ID: 906280420

View in Genome Browser
Species Human (GRCh38)
Location 1:44549640-44549662
Sequence GTTAAGAAGCAGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 0, 2: 1, 3: 56, 4: 521}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906280420_906280430 12 Left 906280420 1:44549640-44549662 CCTTCCTCCTGCTGCTTCTTAAC 0: 1
1: 0
2: 1
3: 56
4: 521
Right 906280430 1:44549675-44549697 GTGTGACTGAAGGGCCTCAGAGG 0: 1
1: 0
2: 1
3: 6
4: 170
906280420_906280427 2 Left 906280420 1:44549640-44549662 CCTTCCTCCTGCTGCTTCTTAAC 0: 1
1: 0
2: 1
3: 56
4: 521
Right 906280427 1:44549665-44549687 GGGGACTCCAGTGTGACTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 192
906280420_906280431 13 Left 906280420 1:44549640-44549662 CCTTCCTCCTGCTGCTTCTTAAC 0: 1
1: 0
2: 1
3: 56
4: 521
Right 906280431 1:44549676-44549698 TGTGACTGAAGGGCCTCAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 222
906280420_906280428 3 Left 906280420 1:44549640-44549662 CCTTCCTCCTGCTGCTTCTTAAC 0: 1
1: 0
2: 1
3: 56
4: 521
Right 906280428 1:44549666-44549688 GGGACTCCAGTGTGACTGAAGGG 0: 1
1: 0
2: 3
3: 7
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906280420 Original CRISPR GTTAAGAAGCAGCAGGAGGA AGG (reversed) Intronic
900755798 1:4433735-4433757 GATTAGAAGATGCAGGAGGAAGG + Intergenic
900850949 1:5142685-5142707 GTTAAAAGGCAGCAGAGGGAGGG - Intergenic
900926487 1:5709420-5709442 GGCAAGAAGCAGCAAGAGAAGGG - Intergenic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901296055 1:8161720-8161742 GCCACGGAGCAGCAGGAGGAAGG - Intergenic
901434842 1:9241018-9241040 GTCTGGAAGCAGCAGGAGGAAGG - Intronic
901452483 1:9344565-9344587 GTTGAGAGGCGGCAGGAGGAGGG + Intronic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
902395384 1:16129643-16129665 GTTAGGGAGCAGCAGGTGCAGGG - Intronic
902981437 1:20126383-20126405 TTTATGAAGCAGCAGGGGGCTGG - Intergenic
903018951 1:20380140-20380162 GCTAATAAGCAGCAGGGTGAGGG - Intergenic
903578351 1:24353039-24353061 GTTAAGAAGCAGCAGATAGAAGG - Intronic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904633827 1:31864213-31864235 GTCAAGAGGCAGAAGGAGCAGGG + Intergenic
906091119 1:43180532-43180554 GTTGTGAAGCAGCAGCATGAGGG - Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906301118 1:44682452-44682474 ATTTAGAAGCAGCAGCAGCATGG + Intronic
906511773 1:46414087-46414109 GGAAAGAAGCAGAAGAAGGAAGG - Intergenic
906756818 1:48325407-48325429 GTCAAGAAGAAGCTGGGGGAGGG - Intronic
907408513 1:54268736-54268758 GTTAAGATGAAGCAACAGGATGG + Intronic
907573841 1:55507782-55507804 GTAAAGGAGAAGCAGCAGGAGGG - Intergenic
907634165 1:56116832-56116854 GTGAAGAAACAGCAGGAAGGGGG + Intergenic
907826473 1:58021896-58021918 GTTCAGAAGCAGAAGGGGGTTGG + Intronic
908001982 1:59689269-59689291 GCAGAGAAGCAGCAGGAAGAGGG + Intronic
908519103 1:64923833-64923855 TTTAAAAAGCAGCAGGAGTCGGG - Intronic
910321756 1:85954397-85954419 GCTAAGAGGAAGCAGGATGATGG + Intronic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
912260823 1:108110503-108110525 GTGAAGATGGAGCAGGAGCAAGG + Intergenic
913470461 1:119180852-119180874 GATCAGGAGGAGCAGGAGGAAGG - Intergenic
914668037 1:149848496-149848518 TTCAAGAGGCAGCAGGAGGATGG - Intronic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
914857275 1:151361980-151362002 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
915622500 1:157094382-157094404 GATTAGAAGGAGCAGGAAGAAGG - Intronic
917000327 1:170350828-170350850 ATTAAAAAGGAGGAGGAGGAGGG + Intergenic
918727341 1:187942314-187942336 GCTAAGAGCCAGCAGGAGGCAGG + Intergenic
919657126 1:200208163-200208185 GTGAAGAAGCAGCAAGAAGGCGG + Intergenic
919795302 1:201318013-201318035 GTTAAAGAGCAAAAGGAGGAAGG + Intronic
919990363 1:202705008-202705030 GTTGAGTAGAAGCAGGAGGCTGG - Intronic
921119294 1:212123051-212123073 GAAAAGAAGCAGCAAGACGATGG - Intergenic
922741646 1:228017375-228017397 GTGGAGAGGCCGCAGGAGGAGGG + Intronic
922819556 1:228474681-228474703 GTTAAGAGGCAGATGGAGGGAGG + Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923462590 1:234219992-234220014 GATCAGAAGAAGCAGGAGGAGGG + Intronic
923517732 1:234711607-234711629 GGGAAGAAGGAGGAGGAGGATGG - Intergenic
923626164 1:235615732-235615754 TCCAAGAAGCACCAGGAGGAGGG + Intronic
924499813 1:244626724-244626746 GTGAAGAAGCTGCAGAAGGAAGG - Intronic
1063771494 10:9207796-9207818 ATTAAGAACCAGAAGGAGGCTGG - Intergenic
1066116402 10:32244045-32244067 GTTAAGAAGTTGCAGCAGGCCGG - Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067343114 10:45419863-45419885 GGGACGTAGCAGCAGGAGGAAGG + Intronic
1067563438 10:47320106-47320128 GTTGAGAAGCAACAGCAGGTGGG + Intergenic
1067572131 10:47379435-47379457 AATAAGAAGGAGCAGGAGGATGG + Intronic
1068049268 10:51928594-51928616 GTTAAGAAGCAGATGAAAGAAGG - Intronic
1068585693 10:58795972-58795994 GTGAAGAGACAGCAAGAGGATGG - Intronic
1068588471 10:58827885-58827907 GTTGAGAAGGAGGAGGAGAAGGG - Intronic
1069573546 10:69508589-69508611 TGTAAGAAGGGGCAGGAGGAGGG + Intergenic
1069626505 10:69871154-69871176 GTTTAGAAGCAAGAGGAAGAGGG + Intronic
1071192779 10:83121498-83121520 GTTCAGAAGCAAAAGTAGGATGG - Intergenic
1072217294 10:93298119-93298141 GTTAAGACACAGCAAGAAGATGG - Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1073522156 10:104142753-104142775 GTCAAGAAGCAACAAGAGGAAGG + Intronic
1074447391 10:113531665-113531687 GTGAAACTGCAGCAGGAGGATGG - Intergenic
1076671662 10:132124201-132124223 GCAAAGCAGCAGCAGAAGGACGG - Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077387099 11:2275197-2275219 TTTGAGGAGCTGCAGGAGGATGG - Intergenic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078740702 11:14063775-14063797 GTTGGGAATCAGCAGGATGATGG - Intronic
1079204285 11:18400516-18400538 GTTAAGTAGAAACAGGAGTATGG + Intronic
1080081733 11:28227760-28227782 GTGAAGAATGAGTAGGAGGAGGG + Intronic
1080224411 11:29944512-29944534 GATCAAAAGCAGCAGGAAGAGGG + Intergenic
1080287265 11:30629750-30629772 GATAAGTAGAAGCAGGAGGTTGG - Intergenic
1081692158 11:45086028-45086050 GGTAAAAAGCAGCAAGGGGAGGG - Intergenic
1082182216 11:49133480-49133502 AGTAAAAAGGAGCAGGAGGAGGG + Intergenic
1082771053 11:57207596-57207618 GTAGAGAAGTAGCAGGAGGAAGG - Intergenic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083573442 11:63772175-63772197 GGCAAGAAGGAGGAGGAGGAAGG + Intergenic
1084097118 11:66918845-66918867 GTGAAGAAGGCCCAGGAGGAGGG + Intronic
1084738926 11:71125541-71125563 GTGAGGAAGCTGCAGGAGAAAGG + Intronic
1085050417 11:73377314-73377336 AGTAAGAGGCAGGAGGAGGAGGG + Intronic
1086469703 11:87095111-87095133 GTTAACAAGCAGCAGCATGCAGG - Intronic
1086575759 11:88337622-88337644 GGAGAGAAGCAGCAGGAGGGCGG + Exonic
1086683290 11:89701466-89701488 AGTAAAAAGGAGCAGGAGGAGGG - Intergenic
1086734218 11:90285663-90285685 GTGAGGAAGCTGCAGGAGAAAGG - Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087220865 11:95545079-95545101 GTTAAAAAGCTGCAGGATGCAGG - Intergenic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089028709 11:115299701-115299723 CTTAAGAAGCAGAAGCAAGACGG + Intronic
1089281884 11:117380536-117380558 CTTGAGAGCCAGCAGGAGGATGG + Intronic
1089620231 11:119717867-119717889 GCTTGGAAGCAACAGGAGGAAGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090382572 11:126337431-126337453 GTTAGGAGGCTGCAGGAGGTTGG - Intronic
1090418838 11:126559428-126559450 GTAGAGAATCAGCTGGAGGAGGG - Intronic
1091036805 11:132241876-132241898 GTTAAGAAGCAGCATTTGGGAGG + Intronic
1091318864 11:134635626-134635648 GTTCTGGAGCAGCAGGAGAAAGG - Intergenic
1092139259 12:6171613-6171635 GTTGAGGAGGAGGAGGAGGAAGG + Intergenic
1092195886 12:6549591-6549613 GGTAAGGAGCAGCATCAGGAGGG - Intronic
1092428435 12:8391352-8391374 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092429516 12:8397504-8397526 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1093213552 12:16336048-16336070 ATTAAGAAGCAGTAGGAGCTGGG + Intergenic
1093425149 12:19020289-19020311 GTGAAGAAGGAGCGAGAGGAAGG - Intergenic
1093912323 12:24762143-24762165 GTAGAGAAGCAGCACTAGGATGG - Intergenic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1094140254 12:27173506-27173528 TTTAAGAAGTAGCAGTAGGCCGG + Intergenic
1094438218 12:30445288-30445310 GTGAAGAGGCAGCAAGAGGGTGG + Intergenic
1094559376 12:31536048-31536070 GATTAGAAGCAGGAGGAAGAGGG - Intronic
1095311015 12:40696656-40696678 GAAATGTAGCAGCAGGAGGATGG + Intronic
1095729838 12:45494399-45494421 GTTAGGAAGGTGCAGGAGGTAGG + Intergenic
1096256099 12:50063273-50063295 GATAAGGTGCAGCTGGAGGATGG - Intronic
1096365030 12:51021782-51021804 GTTAGGAAGCAAGAAGAGGAGGG + Intronic
1096580327 12:52580854-52580876 GTTAAGAAGGGACAGGAGAAGGG + Intergenic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1099051402 12:77785468-77785490 GTGAAGAAGTAGGAGGAGGGAGG + Intergenic
1099891889 12:88599271-88599293 GTGATGAGGCAGCAAGAGGATGG - Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101834612 12:108286605-108286627 GGTAAGGAGGTGCAGGAGGAGGG - Intergenic
1101838523 12:108311698-108311720 GGCAAGAGGCAACAGGAGGAAGG + Intronic
1102762312 12:115398696-115398718 GTTCAGAGGCAGCAGGAGCTGGG - Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1103192887 12:119017519-119017541 GATGGGAAGCAGCAGGAGGCTGG + Intronic
1103235367 12:119368150-119368172 GAAAAGAAGGAGGAGGAGGAAGG + Intronic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1104107381 12:125675858-125675880 TTTGAGAAGGTGCAGGAGGATGG + Intergenic
1104310044 12:127646409-127646431 GAGAAGAAGAAGCAGGTGGAGGG + Intergenic
1104378215 12:128283931-128283953 GTTCAGAAGCAGGAGGAAGAGGG + Intronic
1104597583 12:130130585-130130607 ATTAGGAAGAAGCAGGAAGAGGG + Intergenic
1104630300 12:130395088-130395110 CCTTAGAAGCAGCGGGAGGAAGG + Intergenic
1104726385 12:131078079-131078101 GCCCTGAAGCAGCAGGAGGAGGG - Intronic
1105600904 13:21886050-21886072 GTTCAGAGGCGGCAGGAGGTGGG + Intergenic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1105974312 13:25459796-25459818 GTTCAGGAGCAGCAGGAGAGGGG + Intronic
1107254463 13:38407062-38407084 GTTAGGTGGCTGCAGGAGGAAGG + Intergenic
1107999429 13:45892724-45892746 AGAAAGAAGCAACAGGAGGAAGG + Intergenic
1108006108 13:45948312-45948334 ATGAAGAAGCAGCAGCAAGAGGG - Intergenic
1109443579 13:62405519-62405541 CTCAGGAAGCAACAGGAGGAGGG - Intergenic
1109567616 13:64138168-64138190 GTTAAAAAGCAGAAGGATGAAGG + Intergenic
1109834707 13:67841596-67841618 TTTAAGAAGCTGCAGCAGCATGG - Intergenic
1110659415 13:78041864-78041886 TTTAAGAATCAGCAGGAGGCTGG - Intergenic
1111604586 13:90520588-90520610 GCTAGGAGGCAGTAGGAGGAGGG - Intergenic
1112495165 13:99898351-99898373 GTTAAAAAGGGGCAGGGGGATGG + Intergenic
1114516225 14:23301864-23301886 GGAAAGAAGAAGCGGGAGGAGGG + Intronic
1114767396 14:25389497-25389519 GTTAAGAGTCAGAGGGAGGAAGG - Intergenic
1116129746 14:40839740-40839762 GCTGAGAAGAAGGAGGAGGAGGG - Intergenic
1116637441 14:47415807-47415829 GTGAGGATGCAGCAGGAAGACGG - Intronic
1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG + Intronic
1117590191 14:57259520-57259542 GTTAGGAAGCAGGAGTAGCATGG - Intronic
1118807424 14:69250336-69250358 TCTAGGGAGCAGCAGGAGGATGG - Intergenic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119401389 14:74364990-74365012 GATAAGAAGCAGCAGAAAGTAGG + Intergenic
1120067901 14:80066172-80066194 GTTAAAAAGAAGCAGGAGCTAGG + Intergenic
1120077197 14:80172429-80172451 GTTAAAGAGGAGCATGAGGACGG + Intergenic
1120696652 14:87652612-87652634 CTTAAGTAGTAGCAGGAGCATGG + Intergenic
1120851996 14:89180030-89180052 GTGTAGAAGCAGCTGGCGGATGG + Intronic
1123072016 14:105646639-105646661 GGTAGGAAGCAGGAGGAGCAGGG - Intergenic
1202844538 14_GL000009v2_random:156045-156067 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
1202913929 14_GL000194v1_random:146286-146308 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
1202878725 14_KI270722v1_random:36416-36438 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
1123861876 15:24477091-24477113 GTGAGGAAGCAGGAGCAGGAAGG + Intergenic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125547265 15:40515243-40515265 GAGAAGTAGCAGCAGGGGGAGGG - Intergenic
1126144809 15:45464466-45464488 TTTAAGGAGCAGGAGGAGGTTGG + Intergenic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1126411806 15:48379948-48379970 GATCAGAAGCATAAGGAGGAGGG + Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126454834 15:48849705-48849727 GTTAAGAACCTCCAGGATGACGG + Intronic
1127143910 15:56005604-56005626 GTGAAGAAGCAGCTTAAGGATGG + Intergenic
1128135345 15:65259159-65259181 TTTAAGAAGGAGCAGATGGAAGG + Exonic
1128154286 15:65383077-65383099 GTGAAGAGGAGGCAGGAGGATGG + Exonic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1129296277 15:74602083-74602105 GGAAAGCAGCAGCAGGAGGGTGG - Intronic
1129358794 15:75011606-75011628 GGTAAGATGCAGCTGGTGGAAGG + Intronic
1129515206 15:76153082-76153104 GTTAGGAAGCTGCAGGAGGTGGG - Intronic
1129534318 15:76299576-76299598 TTTAAGAAACATCAGGAGGCAGG - Intronic
1130116956 15:81013752-81013774 GTTAAGGAGAAGCAGGATGTGGG - Intronic
1130295271 15:82643175-82643197 GCTAAGAAGCAGCTAGAGGCAGG + Intronic
1130971466 15:88737021-88737043 GTTAACAAGAACCAGGAGGACGG + Intergenic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131224403 15:90611985-90612007 GATAAGAAGGAGAAGGAAGATGG - Intronic
1132903409 16:2270302-2270324 ATTAAAAACCAGCAGGGGGAGGG - Intergenic
1133164761 16:3938813-3938835 GTTAAGAAACTGCAGGAGTCCGG + Intergenic
1133398010 16:5464031-5464053 GTGATGGACCAGCAGGAGGAGGG + Intergenic
1133571947 16:7049691-7049713 ATTAAAAAGCAGCAAGTGGAGGG - Intronic
1133962485 16:10506584-10506606 GTAAACAAGCAGAAGGAAGAAGG - Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136477807 16:30524416-30524438 GTGGAGAAGCCGCAGGAGAATGG - Exonic
1136679390 16:31947390-31947412 TTTAAAAAGCAGCAAGAGAAAGG + Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1139475007 16:67198719-67198741 GTTATGGGGCAGCAGGAGGTGGG - Exonic
1140379890 16:74477128-74477150 TTTAATAAGCAACAGGAAGAGGG + Intronic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141268794 16:82520659-82520681 ATTAAGAATAGGCAGGAGGAAGG - Intergenic
1141345340 16:83239833-83239855 GTTAAACAGGACCAGGAGGATGG + Intronic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1142643374 17:1297559-1297581 AATAACAAGCAGCAGCAGGATGG - Intronic
1142809442 17:2388355-2388377 GTGAAGAGGCTGCTGGAGGAGGG - Intronic
1142944512 17:3413189-3413211 GGAGAGAAGCAGCAGGAGGGAGG + Intergenic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143542596 17:7578533-7578555 GCTGAGGAGCAGCAGGAGGGGGG + Exonic
1143919843 17:10322446-10322468 GTTATCAGGAAGCAGGAGGAGGG + Intronic
1144457953 17:15434206-15434228 GATAAGAGGCTGCAGGAGGCTGG - Intergenic
1144725592 17:17500451-17500473 TTCAAGAAGAAGCAGGAGGGAGG - Intergenic
1144752977 17:17662843-17662865 GAGAAGGAACAGCAGGAGGAGGG - Intergenic
1145278789 17:21453734-21453756 GTCAGGAAGCAGGAGGAGGTAGG - Intergenic
1145399065 17:22516752-22516774 GTTAGGAAGCAGGAGGAGGTAGG + Intergenic
1145797556 17:27664569-27664591 GGTTAGAAGTTGCAGGAGGAGGG + Intergenic
1146116350 17:30143320-30143342 GATAAGAAGCAGCATTTGGAAGG + Intronic
1146606937 17:34268610-34268632 TTTTAGAAGCATCAGGTGGATGG + Intergenic
1147427345 17:40352196-40352218 GGGAAGAGGCAGCAGGAGGAGGG - Intronic
1148070523 17:44906123-44906145 GTTAAGAAGCAGCAGTCCCAGGG + Intronic
1148212877 17:45818806-45818828 GATCAGATGCAGCAGGAGGGAGG - Intronic
1148384465 17:47224017-47224039 GTTTAAAAGCAGCAAGAGCAAGG - Intergenic
1148623097 17:49049388-49049410 GTTAAGCAGCAGCATCAGAAGGG + Exonic
1149333107 17:55606805-55606827 TTTAAGAAGCAGGAGGAAGGAGG - Intergenic
1149883671 17:60318435-60318457 GTTAAGAAGCAGCAGGGAAAAGG + Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1152058841 17:78053296-78053318 GATAAGGAGAAGCAGGAAGAAGG + Intronic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1153230261 18:2928244-2928266 GGGAAGAAGCAGCAAGAAGAAGG - Intronic
1153851180 18:9096136-9096158 TTTAAGAAGCAGCCTGAGGGAGG + Intergenic
1155505186 18:26526248-26526270 TTTGGGGAGCAGCAGGAGGAGGG + Intronic
1155740447 18:29282353-29282375 GTTCAGAAGAAGCATGTGGATGG - Intergenic
1156042569 18:32839360-32839382 GTTAAGAAGTATCATGAGTATGG + Intergenic
1156460362 18:37318279-37318301 GATAAGCGGCAGGAGGAGGAGGG - Intronic
1156499035 18:37545318-37545340 GCTACTAGGCAGCAGGAGGAAGG - Intronic
1156525287 18:37761585-37761607 GTTGAGAAGCAGCAGGAAGTGGG + Intergenic
1156547830 18:37983156-37983178 GTTGCGAAGCAGCAGCTGGAAGG + Intergenic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1157353553 18:46913201-46913223 GTTAGGATGCAGCAGGAGAATGG - Intronic
1157488632 18:48107240-48107262 GTTAGGAAGGTTCAGGAGGAAGG + Intronic
1158369032 18:56776834-56776856 GTAAAGCAGGAGCAGAAGGAGGG - Exonic
1158660595 18:59384055-59384077 GTTAATGAGCAGCCTGAGGATGG - Intergenic
1158844453 18:61426977-61426999 TTTAAGAAGCAACAGTATGAAGG + Intronic
1158853464 18:61518398-61518420 GTGAAGAAGCTTCAAGAGGAAGG + Intronic
1159182771 18:64930468-64930490 GATAAGAAGCAGCAGAAACATGG + Intergenic
1160044133 18:75371087-75371109 GGTAAGACCCAGCAGGAGGCAGG - Intergenic
1160677468 19:399093-399115 TTTTATACGCAGCAGGAGGAAGG - Intergenic
1161266434 19:3366727-3366749 GTTTTGAAGCAGGAGGAGGCGGG + Intronic
1163053822 19:14704071-14704093 GTGAAGAGGCAGCAGGAGGGTGG - Intronic
1164712624 19:30368260-30368282 GCTAAGGAGAAGCTGGAGGATGG - Intronic
1164768883 19:30792762-30792784 GTTCAGAAGCAGTAAGAGCATGG - Intergenic
1164900781 19:31920260-31920282 GTTTAGTAGCAGCATGAGAATGG + Intergenic
1165120029 19:33552941-33552963 GTTCAGAAGCAGGAGGACAAAGG - Intergenic
1166382485 19:42362235-42362257 GATGAGAAGCAGCAGGTGTAGGG + Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1167227015 19:48251921-48251943 GCAACCAAGCAGCAGGAGGATGG - Intronic
1167234001 19:48302922-48302944 GCTAGGAAGAAGCAGGAGGCAGG + Intronic
1167286675 19:48602309-48602331 GGAAGGCAGCAGCAGGAGGAGGG + Intronic
1167389927 19:49188360-49188382 GTCAAGAAGCAGTTGGAGGCTGG - Intronic
1168383490 19:55943736-55943758 GTTGAGAAACAGCAGGACCAGGG - Intergenic
1168692630 19:58386176-58386198 GTTCAGAGGCAGCTGGGGGAAGG + Intergenic
1202654348 1_KI270708v1_random:5450-5472 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
924966471 2:81072-81094 GTTAACACGCAGCAGGCAGATGG + Intergenic
924989703 2:302123-302145 GTGAAGAAGCTGCATAAGGAAGG + Intergenic
925083293 2:1087056-1087078 GCTAAGGAGCAGAAGGAGGGTGG + Intronic
926383555 2:12314585-12314607 GAGATGCAGCAGCAGGAGGAGGG - Intergenic
927204186 2:20596758-20596780 CTTCAGACACAGCAGGAGGAAGG - Intronic
927285926 2:21356587-21356609 GTCAGGAAGCCTCAGGAGGAAGG - Intergenic
927527265 2:23756610-23756632 TTTAAGAAGCAGCAGAAAGAGGG - Intronic
927866204 2:26589262-26589284 GGAAAGAAGGAGGAGGAGGAAGG - Intronic
927876059 2:26655856-26655878 TTTAAGAAACAGCAAAAGGAAGG - Intergenic
928365384 2:30696444-30696466 GTTAAGAAACAGTGGGTGGAAGG - Intergenic
929401691 2:41590217-41590239 GACAAGAAGCACCAGAAGGAAGG + Intergenic
929626904 2:43418749-43418771 TTTGAGAGGCAGCGGGAGGAAGG + Intronic
930665796 2:54097194-54097216 GTTAAGAAGGACCAGGAGTGGGG - Intronic
930783083 2:55242636-55242658 GTAAAGAACCAGGAGGAGTAGGG + Intronic
930831378 2:55747258-55747280 GTGAGGAAGCTGCAGGAGAAAGG + Intergenic
931635510 2:64337713-64337735 GCCAAGAAGCAACAGGAGGTGGG + Intergenic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
932735880 2:74254323-74254345 GCTAAGGAGGAGCAGGAGGAAGG - Intronic
933249598 2:80014256-80014278 GAGCAGAAGCTGCAGGAGGAAGG + Intronic
933386004 2:81610982-81611004 CTCAAAAAGCAGCAGGAAGAAGG + Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
936063434 2:109313036-109313058 GTTAAGAAGAGGCAGGAGACAGG + Intronic
936115507 2:109699646-109699668 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
936388368 2:112050880-112050902 TCTAAGAAGGAGGAGGAGGAAGG - Intergenic
937004678 2:118500810-118500832 AATAGGAAGGAGCAGGAGGAGGG + Intergenic
937207612 2:120246528-120246550 GTTAGGAAGGGGGAGGAGGAAGG - Intronic
937320343 2:120957002-120957024 GTGAAGGAGCAGCCAGAGGAGGG - Intronic
937579086 2:123461538-123461560 GAAAAGAAGAAGGAGGAGGAGGG - Intergenic
939108976 2:137983884-137983906 ATTAAGAAGCAGCAAATGGAAGG - Intronic
939797000 2:146657326-146657348 GTGAAGATGCAGCAAGAAGAAGG + Intergenic
939954627 2:148517282-148517304 GTTAAGAAGCAGTAAGAGGCTGG - Intronic
939992091 2:148885376-148885398 GTGAAGCAGCAGCAGGGAGAAGG - Intronic
940857972 2:158744544-158744566 GTTTAGAAGCATCCTGAGGATGG - Intergenic
941567149 2:167123637-167123659 GTGAAGAGGCAGCAAGAGGGAGG - Intronic
942043739 2:172087249-172087271 GGTAAGAAGGAGGAGGAGGAGGG - Intronic
942544928 2:177053687-177053709 CTTAAAAAGAAGCAGGAGGCCGG - Intergenic
942831801 2:180245333-180245355 TTTAAGAAGAAGCTGGAGAACGG - Intergenic
943593630 2:189829417-189829439 GTTAAAAAGCAGTAGGAACAAGG - Intronic
944999078 2:205329599-205329621 GTTAAGAAGCAACATGCGGTAGG + Intronic
945413582 2:209542738-209542760 GTAAAGAAGCTGCAGAAGAAAGG - Intronic
946027328 2:216679690-216679712 CTTCATAAGCGGCAGGAGGAGGG + Intronic
946538809 2:220661179-220661201 GTTGAGAAACAGCAAGAGAAAGG - Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
948735729 2:240003769-240003791 GATGAGAAGCAGCAGGGGGTGGG + Intronic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
948935211 2:241159416-241159438 GCTAAGAGCCAGCAGGAGGTTGG - Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1170283181 20:14674599-14674621 GTTACGAAGTAGAAAGAGGATGG - Intronic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1172116880 20:32578337-32578359 GTAAAGAAGCAGCTGGAAGTTGG - Intronic
1173496948 20:43526352-43526374 GGCAAGAAGCAGCAGGATGATGG + Intronic
1173736449 20:45364809-45364831 GAGAACAAGCAGCAGGAGCAAGG - Intronic
1173817477 20:45998987-45999009 GTCAGGAGGCAGAAGGAGGAAGG + Intergenic
1175096934 20:56548676-56548698 GTAAAGAAGGGGAAGGAGGATGG - Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175351357 20:58322035-58322057 GTGAAGCCACAGCAGGAGGATGG - Intronic
1175452092 20:59077925-59077947 GGGAAGAAGGAGGAGGAGGATGG + Intergenic
1175503165 20:59464499-59464521 GTGAAGAAGCTGCAGGTGGCTGG - Intergenic
1175609835 20:60341559-60341581 GTTAAGAAGAAGCAAGAAGCTGG + Intergenic
1175935599 20:62512549-62512571 ATTAAGGAGCAGCAGGGGGTGGG - Intergenic
1176095022 20:63337149-63337171 GGAAAGAAACAGCAAGAGGAGGG + Intergenic
1176633284 21:9160961-9160983 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
1176640039 21:9293856-9293878 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
1177919927 21:27139755-27139777 GCAAACAAGCAGCAGGAGAAAGG - Intergenic
1179290227 21:40012074-40012096 TTTAAAAAACAGCAGGAGGCTGG + Exonic
1180349053 22:11783238-11783260 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
1180373341 22:12066692-12066714 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
1180389147 22:12208975-12208997 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
1180416794 22:12725496-12725518 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
1180424085 22:12901319-12901341 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
1180559689 22:16605625-16605647 GTACAGAAGCAGCAGGTGGTAGG + Intergenic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1182522418 22:30891999-30892021 GTGAAGAAGCAGCAGCTGGAGGG + Intronic
1183299545 22:37052076-37052098 GGGAAGAAGCGGCAGGAGGAGGG + Intronic
1183466647 22:37983603-37983625 GTCAAGAAGGAGCAGCAGGACGG - Exonic
1183790814 22:40067687-40067709 GTTCAAGAGCAGGAGGAGGAGGG + Intronic
1183866738 22:40710288-40710310 CTTAAGAAGCAGTAGTAGGACGG - Intergenic
1183987487 22:41577514-41577536 GTTCTGAAGGGGCAGGAGGAGGG - Intronic
949959633 3:9301376-9301398 GTTCAGAAGAAACAGGAAGAGGG + Intronic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
950895820 3:16449934-16449956 ACCAGGAAGCAGCAGGAGGAGGG + Intronic
951913763 3:27777926-27777948 GTCAGGAAGCAGAAGGAGGGAGG + Intergenic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953579451 3:44140593-44140615 GTTAAGACTTAGGAGGAGGAGGG - Intergenic
954078265 3:48196827-48196849 TTCAAGAAACAGCAGGAGGGAGG + Intergenic
954752474 3:52821435-52821457 GTGTAGAAACAGCAGCAGGAAGG + Intronic
955062728 3:55507137-55507159 GTTAAGGGGCAGCTGGAGGGAGG + Intergenic
955609460 3:60741676-60741698 GATAAGAAGGAGAAGGAGAAAGG - Intronic
955647385 3:61154590-61154612 GTTCAGAAGTAGCAGGAGAGGGG - Intronic
957656956 3:83092631-83092653 GTGAAGAAGTAGCAAGAGGGTGG + Intergenic
959882483 3:111460665-111460687 GTAAATAAGCAGCAAGAGGGTGG + Intronic
960168491 3:114431143-114431165 GTACAGAAGAAGAAGGAGGAAGG + Intronic
960476424 3:118135071-118135093 GTGAGGAAGCTGCAGAAGGAAGG + Intergenic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
961904513 3:130248715-130248737 GATAAGAAGCAGCAAGATGTAGG - Intergenic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962627557 3:137241585-137241607 GTTGAGGAGCAGCTGGAGGCCGG + Intergenic
962935947 3:140080892-140080914 GGTAAGAAGCAGAAGTGGGATGG - Intronic
962986389 3:140540042-140540064 GCAAATAAGCAGCAGTAGGAAGG - Intronic
963283565 3:143411379-143411401 GATATGAAGTAGCAGGTGGAAGG - Intronic
963299598 3:143583973-143583995 GTAATGAAGAAGAAGGAGGAGGG + Intronic
963561889 3:146876094-146876116 GGGAAGAAGCAGCAGGGGCAGGG + Intergenic
963850718 3:150207910-150207932 CTTAAGAAGCGGGGGGAGGAAGG + Intergenic
964778759 3:160311652-160311674 GTCTAGAATCAGCAGGAGTAAGG + Intronic
964870433 3:161307969-161307991 GTGAGGAAGCTGCAGAAGGAAGG + Intergenic
965057467 3:163740938-163740960 GTTCAGAAGCATCAGTAGCATGG - Intergenic
965885247 3:173437490-173437512 GTTCAAAAGCAGGAGGAGCAAGG - Intronic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
1202746856 3_GL000221v1_random:111166-111188 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
970124844 4:12797661-12797683 GCCAAGAAGCTGCAGGAGCAGGG + Intergenic
970760466 4:19480259-19480281 GTTAATAGGCAGAAGGAGGGAGG - Intergenic
971058072 4:22935925-22935947 GGTAAGGAGCAGGAGGAGGCAGG + Intergenic
975665817 4:76733770-76733792 GTTAAGAAGCAGGCGTAAGAGGG + Intronic
975969403 4:80015712-80015734 GAAGAGAAGAAGCAGGAGGAGGG + Intronic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG + Intergenic
976932714 4:90588583-90588605 GTCAGGAAGCTGCAGAAGGAAGG - Intronic
977586962 4:98784703-98784725 GTTAAGAAGCAGTGGGAGGTCGG - Intergenic
977984292 4:103363571-103363593 GGTAAGAAGTAGCAGGGGGAAGG - Intergenic
978151671 4:105443332-105443354 GTGAAGAAGCAGAAGGCAGAAGG + Intronic
978622007 4:110641869-110641891 GTTAAGAATAAGCAAAAGGAAGG - Intronic
979295754 4:119031040-119031062 GTTTTGGAGCAACAGGAGGAGGG - Exonic
979350034 4:119632745-119632767 GTGAAGAGGCAGCAAGAGAATGG + Intergenic
980114102 4:128662869-128662891 TTTGAGAAGGAGCAGCAGGAGGG - Intergenic
980841061 4:138261916-138261938 GATAAGAAGAAACAGGAGGAGGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981421913 4:144560628-144560650 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
981938524 4:150257987-150258009 CTTATGAAGCAGCAGCAGGAAGG + Intergenic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
983357750 4:166685538-166685560 GGTAAAAGGCAGTAGGAGGATGG - Intergenic
983913872 4:173269722-173269744 GTTGAGGAGGAGGAGGAGGAGGG - Intronic
985145056 4:186887920-186887942 CTTAGGAAGCAGCATGAGAAGGG + Intergenic
986280095 5:6315703-6315725 GCTCAGCAGGAGCAGGAGGAAGG - Intergenic
986462547 5:7987189-7987211 GTGAAGTAGCAGCAGGCAGATGG + Intergenic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987148155 5:15012634-15012656 GTTAAGGAGAATCATGAGGAAGG + Intergenic
987274757 5:16350627-16350649 GATAAGAAGCAGTTGCAGGAAGG - Intergenic
987445397 5:18011510-18011532 GGAAAGAAGCAGCATGAAGAAGG + Intergenic
988230407 5:28470875-28470897 GTTAAGAAATAGAAGGAGCAAGG - Intergenic
988836072 5:35033559-35033581 GAGAAGAAACAACAGGAGGATGG + Intronic
989531391 5:42512151-42512173 GTTATAAAGGAGCAGGAAGATGG + Intronic
990442501 5:55860924-55860946 GTGAAGAGGCAGCAAAAGGAAGG - Intronic
990494942 5:56338023-56338045 GAGAAGGAGCAGGAGGAGGAGGG - Intergenic
990867362 5:60395075-60395097 ATTAAGATGGAGCATGAGGAAGG - Intronic
991043005 5:62194796-62194818 GTGAAGAAGCCACAAGAGGAAGG - Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
991611944 5:68458546-68458568 CTAAAGAGGCAGCAGGAAGAAGG + Intergenic
991618465 5:68520538-68520560 GTCAAGAAGGAGCACCAGGACGG + Intergenic
992233572 5:74685726-74685748 CTTAAGAAGCAGTAGGAGGGTGG - Intronic
992559584 5:77937390-77937412 GCTAGGAAGAAGCAGGAAGAGGG + Intergenic
992794122 5:80240270-80240292 GTTGAGAAGCAGTGGGAGGAAGG - Intronic
993389245 5:87298111-87298133 GTAAAGAAGGAACAGGAGGCTGG + Intronic
993836011 5:92821361-92821383 GTTTGGAAGCAGCAATAGGAAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
995016788 5:107318875-107318897 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
996912750 5:128674166-128674188 ATAAAGAAACAGCAGGAGGCGGG - Intronic
997091162 5:130860272-130860294 GTCAAGCAGCAGTAGGATGAGGG - Intergenic
997728112 5:136139662-136139684 GTTGAGAATAAGCAGGAGGAGGG - Intronic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999446044 5:151640171-151640193 GCTCAGAAGCAGCAGGAGACAGG + Intergenic
1000435353 5:161201108-161201130 GTCAAGAAGCAGGAGGATGCAGG + Intergenic
1002453780 5:179334039-179334061 GTTAAGACACAGGAGGAGAATGG + Intronic
1003404425 6:5816767-5816789 GATAGGAAACAGCAGGACGAAGG - Intergenic
1003573493 6:7271292-7271314 GTTAAGAGGCAGGAGGATGGAGG + Intronic
1003660014 6:8051371-8051393 GTGAGGAAGCTGCAGAAGGAAGG + Intronic
1003725958 6:8764313-8764335 TTTTAGAAGGACCAGGAGGAAGG - Intergenic
1003837656 6:10088963-10088985 GTTTAGAAGCTGAAGGAGAAAGG - Intronic
1006174997 6:32116346-32116368 GGTGAGAAGCAGCAGGAAGTAGG - Intronic
1006197619 6:32255423-32255445 TTTAAGAGGCAGGCGGAGGAAGG - Intergenic
1006460399 6:34154662-34154684 GACAAAAAGCAGCAGCAGGAGGG + Intronic
1006815989 6:36850353-36850375 GTGGAGGCGCAGCAGGAGGAAGG - Intergenic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1008018486 6:46548357-46548379 GATAAGAAGAAGCAGTAGGAGGG - Intergenic
1008111834 6:47503360-47503382 GTGAAAAAGCTACAGGAGGAAGG + Exonic
1008395179 6:50997965-50997987 GCTAAGAAGCAGGAGTGGGAGGG - Intergenic
1008713748 6:54262786-54262808 TTTAAGAAAAAGAAGGAGGAGGG + Intronic
1011000454 6:82582699-82582721 GTAAAGAAGCAGCAGGAAGGTGG + Intergenic
1011012885 6:82721874-82721896 GTTAAGAAGAAATAAGAGGAAGG - Intergenic
1011279520 6:85662997-85663019 GTTAAGAAGTGGCAGTAGGGAGG + Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011641172 6:89417767-89417789 GTAATGAAAGAGCAGGAGGATGG + Intergenic
1011677791 6:89752239-89752261 GTTGAGAAGCAATAGGGGGAGGG + Intronic
1011870616 6:91887452-91887474 GTTAAGGAGTAGGAGGATGAAGG - Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013402849 6:109815525-109815547 GGTACCAAGCAGCATGAGGAGGG - Intronic
1014167753 6:118245219-118245241 GCTAAGTAGCAGTAGGTGGAGGG + Intronic
1014732067 6:125043977-125043999 GTTAAGAAGTTGCAGGCTGAAGG - Intronic
1014806650 6:125837730-125837752 CTTAGGAGGCAGCATGAGGAAGG + Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015372421 6:132469414-132469436 TTTAAAAAGCTGCAGTAGGAGGG + Intronic
1015450968 6:133365584-133365606 GTCAGGATGCAGAAGGAGGAAGG + Intronic
1015672164 6:135703047-135703069 GTTAGGAGGCTGCAGGAGGTTGG + Intergenic
1015718475 6:136216088-136216110 GATAGGCAGCAGGAGGAGGAAGG + Intergenic
1015871784 6:137782786-137782808 ATTAAGAAGCAGCAGAAAAAGGG - Intergenic
1017868931 6:158469812-158469834 TTTAACAAGCAGCAGAAGGAAGG + Intronic
1018333879 6:162763300-162763322 CTTGAGAAGCAGCAGGAAGGAGG + Intronic
1019171748 6:170136790-170136812 GTTGAGTAGCAGGTGGAGGACGG - Intergenic
1019756948 7:2777622-2777644 GTGAGGAAGCAGCAGGAAGGTGG + Intronic
1020401673 7:7785564-7785586 GTTAAGAAAGAGTAGGAGAATGG + Intronic
1021603454 7:22387794-22387816 TATAACAAGAAGCAGGAGGATGG - Intergenic
1021737948 7:23657457-23657479 GTTTAGAAGGAGAAGGAGTAGGG - Intergenic
1022084792 7:27056467-27056489 TTTAAGAAGCTGCATGGGGATGG - Intergenic
1022602946 7:31778940-31778962 GTTAAGAAGCAGCAAGAGTCAGG - Intronic
1022979945 7:35594776-35594798 GTTCAGACTCAGCTGGAGGAAGG + Intergenic
1023224605 7:37956105-37956127 GTGAAGAAGAAGGAGCAGGAAGG + Intronic
1023639909 7:42247095-42247117 GTTTAGATGCAGGAGGAAGAAGG + Intergenic
1023680807 7:42685309-42685331 GTAATGAAGCAGCAGGAAGGGGG + Intergenic
1023758780 7:43444679-43444701 GAGAAGGAGCAGGAGGAGGAGGG + Exonic
1023983598 7:45082932-45082954 GTTGAGAACCAGCAGGAAGGAGG - Exonic
1024581952 7:50807627-50807649 AATAAGATGCAGCAGGAGCACGG - Intergenic
1024638185 7:51307973-51307995 TTTAGGCAGGAGCAGGAGGAAGG + Intronic
1024674575 7:51626720-51626742 GGGAAGCAGCAGCAGGAGGGAGG - Intergenic
1024914932 7:54488519-54488541 GTTAATAACCAGCTGGAGTAAGG - Intergenic
1025994325 7:66518604-66518626 GGACAGAGGCAGCAGGAGGAGGG - Intergenic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1026985935 7:74555293-74555315 GGACAGAGGCAGCAGGAGGAGGG - Intronic
1027193049 7:76009064-76009086 GTTTAAAAACAGCAGGAAGAGGG - Intronic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1030241540 7:107331740-107331762 TTTAAGAAGAAGCAGCAGGTGGG + Intronic
1030545655 7:110892079-110892101 GTTGAGAAACAGGAGGTGGAAGG - Intronic
1030658088 7:112190446-112190468 GTAAAGAAGCAGGAGGTGGATGG + Intronic
1030775616 7:113530643-113530665 GATCAGATGCAGCAGGAGCAAGG - Intergenic
1030853828 7:114525747-114525769 ATTAAGGAGCAGCAGCAGGTAGG - Intronic
1030995363 7:116352903-116352925 GTCAAGAAGTAGAAGGAGCATGG - Intronic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1032172954 7:129600942-129600964 TTCAAGAGGCAGCAGGATGAAGG - Intergenic
1032474235 7:132201552-132201574 ATTATGAAGCAGCAGGAAGAGGG - Intronic
1032522575 7:132557083-132557105 GTTACGAACCAGCAGTGGGATGG + Intronic
1032548997 7:132766886-132766908 GGTGAGCTGCAGCAGGAGGAGGG + Intergenic
1033500602 7:141945290-141945312 GCATAGAAGTAGCAGGAGGATGG + Intronic
1034406054 7:150903127-150903149 GTGAAGGAGAAGGAGGAGGAGGG - Intergenic
1034617549 7:152432181-152432203 GTACAGAAGCAGCAGGTGGTAGG - Intronic
1035245903 7:157561817-157561839 AGGAAGATGCAGCAGGAGGATGG + Intronic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1037300263 8:17444063-17444085 GATCAGAAGGAGGAGGAGGAGGG - Intergenic
1038050481 8:23805861-23805883 GTTGAGGAGCAGCAGGAGAGGGG - Intergenic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1039119499 8:34130019-34130041 GTAAGGAACCAGCAGGAGCAAGG + Intergenic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1040607714 8:48951035-48951057 GTTAAGTAGGAGCAGGAGACTGG - Intergenic
1041952543 8:63520079-63520101 AATAAGAAGAAGCAGAAGGATGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044364423 8:91326410-91326432 GTGAGGAAGCAGCAAGAGGGAGG - Intronic
1044875885 8:96666020-96666042 GTTAGGAAGCAGAAGGAGTGAGG + Intronic
1045494632 8:102698270-102698292 GTTATCAAAAAGCAGGAGGAGGG + Intergenic
1045948082 8:107819703-107819725 GCTAAGAGGCAGGAAGAGGAGGG - Intergenic
1046809695 8:118519026-118519048 CTTAAGTATCAGCAGCAGGAGGG + Intronic
1046953610 8:120041487-120041509 GTTAACAGGAAGCAGGAGGCAGG - Intronic
1047705896 8:127499348-127499370 GTTAAAAAGCATCAGTGGGATGG + Intergenic
1048259052 8:132930274-132930296 GTGAGGAATCAGCATGAGGATGG + Intronic
1049062570 8:140287311-140287333 AGCAAGAAGGAGCAGGAGGAAGG + Intronic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1050339341 9:4620262-4620284 GTTATGAGGCCACAGGAGGAAGG - Intronic
1050339351 9:4620303-4620325 TTTATGAAGCCACAGGAGGAAGG - Intronic
1051840457 9:21391951-21391973 GCTGCGAAGCAGGAGGAGGAAGG + Intergenic
1051896024 9:21989979-21990001 GTTAGGATCCAGGAGGAGGATGG + Intronic
1051898486 9:22013057-22013079 GTGAAGAGGCAGCAGTAGGATGG - Intronic
1052444424 9:28542069-28542091 GGTAAGAAGCAGGATTAGGAAGG + Intronic
1053135589 9:35648632-35648654 GTTAAGAATCAGCAGGTGATGGG + Intergenic
1053292354 9:36889629-36889651 GTCTAGAAGCAGGAGAAGGATGG - Intronic
1055238851 9:74159309-74159331 GTCAAAAAGGAGCAAGAGGAGGG + Intergenic
1056018420 9:82416587-82416609 GGTAGGAAGCAGCAGCAGGAAGG + Intergenic
1056236970 9:84604361-84604383 GAAAAGAAGAAGGAGGAGGAGGG - Intergenic
1056711378 9:88994508-88994530 GTCATGAAGCAGCAGCAGAATGG + Exonic
1056851103 9:90084918-90084940 GTTATAAAGCAGCAGGAGGCAGG - Intergenic
1057181560 9:93033410-93033432 GAGAAGGAGCAGGAGGAGGAGGG - Intronic
1057214804 9:93221866-93221888 GTTTAGAAACAGCTGGTGGAGGG + Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057396046 9:94681449-94681471 GATGAGAAGGAGGAGGAGGATGG - Intergenic
1057640565 9:96816229-96816251 GTTAGAAGGCAGCAGGAGAAAGG + Intergenic
1058700645 9:107597431-107597453 TAAAAGAAGCAGCAGGATGAAGG - Intergenic
1059820948 9:117971392-117971414 GTCAAGAAGCACCATGTGGAGGG + Intergenic
1060046031 9:120341819-120341841 GCTCAGAAGAAGGAGGAGGAGGG + Intergenic
1060202708 9:121661054-121661076 GTGAAGAAGCGGGAGGATGAGGG + Intronic
1060960742 9:127678918-127678940 GGTAGGGAACAGCAGGAGGAGGG - Intronic
1061703240 9:132432464-132432486 GCTAGCAAGCAGCAGAAGGAGGG - Intronic
1062166326 9:135109443-135109465 GAGAAGAAGCCGCAGGAGAAGGG + Intronic
1062319901 9:135985810-135985832 ATTCAGGAGGAGCAGGAGGAAGG - Intergenic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1203756125 Un_GL000218v1:128589-128611 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
1203715491 Un_KI270742v1:141259-141281 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
1203535726 Un_KI270743v1:36969-36991 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
1203649741 Un_KI270751v1:104837-104859 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1187025741 X:15433909-15433931 GGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187536880 X:20149053-20149075 GTGAAGAGGCAGCAAGAGGGCGG + Intergenic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1189337949 X:40182209-40182231 GCCAGGAAGCAGCAGGAGGTAGG - Intergenic
1189546440 X:42047093-42047115 GACAAGAAGCAGCAGCAAGAAGG - Intergenic
1190598527 X:52068216-52068238 GTGAAGCAGCTGCAGGGGGAGGG + Exonic
1190610297 X:52185857-52185879 GTGAAGCAGCTGCAGGGGGAGGG - Exonic
1190828628 X:54041471-54041493 TCTAACAAGCAACAGGAGGAGGG + Intronic
1191846303 X:65550361-65550383 GTGGAGCACCAGCAGGAGGAAGG + Intergenic
1193422329 X:81296194-81296216 GACAAGCAGCAGTAGGAGGATGG + Intronic
1194349703 X:92810694-92810716 ATTAAGGAGCAGCAGGAAAAAGG + Intergenic
1195450245 X:105003367-105003389 TTTAAGAAGCATCTGGAGCAAGG - Intronic
1195934581 X:110112725-110112747 GTGAAGAGGCAGCATGAGGGTGG - Intronic
1196193682 X:112818936-112818958 CTTAGGAAGGAGCAGGATGAGGG - Intronic
1197150048 X:123210192-123210214 TTTAGGAAGCAAAAGGAGGATGG - Intronic
1197773598 X:130106205-130106227 GGTCAGCAGCAGCTGGAGGAGGG - Intronic
1197917202 X:131548916-131548938 GTGAAGAAGTGGCAGAAGGAAGG - Intergenic
1198516249 X:137410642-137410664 GTTATGAAGTAGTAGCAGGAGGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1200257919 X:154594767-154594789 GTTCTGCAGCAGCTGGAGGAAGG - Intergenic
1200658025 Y:5927297-5927319 ATTAAGGAGCAGCAGGAAAAAGG + Intergenic
1201143775 Y:11050432-11050454 GTGAGGAAGCTGCAGGAGAAAGG + Intergenic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201316757 Y:12654964-12654986 GTTAAAAAGCAATAGGAGGCAGG - Intergenic