGGAAGG - Intergenic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1013878298 6:114861884-114861906 GTGGGGAAGCAGAGCAGGGAAGG + Intergenic
1014186228 6:118437287-118437309 ATAGGGAATCCGAACTGGAAAGG - Intergenic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1015113337 6:129619210-129619232 AAGGGGAAGAAGAGGTGGGAAGG + Intronic
1015678823 6:135781380-135781402 CTGGGGAAGCTGCAGTGGGAAGG - Intergenic
1016453753 6:144210194-144210216 ATGGGTGAGCTGAACTGGTAAGG - Intergenic
1016834036 6:148459292-148459314 AGGGAGAATCAGATCTGGGATGG - Intronic
1017434969 6:154407121-154407143 CTCTGGAAGCAGAAATGGGAAGG + Intronic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018471127 6:164099369-164099391 ATGGGGAAGGGGAAATGAGAGGG - Intergenic
1018560255 6:165095047-165095069 GTGGGGAAGCAGTAATGGCAGGG + Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019644710 7:2122897-2122919 ACGGGGAAGCTCACCTGGGAGGG - Intronic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1020254513 7:6495336-6495358 ATGGGGAACCAGATCTGTGCTGG + Intergenic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020673545 7:11151311-11151333 TTTGGGAAGCTGAAGTGGGAGGG + Intronic
1020941302 7:14541922-14541944 ATTGGGTAGGATAACTGGGATGG - Intronic
1022098148 7:27153627-27153649 GTGGGGAAGCAAAAGTGGGGTGG - Intergenic
1022198865 7:28096131-28096153 AGGGATAAGCAGAACTGAGAGGG + Intronic
1022472155 7:30688629-30688651 CTGTGGATGCAGACCTGGGAAGG + Intronic
1022632998 7:32103207-32103229 ATTTGGAAGCAGAAAAGGGAGGG + Intronic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023996429 7:45161700-45161722 AGGAGGAAGAAGAACTGGGCTGG + Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024896880 7:54270562-54270584 GTGGGAAAGTAGAACTGGGGAGG + Intergenic
1025095030 7:56090070-56090092 ATGAGGAAGGAGCAGTGGGATGG - Intronic
1026111066 7:67459302-67459324 ATGGGGATCCAGAAGGGGGATGG + Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026681929 7:72473385-72473407 CTTGGGAAGCAAAGCTGGGAGGG - Intergenic
1026728992 7:72894933-72894955 ATGTGGAAGCTGAGGTGGGAGGG - Intronic
1026856991 7:73761740-73761762 ATGGGGAAACAGACCTGGAAGGG + Intergenic
1027203192 7:76075590-76075612 CTTGGGAAGCTGAAGTGGGAGGG + Intergenic
1027900018 7:84100973-84100995 ATGGGGAAGTAGAAATAGCAGGG - Intronic
1028427536 7:90706968-90706990 ATGGGGAGGCAGGACAGGGAGGG - Intronic
1028863354 7:95679701-95679723 ATGGGCACACAGAACTGGAAGGG - Intergenic
1029274699 7:99397208-99397230 ATGAGGAAGCAGGCCTGGAAAGG - Intronic
1029305823 7:99619505-99619527 ATGTAGAGACAGAACTGGGATGG + Intronic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029945625 7:104529739-104529761 ATGGTGAGTCAGAACAGGGATGG + Intronic
1030513084 7:110508911-110508933 ATTGGGAAGGAACACTGGGAAGG - Intergenic
1030900024 7:115111873-115111895 ATGGGGACCCACAATTGGGAAGG + Intergenic
1030902396 7:115140609-115140631 AAGGGGAAGGAGAACGGGAAGGG - Intergenic
1032218702 7:129977790-129977812 ACGGGGAAGAAGAACTAGGTTGG + Intergenic
1032578874 7:133084986-133085008 CTGGGGAGGCTGAACTGGGAGGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1035377931 7:158419032-158419054 ATGGTGAAGGAGAAGTGGCAAGG - Intronic
1035650379 8:1259646-1259668 CTGTGGAAGCAGAGCTGGGCTGG - Intergenic
1036446867 8:8829195-8829217 ATGGGGAAGGGGTTCTGGGAGGG - Intronic
1036943209 8:13070720-13070742 ATGAGGAAGCAGAGATTGGAAGG - Intergenic
1038301173 8:26350506-26350528 CTGGGGAGGCTGAAGTGGGAAGG - Intronic
1039420474 8:37433940-37433962 ATGGGGAAGGACTACAGGGAGGG + Intergenic
1039444022 8:37615885-37615907 TTGCCCAAGCAGAACTGGGATGG - Intergenic
1039597001 8:38799137-38799159 GTGGGGGAGGAGAGCTGGGAGGG + Intronic
1039611721 8:38924428-38924450 CTGGGGAAGGAGGACAGGGAAGG + Intronic
1040571506 8:48615556-48615578 AATGAGAAGCAGAACTGTGAGGG - Intergenic
1040959053 8:53011565-53011587 AGGGGGAACCAGAACTGAGCTGG + Intergenic
1041559986 8:59206261-59206283 CTGGGGAAGCAGCTCAGGGATGG - Intergenic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1042852790 8:73233561-73233583 ATTGGGAAGCAGGAATGGGAAGG - Intergenic
1042953065 8:74220733-74220755 GTGGGAAAGGAGACCTGGGAGGG + Intergenic
1043919819 8:85968532-85968554 ATGGAGAAGGAGAACAGGTAGGG + Intergenic
1044454048 8:92370875-92370897 ATGGAGAGGAAGGACTGGGAAGG + Intergenic
1045252098 8:100490796-100490818 CAGGGGCAGCAGATCTGGGATGG + Intergenic
1045507283 8:102787836-102787858 TTGAGGAAGGAGAGCTGGGAGGG - Intergenic
1045619808 8:103962730-103962752 CTGGGGAAGCTGAGCTGAGAGGG - Intronic
1046359044 8:113126676-113126698 AAGGGGAAGGAAAACTGGGTGGG + Intronic
1046441285 8:114258214-114258236 ATGGGGAAGCAAACCGGGCAAGG + Intergenic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1049348987 8:142154046-142154068 ATGGGGAAACGGCCCTGGGAGGG + Intergenic
1049445965 8:142631705-142631727 CAGGAGAAGCAGAACCGGGAGGG + Intergenic
1049852926 8:144843733-144843755 ATGAGGAAGCAGCACAAGGAGGG + Intronic
1050091883 9:2023717-2023739 ATGGGGAAGCAGTGCGGGGTGGG - Intronic
1051005699 9:12340748-12340770 ATGGGGAAGTAGAAATAGGCTGG - Intergenic
1052246168 9:26337755-26337777 ATGAGGAAGCAGGACAGAGAAGG - Intergenic
1053074769 9:35123502-35123524 TTTGGGAGGCTGAACTGGGAGGG + Intergenic
1055374491 9:75634367-75634389 AGAGGGAAGCAGTACTGGCAGGG - Intergenic
1055438673 9:76317892-76317914 GTGGGGAAGCAGATCTAGGCTGG - Intronic
1055759515 9:79591662-79591684 CTAGGGAAGTAGAACTGGAAAGG + Intronic
1056163861 9:83923322-83923344 TTTGGGAGGCTGAACTGGGAGGG + Intergenic
1056258415 9:84823983-84824005 ATGGGGAAGCAGGACAGTGGGGG + Intronic
1056456268 9:86763956-86763978 AAGGGGAAGTAGAAAAGGGAAGG + Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1057228699 9:93305919-93305941 ATAGGCAGGCAGAGCTGGGACGG - Intronic
1057870335 9:98711862-98711884 ATGGGGCCTCAGCACTGGGAGGG + Intergenic
1057875105 9:98747745-98747767 AAGGGGAAGAATAACTGGGAGGG - Intronic
1057917762 9:99070828-99070850 ATGTGGAAGCAGACCTGGGGTGG + Intergenic
1058102379 9:100931679-100931701 ATGGGAATGAAGAACTAGGAGGG + Intergenic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1059456168 9:114401664-114401686 GTGGGGAAGCAGGACAGGGAAGG - Intergenic
1059636062 9:116171749-116171771 ATGGGGAGGCTGAACTGGAGAGG + Intronic
1059864950 9:118504260-118504282 TTTGGGTAGCAGTACTGGGATGG - Intergenic
1059995836 9:119908090-119908112 AAGTGGATGCAGAACTCGGATGG + Intergenic
1061209191 9:129181076-129181098 ATGGGGAAACAGGGCAGGGATGG + Intergenic
1061231915 9:129320317-129320339 ATGAGGCAGCAGACCTGGGAGGG + Intergenic
1062182064 9:135196220-135196242 AATGGGAAGGGGAACTGGGAAGG - Intergenic
1062182162 9:135196496-135196518 AATGGGAAGGAGAAATGGGAAGG - Intergenic
1062182239 9:135196696-135196718 AACGGGAAGGAGAAATGGGAAGG - Intergenic
1062213275 9:135376032-135376054 ATGGGGAAGCTGAACTTGGACGG + Intergenic
1062547143 9:137068989-137069011 GTGGGGGAGCAGTACAGGGAGGG + Intronic
1185573804 X:1154496-1154518 ATGGGGAAGCAGGGAGGGGAGGG - Intergenic
1185951087 X:4434989-4435011 GTGGGGAAGGAGAAATGGGGAGG + Intergenic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186186946 X:7030011-7030033 ATGGGGATGGAGAATTGGAATGG - Intergenic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1186289503 X:8081019-8081041 ATGGGGAAGCAGAGCACAGAAGG + Intergenic
1186821440 X:13291687-13291709 CTGGGGAAGCCGAGATGGGAGGG + Intergenic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187103044 X:16214647-16214669 CTGGGTCAGCAGATCTGGGATGG + Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187332587 X:18354427-18354449 ATCGCGAAGCCGAACTGAGATGG + Intronic
1187371938 X:18716592-18716614 ATGGGGATGGAGAGCCGGGAGGG - Intronic
1187548688 X:20279611-20279633 ATGGGGAACTTGAAATGGGAAGG + Intergenic
1187571485 X:20508247-20508269 ATGGGGAAGTAAGATTGGGAAGG - Intergenic
1187636880 X:21238711-21238733 AAGGGGAAGGAGGAGTGGGAAGG + Intergenic
1188806273 X:34594352-34594374 AAGGGGAAGCATAACTGGTGAGG + Intergenic
1188806282 X:34594398-34594420 AAGGGGAAGCATAACTGGTAAGG + Intergenic
1189206391 X:39242911-39242933 ATGAGCAAGCAGAAATTGGAAGG - Intergenic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1190056090 X:47181802-47181824 GTGGGAGAGCAGAACTAGGATGG - Exonic
1190757480 X:53413475-53413497 ATGGGTAAGGTGAACTGGGTTGG - Intronic
1191913275 X:66174218-66174240 ATGTGGAAGCTAAACTGTGAGGG - Intronic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1193337330 X:80306480-80306502 AAGGGGAAGGAAGACTGGGAAGG - Intergenic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1194954179 X:100160407-100160429 ATGGGAAAGCAGAAAAGGGCAGG - Intergenic
1195827371 X:109016674-109016696 ATGGGGTAGGAGAAGTGGGGAGG + Intergenic
1196410686 X:115414962-115414984 ATGATGAAACAGAATTGGGAAGG - Intergenic
1197053971 X:122094546-122094568 AAGGGGAAGGAGAAATGGGAAGG + Intergenic
1197304227 X:124820877-124820899 AAGGGGAAGCAATACTGGTAAGG - Intronic
1197861711 X:130978107-130978129 AAGGGGAAGCAGACATGAGAGGG - Intergenic
1198112773 X:133516255-133516277 ATGGGAAAGCAGAACACAGAGGG - Intergenic
1199719104 X:150529377-150529399 CTGGGGAAGCAGTGCAGGGAAGG + Intergenic
1199887823 X:152039726-152039748 ATGGGGAACAAGACCTCGGAAGG - Intergenic
1200755297 Y:6985028-6985050 ATGAGGAAGCAGAAGTGGAGAGG - Intronic