ID: 906281172

View in Genome Browser
Species Human (GRCh38)
Location 1:44554916-44554938
Sequence AGGAATCAGAATTGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906281172 Original CRISPR AGGAATCAGAATTGTGGGCA GGG (reversed) Intronic
901613550 1:10518764-10518786 CGGAATCAGCATTTCGGGCAAGG - Intronic
905675119 1:39819394-39819416 AGGAATCTGACTTCTGGGCCAGG - Intergenic
905828346 1:41044496-41044518 AGGAATTAGAAGTTTAGGCAAGG + Intronic
906281172 1:44554916-44554938 AGGAATCAGAATTGTGGGCAGGG - Intronic
906872038 1:49493655-49493677 AGGAAACTGAAATGTGGGCTGGG + Intronic
907183482 1:52590933-52590955 AGAAATCAGGATTGGGGGCTTGG + Intergenic
907611287 1:55873974-55873996 AGCCATCAGAATTGAGGTCATGG - Intergenic
908965296 1:69754430-69754452 AGGAATCAAAATTGATGCCAAGG + Intronic
909145111 1:71920246-71920268 TGGAATAAGAACTGTGGGGAAGG - Intronic
911646331 1:100341119-100341141 ATGAATTACAATGGTGGGCATGG - Intergenic
913125132 1:115779896-115779918 AAGAATCAGCATTGTGGAAATGG + Intergenic
913196947 1:116465076-116465098 AGGAAATAAAATGGTGGGCAGGG + Intergenic
913267611 1:117060296-117060318 CGGAAGCAGAATTGGGGGCGGGG + Exonic
913995752 1:143651136-143651158 AGGAATCAGGATTGGGGGTGGGG + Intergenic
914474504 1:148012262-148012284 AGGAATCAGGATTGGGGGTGGGG + Intergenic
914492075 1:148158576-148158598 AGGAATCAGGATTGGGGGTGGGG + Intergenic
915578090 1:156794623-156794645 AGGAGTCAGGAATCTGGGCAAGG - Intronic
916432838 1:164748696-164748718 GAGAATGAGAATTGTGGTCATGG + Intronic
916617261 1:166454905-166454927 AGGTATCAGCATTATTGGCAAGG - Intergenic
916660347 1:166917728-166917750 AGGAATCAGAAATTTGGGCTGGG + Exonic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
918055278 1:181015952-181015974 AGAAAACAGATTTGTGGGCCAGG - Intronic
919406461 1:197190335-197190357 AGGAATCCAAATTTGGGGCAGGG - Intronic
919852246 1:201680814-201680836 AGAAAGGAGAATGGTGGGCAGGG + Intronic
919924493 1:202185412-202185434 AGGGACCAGAAAGGTGGGCAGGG + Intergenic
920422495 1:205844632-205844654 AGGAATCTGAATTTTGGTCAAGG + Intronic
922029279 1:221782270-221782292 ATGAATCAGTGTTGTGGCCAAGG - Intergenic
922031796 1:221808298-221808320 AGAAAGCAGGATGGTGGGCAGGG + Intergenic
922101690 1:222482350-222482372 AGAAATGAGCATGGTGGGCATGG - Intergenic
922262770 1:223957466-223957488 AGAAATGAGCATGGTGGGCATGG - Intergenic
922336643 1:224623672-224623694 ATTAATCAGAATTCTGGGGAGGG - Intronic
923055354 1:230422646-230422668 AGGAGACAGAAGAGTGGGCAAGG + Intronic
924344608 1:243062467-243062489 AGAAATGAGCATGGTGGGCATGG - Intergenic
924532732 1:244907034-244907056 AGGAATAACAAGTGTTGGCAAGG + Intergenic
1064146845 10:12832661-12832683 AGTGACCAGAATTGTGGCCATGG - Exonic
1064546809 10:16458629-16458651 AGGAATGAAAGTTGTGGGGAAGG + Intronic
1064605280 10:17032789-17032811 ATTAATCAGACTTCTGGGCAAGG + Intronic
1064781614 10:18845543-18845565 AGGAAGCAGGAATGCGGGCAGGG + Intergenic
1065255482 10:23862703-23862725 AGAAATCAAAATGGTAGGCAGGG + Intronic
1066731723 10:38442608-38442630 AGAAATGAGCATGGTGGGCATGG + Intergenic
1068384507 10:56307733-56307755 ATTAATTAGAATTCTGGGCATGG - Intergenic
1068614367 10:59096410-59096432 AGTACTCAGAGTTGTGGGAACGG + Intergenic
1069620338 10:69833599-69833621 AGGAATCAGAAATGGCTGCATGG + Intronic
1070552464 10:77501592-77501614 AGGAATCAGGCTGGGGGGCAGGG - Intronic
1071075552 10:81747021-81747043 AGGAATCAGAATTGAATACAAGG - Intergenic
1071556243 10:86604130-86604152 AGGAAGCAGAAATGTAGGCGAGG - Intergenic
1072835437 10:98706462-98706484 AGGAGACAGAAATGTGGACAAGG + Intronic
1075373401 10:121956977-121956999 AGGAATCATAATGGTCCGCAGGG + Intergenic
1075989216 10:126819560-126819582 AGGTAATTGAATTGTGGGCATGG + Intergenic
1076522703 10:131090918-131090940 AGGAGGCAGCACTGTGGGCAGGG + Intergenic
1076522716 10:131090966-131090988 AGGAGGCAGCACTGTGGGCAGGG + Intergenic
1076750335 10:132539018-132539040 AGGAACCAGAGTTAGGGGCAGGG - Intronic
1077059144 11:610131-610153 ATGAAACAGCATTCTGGGCAGGG + Intronic
1077910525 11:6568374-6568396 AGGAATCAGACTTGAGGCTAGGG - Intronic
1080183861 11:29455953-29455975 AGAAAACAGAAATGTGTGCATGG - Intergenic
1081589721 11:44413141-44413163 AGGCATCAGAAGTGCGGGGAAGG - Intergenic
1081662198 11:44894988-44895010 AGGAAACTGAAGCGTGGGCAGGG - Intronic
1081755378 11:45540668-45540690 ATTAATCAGAATAATGGGCAAGG - Intergenic
1081767681 11:45622738-45622760 AGGAATCAGAATTGGGCAGAGGG - Intergenic
1083735689 11:64679340-64679362 AAGAATCAGGATTGAGGGCCAGG + Intronic
1085015261 11:73169803-73169825 AGGAAGCAGGGCTGTGGGCAGGG + Intergenic
1085305211 11:75481938-75481960 AGGACACACAATTGGGGGCAGGG + Intronic
1088025786 11:105180763-105180785 AGAAATCAGGATTGTCGGCCGGG + Intergenic
1088219168 11:107549144-107549166 AGAAATCAGAATTTTAGGCTGGG - Intronic
1088543834 11:110940218-110940240 AGGAATGAGCAAGGTGGGCAGGG - Intergenic
1088692468 11:112339399-112339421 AGGAGACAGAATTGTGTGTAAGG + Intergenic
1089794502 11:120969421-120969443 AGGAGTCAGTGCTGTGGGCAGGG + Intronic
1090879763 11:130823389-130823411 AGGAATCAGAAGTGAGGGGTAGG + Intergenic
1091328917 11:134715065-134715087 TGGAGTCAGAATCATGGGCAGGG + Intergenic
1091567974 12:1662170-1662192 GGGAATCAGGAATCTGGGCAGGG - Intergenic
1091694759 12:2620889-2620911 ATGAATGAGAATTGTGAGCCCGG + Intronic
1091791586 12:3275006-3275028 AGGAAGCAGATTTGGGGACAGGG + Intronic
1093249241 12:16780201-16780223 AGGAAACACCATTCTGGGCATGG + Intergenic
1095880914 12:47135390-47135412 AGGACTCAGCTTTGGGGGCAGGG + Intronic
1097466706 12:59934996-59935018 AGCAATCACAAATGTTGGCAAGG + Intergenic
1097855092 12:64453206-64453228 AGTAATCACAATAGTGGTCAGGG - Intronic
1098696402 12:73562453-73562475 AGTTATCAGATTTGTGGACAAGG - Intergenic
1099176310 12:79426953-79426975 AGGAAGGAGAATTGTAAGCAGGG - Intronic
1099356405 12:81641351-81641373 TGTAATCTGAATTGTGGCCATGG - Intronic
1099403422 12:82228604-82228626 AGGAAAAAGAATTGTTGGCCGGG + Intronic
1101420175 12:104544419-104544441 AGAAATCAGAAATTTGGGCCGGG + Intronic
1103352053 12:120290896-120290918 AGGAGTCACAACTCTGGGCATGG - Intergenic
1106016825 13:25877586-25877608 TGGAAACAGAATTGTGGGGTCGG - Intronic
1108068975 13:46607938-46607960 ATGAAGCAGAACTGAGGGCAGGG + Intronic
1108880740 13:55111632-55111654 AGGAGTCATAATCATGGGCATGG + Intergenic
1108925286 13:55734838-55734860 AGGAATCAGTATTGTGAAAATGG + Intergenic
1109228722 13:59729111-59729133 AGGCATCAGAATTCCTGGCAAGG + Intronic
1110512557 13:76368399-76368421 AGGAATAAAAATTGTTTGCAAGG + Intergenic
1110960679 13:81620316-81620338 ATGATTTATAATTGTGGGCAGGG + Intergenic
1113975686 13:114225701-114225723 AGGAATAAGAATTGCAGGCGTGG + Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1119253021 14:73173613-73173635 AGCATTCAGAATTGAGTGCAGGG - Exonic
1119509701 14:75201087-75201109 AGGAATCAGAATCTTGAGGATGG + Intergenic
1119645272 14:76343453-76343475 ACAAATCTGAAATGTGGGCAGGG + Intronic
1121088857 14:91167534-91167556 AGGAGTCAGAACAGTGGGGAGGG - Intronic
1121170243 14:91847714-91847736 ATGAATCTGCAATGTGGGCAGGG - Intronic
1122190713 14:100040810-100040832 AAGAATAATAAATGTGGGCATGG + Intronic
1124340694 15:28887576-28887598 AGGAATCAGCACAGAGGGCAGGG - Intronic
1125074256 15:35594570-35594592 AGTAATCATAAGTGTCGGCAGGG - Intergenic
1126026267 15:44448663-44448685 AGAAATTAGAATGGAGGGCATGG - Intronic
1127352052 15:58162884-58162906 ATGAATCAGCAATTTGGGCAGGG - Intronic
1130338789 15:82980976-82980998 AGGATACAGGATTGAGGGCAGGG + Intronic
1130612052 15:85370147-85370169 AGGGGTGGGAATTGTGGGCAGGG + Intergenic
1130939194 15:88493843-88493865 AGGACTCAGAGTTGCGGGAAGGG + Intergenic
1131333539 15:91525234-91525256 AGGAATCAGAATTGTGCTTTGGG + Intergenic
1131425964 15:92345680-92345702 AGGACTTAGAATGGTGAGCATGG + Intergenic
1134769906 16:16799156-16799178 AGGAATCACGAGTGTGGACAAGG - Intergenic
1136099565 16:27983744-27983766 AGAAATCAAAATGGGGGGCAGGG + Intronic
1137395532 16:48114183-48114205 AGGCATCCGAATTTTGCGCATGG - Intronic
1138279811 16:55764201-55764223 AGGAATTAGAAGAGGGGGCAAGG - Intergenic
1138288686 16:55829447-55829469 AGGAATTAGAAGAGGGGGCAAGG + Intronic
1142622083 17:1171608-1171630 AGGCATCAGAGGTGAGGGCAGGG + Intronic
1142767599 17:2074230-2074252 AGAAATCAGAAGCGCGGGCATGG - Intronic
1142862880 17:2774140-2774162 AGGAATCAGAATTGTCTGAAGGG + Intergenic
1144058553 17:11561579-11561601 AGAAATTTGAATTGGGGGCAAGG - Exonic
1144511396 17:15880399-15880421 AGAAATCAGAGTTGGAGGCAGGG + Intergenic
1145122889 17:20276849-20276871 AGAAGTCAGAATTGGAGGCAGGG + Intronic
1145175555 17:20698117-20698139 AGAAATCAGAGTTGGAGGCAGGG + Intergenic
1147169697 17:38610694-38610716 AGGCATAAGAATTGTCGGGATGG + Intergenic
1148330332 17:46810295-46810317 AGGAATAAGAAGGCTGGGCATGG - Intronic
1149502575 17:57165374-57165396 AGGAAGAAGAATGGTAGGCAGGG + Intergenic
1150530614 17:65977600-65977622 AGCAGTCAGAGCTGTGGGCAGGG + Intronic
1152321997 17:79612906-79612928 AGGGAGAAGAAATGTGGGCAAGG - Intergenic
1152380320 17:79938984-79939006 AGGAGTCAGCAGTCTGGGCAGGG - Exonic
1153191690 18:2548024-2548046 AGGAGTCAGCATTTTGTGCAGGG - Intronic
1153871421 18:9324113-9324135 AAAAATAAGAATTGTTGGCAAGG + Intergenic
1154156638 18:11948935-11948957 AGGCAACAGAAATGAGGGCAGGG - Intergenic
1154192166 18:12239381-12239403 AGGAGGCAGAGTTGTGGGGAGGG - Intergenic
1158321547 18:56269489-56269511 AGGAATCAGAGTTGGGTGCAAGG + Intergenic
1158488132 18:57886617-57886639 AGGAGTCAGAATTGTTGGGGGGG + Intergenic
1160725054 19:614161-614183 AGGCATCAGGAGTGTGGCCATGG + Intronic
1162014275 19:7835933-7835955 AGGAATCAGAAATGGGGGGTAGG + Intronic
1162787967 19:13047619-13047641 AGGCCCCAGAACTGTGGGCAGGG + Intronic
1163214970 19:15869875-15869897 GGGAATCAGAATTGAGCCCAGGG + Intergenic
1165857151 19:38886276-38886298 AAGATTTAGAATAGTGGGCAAGG - Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1167779521 19:51590065-51590087 AGTAATCAAAACTGTGGGAATGG - Exonic
925285300 2:2711869-2711891 AGGAATCAGGAATTTGGGAACGG + Intergenic
927452551 2:23221616-23221638 TGGATTCATAATTGTGGGAAAGG + Intergenic
927994932 2:27477970-27477992 AGGAACCAAAATTGAGGGTAGGG - Intronic
928418731 2:31120854-31120876 AGGATTCAAAATTGTGTCCATGG - Intronic
928907182 2:36380779-36380801 AGGAATCAGAATTGTGGCATTGG + Intronic
928951436 2:36816953-36816975 TGGCATCAGAATTGTCGGTATGG + Intergenic
930976837 2:57473315-57473337 AGACATCAGAAGTGTAGGCAAGG - Intergenic
932426689 2:71642085-71642107 AGGAACAAGAATTGTGGGGAAGG - Intronic
932983659 2:76700023-76700045 ATTAATCAAAATTCTGGGCAGGG - Intergenic
933990974 2:87633546-87633568 GGGATTCAGAATTGAGGGCTGGG + Intergenic
935789604 2:106578783-106578805 AATACTCAGAATGGTGGGCAGGG + Intergenic
935806832 2:106757105-106757127 AGGAAGCAGAATCATGGGGATGG + Intergenic
935985865 2:108672540-108672562 AGGACACTGAATTGAGGGCATGG + Intronic
936049425 2:109211942-109211964 AGGTAACAGAAATGTGGGAAGGG - Intronic
936138296 2:109916167-109916189 AGGACACTGAATTGAGGGCATGG + Intergenic
936206400 2:110455318-110455340 AGGACACTGAATTGAGGGCATGG - Intronic
936302866 2:111317277-111317299 GGGATTCAGAATTGAGGGCTGGG - Intergenic
936680827 2:114769200-114769222 AGGAATCAGAATACTTGGCTTGG + Intronic
937278131 2:120699392-120699414 AGGCAGGAGAATTGTGGGCAGGG + Intergenic
937466672 2:122138990-122139012 ATGAAGTAGAATTGTGGGCCTGG - Intergenic
938084290 2:128388626-128388648 TGGAATCTGAATTTAGGGCAAGG - Intergenic
938630044 2:133156649-133156671 AGGAAGCAGAGTTGTGGAAACGG - Intronic
939102883 2:137915548-137915570 AGGAATCAGACTTGGGTGCCCGG + Intergenic
939370247 2:141290050-141290072 AGGAATCAGAATTCAGGCCAAGG + Intronic
939569493 2:143823947-143823969 AGGAGTCTAAATTGTGGGAATGG + Intergenic
943140301 2:183974081-183974103 AAGAATCAGTATTGTGAACATGG - Intergenic
943163507 2:184285279-184285301 AAGAATCAATATTGTGGACATGG + Intergenic
943631159 2:190253952-190253974 AAGAAGCAGAATTGGGGGAAGGG - Intronic
944908392 2:204285427-204285449 AGGAAGCAGAAGTGGGGGCCTGG + Intergenic
945199157 2:207264198-207264220 AGGAAGCAAAAGTGAGGGCATGG - Intergenic
945911369 2:215653607-215653629 AGACTTCAGAAATGTGGGCAGGG + Intergenic
946156293 2:217808914-217808936 AGGAATAGGAAATGTGGGGAGGG + Intronic
946439706 2:219685008-219685030 CTGAATCACAAGTGTGGGCAGGG + Intergenic
949005501 2:241644573-241644595 AGGAATCAGAAGTGTTGGCCGGG + Intronic
1168988593 20:2073527-2073549 AGTTATCAAATTTGTGGGCATGG - Intergenic
1169594193 20:7179497-7179519 AGCAGTCATAATTGTGGGTATGG - Intergenic
1169828069 20:9791393-9791415 AGGAATCAAAGTTGTGCCCAAGG - Intronic
1170322394 20:15114616-15114638 ATGGATCAGAAGTCTGGGCATGG - Intronic
1175863791 20:62163828-62163850 AGGAGTCAGTGTTGGGGGCAGGG + Intronic
1177137697 21:17323933-17323955 AAGAATCAGTATTGTTGGCTGGG + Intergenic
1179090780 21:38263592-38263614 GGGAATCATAGTTGTGGTCAGGG - Intronic
1179410468 21:41159260-41159282 AGGGAATGGAATTGTGGGCAAGG + Intergenic
1180608705 22:17081725-17081747 AGGAAACAAAAGTGTGGGGAAGG - Intergenic
1181371779 22:22424752-22424774 AGGAATCAGAGATGTGGGAGGGG - Intergenic
1181372619 22:22430167-22430189 AGGAAGCACATCTGTGGGCAGGG + Intergenic
1181989666 22:26827876-26827898 AGAATTCAGCATTCTGGGCAAGG + Intergenic
1182124704 22:27808057-27808079 AGGCATCAGAACTGTGGGCAAGG - Intergenic
1182425339 22:30268549-30268571 AGGAAACAGCATTGTGGGGGTGG - Intergenic
1182784900 22:32899237-32899259 AGGCATCAGAAAAGTGGGGAAGG - Intronic
1184389520 22:44195210-44195232 AGGGAGCAGTATTTTGGGCAGGG + Intronic
950297567 3:11845345-11845367 AGGAATCAAAAGTGAGGGAATGG + Intronic
950877257 3:16287636-16287658 AGGATTCAGAGTTGAAGGCACGG - Intronic
950989795 3:17420768-17420790 AGGAAACAGAAGTGTGTCCAGGG + Intronic
952643467 3:35626298-35626320 AAGAAATAGAATTGTGTGCAAGG + Intergenic
952737828 3:36707638-36707660 AGGAATCATCAGTGTGGCCATGG + Intergenic
952867452 3:37863328-37863350 AGGAAACAGAATGGGGGGCTGGG - Intronic
955611789 3:60765458-60765480 GGGAATGAGAATAGTGGGTAAGG + Intronic
957177618 3:76831862-76831884 TGGAATCAGCTTTGTGGCCAGGG + Intronic
957829549 3:85498382-85498404 ATGAATCAATAATGTGGGCAAGG + Intronic
960740672 3:120830154-120830176 GGGAATCAGAAGTGTGGGATGGG + Intergenic
961849793 3:129804675-129804697 AGTATTCAGATTTGTGGGCACGG + Intronic
962937291 3:140092682-140092704 AGGAATCAGGTTTGAGAGCAGGG - Intronic
963862825 3:150328509-150328531 AGAAGTGGGAATTGTGGGCAAGG + Intergenic
964083189 3:152785246-152785268 AGAAAAGAGAACTGTGGGCAAGG - Intergenic
964836945 3:160949531-160949553 AGGAAGAAACATTGTGGGCACGG + Intronic
965388375 3:168073512-168073534 AAGGATTAGAATAGTGGGCATGG + Intronic
965565161 3:170108274-170108296 AGGACTCAGAAATGTAGACATGG + Intronic
965750105 3:171966850-171966872 TGGAAACAGAATTGAGGGCTAGG + Intergenic
966028321 3:175313767-175313789 AGGAATCAGAAAAGTGGTCCGGG + Intronic
966842474 3:184100728-184100750 AGGAAGCAGAAATGTGGATAAGG - Intronic
969005859 4:4019696-4019718 AGGAATCATAATAGTGGGGGTGG - Intergenic
969807090 4:9617594-9617616 AGGAATCATAATAGTGGGGGTGG + Intergenic
970193929 4:13538545-13538567 AGGAGTAAGATTTGTGGGCTCGG + Intergenic
972359598 4:38314774-38314796 AGAATATAGAATTGTGGGCAGGG + Intergenic
973301673 4:48591894-48591916 AGGAATCAAATCTGGGGGCAAGG - Intronic
974052621 4:56955220-56955242 CTTAATCAGAATTGTGGGTAAGG + Intergenic
974692689 4:65318580-65318602 TGGAATCAGAATTGTGTGATGGG + Intergenic
975719420 4:77235499-77235521 AGGAATGAGAAAAGTGGGCATGG + Intronic
977582939 4:98744930-98744952 AGGAATCAGAAGTGCTGGCAGGG - Intergenic
977856187 4:101897307-101897329 TGGAATCAAAATTGTGGAGATGG + Intronic
977918649 4:102620461-102620483 ACGAATCTGCAATGTGGGCAGGG - Intergenic
978548789 4:109901917-109901939 CTGAATCAGAATGGAGGGCAGGG + Intergenic
979067720 4:116158733-116158755 AGGAAGCAGAATTGAGACCAGGG + Intergenic
979258108 4:118625232-118625254 AGAAATGAGCATGGTGGGCATGG + Intergenic
979330238 4:119415336-119415358 AGAAATGAGCATGGTGGGCATGG - Intergenic
981379074 4:144050807-144050829 AGGAAACAGAGTTGTGGGGGTGG + Intergenic
982208243 4:153013615-153013637 AGGTACCAGACTTGTGAGCAAGG - Intergenic
982367222 4:154592652-154592674 AGGAAGCAGAATTTGAGGCAAGG - Intergenic
984185538 4:176538603-176538625 AGGAAGCAGGATTGTGTGGAAGG + Intergenic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
985285280 4:188330771-188330793 AAGTATCAGAAGTGTGGGCCTGG - Intergenic
985548904 5:523536-523558 ATGAACCAGTAATGTGGGCACGG - Intronic
986345635 5:6832756-6832778 AGGAATCAAAACTGTGTGGAAGG - Intergenic
988921932 5:35950852-35950874 AGGAATTAGAAATGTGAGGAAGG - Intergenic
989792922 5:45429288-45429310 AGGAATGTGAAATTTGGGCAGGG + Intronic
990200025 5:53361631-53361653 AGCAGGTAGAATTGTGGGCAGGG - Intergenic
991157072 5:63451262-63451284 AGGAATTAGAATTTGGGGCTTGG - Intergenic
992213589 5:74504648-74504670 AGGTGTCAGAGTTGTGGGGATGG - Intergenic
993800416 5:92327063-92327085 AGAAATAAAAATTGTTGGCAAGG - Intergenic
993820869 5:92614842-92614864 AGGAATCAGAATTGAAGATAAGG + Intergenic
994246268 5:97481258-97481280 AGGAATCAGAATGGTGGAGTAGG - Intergenic
994266984 5:97729056-97729078 ATGAATCAGAATTGCTGGCAAGG + Intergenic
994807272 5:104465593-104465615 ATGAATCTGCAATGTGGGCAGGG + Intergenic
995024110 5:107399018-107399040 AGGAGCCAGCAGTGTGGGCAGGG - Intronic
995516377 5:112958287-112958309 CAGAATCAGAATTTTGGGAAGGG - Intergenic
997927270 5:138042312-138042334 AGAAGTCAGAATTGTGGTTAAGG + Intronic
998457289 5:142283093-142283115 AGGAAACTGATATGTGGGCAAGG - Intergenic
999064152 5:148667505-148667527 TGAAATCTGAATTGAGGGCAAGG + Intronic
999555022 5:152730820-152730842 AGAAAACAAAATTGTGGGTAGGG - Intergenic
999774047 5:154797604-154797626 AGGAATTAAGATTATGGGCATGG - Intronic
1000125209 5:158237253-158237275 AGGAGGCTGAATTGAGGGCAGGG - Intergenic
1000194386 5:158943734-158943756 GGGAAACAGAATAGTGGGGAGGG + Intronic
1000957935 5:167564177-167564199 AGGATGGAGAATTGGGGGCAAGG + Intronic
1001873676 5:175180716-175180738 AGGAACAGGAATTGTGGTCATGG + Intergenic
1003477458 6:6497431-6497453 AGGAAGCAGCTTTATGGGCATGG + Intergenic
1003899351 6:10639585-10639607 AGGAAGCAAAATTCTGTGCATGG + Intergenic
1004362062 6:14979897-14979919 AAGAATGTGAATTGTGGGCCAGG - Intergenic
1004720083 6:18261275-18261297 AGGATTCAGACTTGTAGGCCGGG + Intronic
1004957455 6:20745363-20745385 TGGGATCAGTATTGAGGGCAAGG + Intronic
1005313949 6:24586571-24586593 AGGAAAGAGGATTGTGGGGAAGG - Intronic
1006600778 6:35224255-35224277 AGGGATAAGCATTGTGAGCAGGG + Intronic
1006708011 6:36038651-36038673 TGGAATGAGAGTTGTGAGCATGG - Intronic
1007541084 6:42645198-42645220 TGGGATCAGAAATGTGGGAAGGG - Intronic
1009195369 6:60678327-60678349 AGGAAGGAGAAGAGTGGGCAAGG + Intergenic
1010031683 6:71277998-71278020 AGGAATGAGAAGTGTCTGCAGGG + Intergenic
1011331052 6:86206923-86206945 AGCAATCAGAATAGTTGACATGG - Intergenic
1013792291 6:113851400-113851422 AGGATTGAGACTTTTGGGCATGG - Intergenic
1015613247 6:135048459-135048481 AGGACTCAGACCTCTGGGCAGGG - Intronic
1018443750 6:163836161-163836183 AGAAAAAAGAATTGTGGGGAGGG - Intergenic
1018479414 6:164174809-164174831 AGCAATGAGACTTGTGTGCAGGG + Intergenic
1019136664 6:169912813-169912835 GGGAAGCAGCATTTTGGGCACGG - Intergenic
1019595775 7:1857690-1857712 AGGACACAGGAGTGTGGGCAAGG + Intronic
1021067318 7:16192555-16192577 AGAAATCAGAATAGTGGAAAAGG - Intronic
1022204130 7:28147139-28147161 AAAAATCAGAATTCTGGGCCAGG - Intronic
1022226440 7:28368462-28368484 TGGAATCAGAAAGGTAGGCAGGG - Intronic
1022764556 7:33396548-33396570 AAGAATCAGTATTGTGCACATGG + Intronic
1023400093 7:39786525-39786547 AGAAATGAGCATGGTGGGCATGG + Intergenic
1024073022 7:45802275-45802297 AGAAATGAGCATGGTGGGCATGG + Intergenic
1024341715 7:48270848-48270870 AGAGTTCAGAATTGTGGGTAAGG - Intronic
1024650311 7:51397909-51397931 AGAAATGAGCATGGTGGGCATGG - Intergenic
1025054454 7:55753562-55753584 AGAAATGAGCATGGTGGGCATGG - Intergenic
1025132506 7:56383714-56383736 AGAAATGAGCATGGTGGGCATGG - Intergenic
1025735052 7:64139570-64139592 AAGAATCTCAGTTGTGGGCAGGG + Intronic
1025911489 7:65832314-65832336 AGAAATTAGCATGGTGGGCATGG + Intergenic
1026532462 7:71211654-71211676 AGCTATCAGCATTTTGGGCAAGG - Intronic
1027972633 7:85105023-85105045 AGGAAAAAGAAAAGTGGGCAGGG - Intronic
1028399621 7:90410692-90410714 GGGAATAAGAATTGTGGGGGTGG + Intronic
1030487391 7:110187394-110187416 AAGCATCAGAATTGTGAGAAAGG + Intergenic
1030626367 7:111849958-111849980 AGAAAGCTGAAATGTGGGCACGG - Intronic
1032050409 7:128645970-128645992 AGAAATGAGCATGGTGGGCATGG + Intergenic
1032238926 7:130146545-130146567 AGGAAAAAGTATAGTGGGCAGGG - Intergenic
1033808033 7:144976724-144976746 AGGAATCTGATTTGGTGGCAAGG + Intergenic
1034157032 7:148964459-148964481 AGGACTGAGAAATGTGGCCAAGG - Intergenic
1036940094 8:13043472-13043494 AGGAAGCAGAATTGGGCCCAAGG + Intergenic
1037637276 8:20711264-20711286 TGGAAGCAGCATTGTGGGGAAGG - Intergenic
1038053261 8:23833317-23833339 GGGAAGCAGAACTGGGGGCATGG + Intergenic
1038418715 8:27418073-27418095 AGGAATCAGAACTGAGGCCCTGG - Intronic
1038649944 8:29393479-29393501 AGCAATCATCATAGTGGGCAAGG + Intergenic
1038819369 8:30938226-30938248 AGACATCAGAATTGTGTCCAGGG - Intergenic
1038965274 8:32565119-32565141 GGGAATGGGAATGGTGGGCAGGG - Intronic
1039471447 8:37815830-37815852 AGGACCCAGAATTGTGGTCCAGG - Intronic
1040444015 8:47475264-47475286 AGAAATGTGAATTGAGGGCAGGG - Intronic
1040961750 8:53041496-53041518 AGGAATCAGTATTGTTAGAATGG - Intergenic
1041784489 8:61616426-61616448 GGGAGTCCGAATGGTGGGCATGG - Intronic
1042774426 8:72414109-72414131 AGGAATCCAAATTTTCGGCATGG - Intergenic
1043277124 8:78412061-78412083 AGGTTTCAGAATTTAGGGCATGG + Intergenic
1043434478 8:80224814-80224836 AGCAACCAGAATTGAGGGAAGGG - Intronic
1047086941 8:121527867-121527889 AGGAAAGAGAATTATGGGTATGG + Intergenic
1049510839 8:143025921-143025943 GCTACTCAGAATTGTGGGCAGGG + Intergenic
1049910884 9:266710-266732 AGGAGTCAGAATGGTGGTGATGG - Intronic
1050639891 9:7656136-7656158 AGGAATCAGAATTATGTGCCTGG - Intergenic
1051359051 9:16265729-16265751 AGGACTCAGAAGTGTGAGGAAGG - Intronic
1051759463 9:20445257-20445279 AAGAAGAAGTATTGTGGGCAGGG - Intronic
1052180987 9:25527451-25527473 TGGAATCAGCAGTGTGGGCCAGG - Intergenic
1052557531 9:30036418-30036440 AGGAATCAGAATTGGGGAGGAGG - Intergenic
1052782041 9:32791369-32791391 AATGAGCAGAATTGTGGGCATGG + Intergenic
1054956090 9:70911976-70911998 AGGAATGAGGATTGAGGGCCTGG + Intronic
1055565287 9:77562335-77562357 AGGAATGAGGATTGAGAGCAAGG + Intronic
1055730937 9:79278782-79278804 GGGAATCTGAATTGTCGGTAAGG + Intergenic
1056492433 9:87120839-87120861 AGGAATCTGAAAGGTGGCCAAGG + Intergenic
1056703186 9:88927491-88927513 AGGAGTCAGAAGTCTGGGCATGG - Intergenic
1057075134 9:92134634-92134656 AGGGACCAGAAAGGTGGGCAGGG + Intergenic
1057514970 9:95713121-95713143 AGGAATCTGAGTTGTGGACATGG - Intergenic
1058083640 9:100725456-100725478 AGGAATCAGAAATCTAGGCAAGG - Intergenic
1058339599 9:103878224-103878246 AAGAATCAGAATTATTGGCCGGG - Intergenic
1058910060 9:109512800-109512822 AGGAATAAGAAATGTGTCCACGG - Intergenic
1059798066 9:117721230-117721252 AGGACTCAGAAAGGTGGGAAGGG - Intergenic
1060273240 9:122162808-122162830 AGAGATGAGGATTGTGGGCAGGG + Intronic
1060927130 9:127462898-127462920 AGGAATAAGATTTCTGGGCTGGG + Intronic
1062220778 9:135413913-135413935 AGGAATCAGTTTTGTGTGGATGG - Intergenic
1185883747 X:3763408-3763430 AGGAATCAGAGTTTAGGGCTGGG + Intergenic
1187418411 X:19113688-19113710 AGGAATCTGGATTAAGGGCATGG + Intronic
1189807580 X:44751104-44751126 AGCAATGAGTATTGAGGGCAAGG - Intergenic
1190829573 X:54047892-54047914 AGGAATCAAAAGTGTTGGCCGGG + Intronic
1191899113 X:66022782-66022804 AGTAATCAAAATTGAGGGCAGGG + Intronic
1194912953 X:99669873-99669895 AAGAATCAGTATTGTGAACATGG - Intergenic
1195684638 X:107574638-107574660 TGGAATCAGAATTGAGCCCAAGG + Intronic
1196041914 X:111214032-111214054 AGGAATGAGAGTTGGGGGAAAGG + Intronic
1196157833 X:112450384-112450406 AGGGATCAGACTTGTGAGCTCGG - Intergenic
1197203256 X:123767476-123767498 AGGAATCACAAATGTGTCCAGGG - Intergenic
1197234710 X:124047662-124047684 AGAAAACAGTATTGTTGGCACGG - Intronic
1197334696 X:125198850-125198872 ATGAATCAGTACAGTGGGCAGGG + Intergenic
1199012809 X:142777424-142777446 AAGAGTCACAATTCTGGGCAGGG + Intergenic