ID: 906282496

View in Genome Browser
Species Human (GRCh38)
Location 1:44563932-44563954
Sequence GTGTGGGTCTCTAACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906282496 Original CRISPR GTGTGGGTCTCTAACTCAGG AGG (reversed) Intronic
901474098 1:9477228-9477250 GTGTGGGTCTCATTCTCAAGTGG - Intergenic
902145306 1:14393812-14393834 GTCTGGCTCTGTCACTCAGGCGG - Intergenic
902331999 1:15735293-15735315 GTGTGGGACTCCAACTTGGGTGG + Intergenic
903063212 1:20684484-20684506 GAGTGGGTCTCACATTCAGGAGG + Intronic
906282496 1:44563932-44563954 GTGTGGGTCTCTAACTCAGGAGG - Intronic
906787770 1:48630828-48630850 GAGAGGGTGTCTTACTCAGGAGG - Intronic
912332647 1:108833831-108833853 GCCCGGGTCTCCAACTCAGGTGG - Intronic
912535300 1:110364057-110364079 GTGTAAGTCCCTAACTCAGGTGG - Intronic
919069294 1:192733657-192733679 GAGTGAATCTCTAACTCAAGGGG - Intergenic
919813021 1:201420874-201420896 GTGGCGGTCCCTGACTCAGGTGG - Intronic
921315913 1:213890343-213890365 GTATGTGTCTGTAACTCATGAGG + Intergenic
923473432 1:234312274-234312296 GTGAGGGTCTTTAAACCAGGAGG + Intronic
924719108 1:246606292-246606314 GGGTGGTTCTCTAATTTAGGGGG - Intronic
924722299 1:246635415-246635437 GGGTGGTTCTCTAATTTAGGGGG - Intronic
924795577 1:247290061-247290083 GGGTGGTTCTCTAATTTAGGGGG + Intergenic
1063021455 10:2133074-2133096 ATGAGGGTCTTTAACTCATGAGG + Intergenic
1065592000 10:27272201-27272223 ATGTGCGTCTTTTACTCAGGAGG - Intergenic
1067831529 10:49613664-49613686 GTGGGGGTCTCTATCTGGGGTGG + Intronic
1068447641 10:57143388-57143410 GTGTGGGAGTCTAACTTTGGAGG + Intergenic
1068629020 10:59280550-59280572 GTGTGGTTCTATTATTCAGGAGG + Intronic
1070765029 10:79051480-79051502 CAGGGGGTCTGTAACTCAGGCGG - Intergenic
1077218510 11:1405030-1405052 GTGTGGGCCTCCATCTCTGGTGG + Intronic
1078760784 11:14249644-14249666 GTGTGGATCTGTAATTTAGGAGG + Intronic
1079919816 11:26418916-26418938 GGGTGGGGCTCTAACCCATGGGG + Intronic
1080426006 11:32154808-32154830 GTGTAGGGCTCTAACTCAGTGGG - Intergenic
1082632381 11:55557708-55557730 GGGTGGTTCTCTAATTAAGGAGG + Intergenic
1082635365 11:55587003-55587025 GGGTGGTTCTCTAATTTAGGAGG + Intergenic
1083347173 11:62001628-62001650 GTGTGGGGGGTTAACTCAGGAGG + Intergenic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1087048246 11:93862396-93862418 GCGTGGCTCTCTAATTGAGGAGG - Intergenic
1089629277 11:119774049-119774071 GTGACAGACTCTAACTCAGGAGG + Intergenic
1099862250 12:88234897-88234919 GGGTGGCTCTCTAATTTAGGAGG + Intergenic
1101463535 12:104923134-104923156 GTGTGGGTCACGAGGTCAGGAGG + Intronic
1103804447 12:123561519-123561541 GTCTGGCTCTGTCACTCAGGCGG + Intergenic
1106897932 13:34325129-34325151 TTGTGGGTCTCTAACCCTGATGG + Intergenic
1110291602 13:73814186-73814208 GTGTGGGTGTGTAGCTCATGTGG - Intronic
1115488971 14:33940562-33940584 TTGTGAATTTCTAACTCAGGAGG + Intronic
1117603873 14:57404844-57404866 GTGGGAGTCTCTAAATCATGGGG - Intronic
1119931639 14:78553405-78553427 GAGTGGGTCTTAAACTCAGTGGG - Intronic
1122994602 14:105256296-105256318 GTGTGGGTCTCCATGGCAGGAGG - Intronic
1123401501 15:19991239-19991261 CTGTGGGTCTGTAACTCACAGGG - Intergenic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1127662652 15:61114776-61114798 GGTTGGGTCTCTAAATCAGAAGG - Intronic
1131679203 15:94703596-94703618 GTGTGTGTATGTATCTCAGGAGG + Intergenic
1133349572 16:5092575-5092597 GTGTGGCTCTTTCACTCAGCAGG + Intronic
1136589674 16:31210288-31210310 GAGTGGGTGTCTAAGACAGGTGG - Intergenic
1143546842 17:7602083-7602105 GAGAGGGTCTCTAACCCAGATGG + Intronic
1144636864 17:16915686-16915708 GCAGGGGTCTCAAACTCAGGTGG - Intergenic
1144648659 17:16992042-16992064 GCAGGGGTCTCAAACTCAGGTGG + Intergenic
1146383729 17:32350529-32350551 GTGTGACTCTGTGACTCAGGAGG + Intronic
1146457415 17:33018429-33018451 GAGTGGTTCTCAAACTCTGGTGG - Intronic
1146576258 17:33994457-33994479 CTGTGGGTCCCTAAGTCATGAGG + Intronic
1147184091 17:38704472-38704494 TTGCGGGTCTCTAACTCTCGTGG + Intergenic
1147924730 17:43939222-43939244 GTGGGGGGCTCTAACCCAGAGGG + Intergenic
1151390490 17:73783903-73783925 GTGGGGGTCTCAAACTATGGGGG - Intergenic
1151578027 17:74962696-74962718 GTGTGGGGCTCAGACACAGGAGG - Intronic
1152819569 17:82429899-82429921 ATGAGGGTCTGTAACCCAGGAGG - Intronic
1162126748 19:8503566-8503588 CTGTGGCTCTCTAGCCCAGGAGG - Intergenic
1162328814 19:10014301-10014323 GTGTGCGTCTCTAAAACAGAGGG - Intronic
1162950229 19:14067708-14067730 GTGTGGGCCTGCTACTCAGGAGG - Intergenic
1164237548 19:23350294-23350316 GGGTGGTTCTCTAATTTAGGGGG + Intronic
1166289336 19:41851684-41851706 CTCTGGGTTTCTAGCTCAGGAGG - Exonic
927242345 2:20930020-20930042 GTGTTGCTCTCTCACCCAGGTGG + Intergenic
927263129 2:21114823-21114845 GTTTTTGACTCTAACTCAGGAGG - Intergenic
927512320 2:23651893-23651915 GGGTGGGTCCCTAACCCAGTCGG - Intronic
929578268 2:43066316-43066338 TTGTGGGTGTCCAAATCAGGGGG - Intergenic
930316389 2:49801528-49801550 GGGTGGGTCACGAGCTCAGGAGG - Intergenic
931350774 2:61486377-61486399 GTGGGTGTCTCCAACTTAGGTGG + Intronic
935719702 2:105969159-105969181 GGGTGGTTCTCTAATTTAGGAGG - Intergenic
938559787 2:132461867-132461889 GTGTGGGGCTCTGACTCATGTGG - Intronic
1168855587 20:1005460-1005482 GTTTGGTTCTCTAACTATGGGGG + Intergenic
1170094237 20:12628747-12628769 GTCTGGCTCTGTCACTCAGGTGG + Intergenic
1170718013 20:18848686-18848708 ATGTGGGTCTCTAACTGAAAAGG - Intergenic
1174160072 20:48544240-48544262 GTCTGGGTCTCCAACTCCAGTGG - Intergenic
1179645888 21:42775912-42775934 CTGAGGGTCTCTATCTCGGGAGG + Intergenic
1179666649 21:42917397-42917419 GGGTGGTTCTCTAATTTAGGAGG - Intergenic
1180216871 21:46329568-46329590 GTGTGCATCTCTAAGTCAAGGGG - Intronic
1181141393 22:20807803-20807825 GTGTGGATCCCTTACTCTGGTGG - Intronic
1183334922 22:37241078-37241100 GTGTTGGTGTCAGACTCAGGAGG - Intronic
953139055 3:40210697-40210719 GTGTGGGTCTGAAAATCAAGCGG - Intronic
953559236 3:43971887-43971909 CTGTGGGTGTCTCACTCTGGGGG - Intergenic
961142643 3:124567958-124567980 GAGTGAGACTCTATCTCAGGGGG + Intronic
961627170 3:128272126-128272148 GTGTGGGCCACACACTCAGGTGG + Intronic
962974379 3:140433408-140433430 ATGTGGGGCTCTGAGTCAGGAGG - Intronic
963121744 3:141782364-141782386 GTGAGGGTCTCTAGCTCCAGTGG + Intronic
969185295 4:5469889-5469911 GTCTGGGTTTCTAAGTCTGGGGG - Intronic
971137527 4:23886127-23886149 GTGGGGGTGTCTAAATCAGGAGG + Intronic
983853055 4:172607016-172607038 GTATGGGTCTGTAACTAAAGAGG + Intronic
988574045 5:32402061-32402083 ATGTGGCTGTCCAACTCAGGTGG + Intronic
998533570 5:142908270-142908292 CTGTGGGTCACGAATTCAGGGGG + Intronic
1000918856 5:167115216-167115238 TTGTGGGTGTCTAATTCAAGAGG + Intergenic
1001846806 5:174929394-174929416 GTGCGTGCCTGTAACTCAGGAGG - Intergenic
1005601158 6:27427635-27427657 ATGTGGGTCTTGAGCTCAGGAGG - Intergenic
1006775850 6:36592027-36592049 GTCTTGCTCTCTTACTCAGGCGG - Intergenic
1017016053 6:150100361-150100383 GAGTGGTTCTCTAATTTAGGAGG + Intergenic
1021764454 7:23932756-23932778 CTGGGGGTCTCTGCCTCAGGGGG + Intergenic
1023454174 7:40320665-40320687 GTGTGGGTCACAAACAAAGGAGG - Intronic
1027574231 7:79911556-79911578 GTGTGGTTCTCTATTTCTGGAGG - Intergenic
1031136870 7:117894119-117894141 GTTTGGGTTCCTAACTCAAGAGG + Intergenic
1032712087 7:134469402-134469424 GGGTGGTTCTCTAATTTAGGAGG + Intergenic
1034190775 7:149211695-149211717 GTGTGAGGCTCTGACTAAGGGGG - Intronic
1034246855 7:149651446-149651468 ATGTGGGGCTCGAACCCAGGTGG - Intergenic
1038115287 8:24546989-24547011 GTGTGGGTTTGTGACGCAGGTGG + Intergenic
1038416575 8:27400796-27400818 GCGTGGGTCTGGAGCTCAGGAGG + Intronic
1038611693 8:29065082-29065104 GTGTTGCCCTCTTACTCAGGTGG - Intergenic
1041916547 8:63144890-63144912 GGGTGGTTCTCTAATTTAGGAGG - Intergenic
1042269644 8:66942071-66942093 GTGAGAGTCCCTAACTCAGCTGG + Intergenic
1043024054 8:75044579-75044601 AAGTGGGGCTCAAACTCAGGTGG + Intergenic
1043506776 8:80910406-80910428 GGGTGGTTCTCTAATTTAGGAGG - Intergenic
1043856870 8:85274422-85274444 GGGTGGTTCTCTAATTTAGGAGG - Intronic
1046516443 8:115267916-115267938 CTGTGGGTCAGTAATTCAGGAGG - Intergenic
1048469789 8:134696057-134696079 GCCTGCGTCTCTAACTAAGGAGG + Intronic
1056909244 9:90683076-90683098 CAGTTGGTCTCTAAATCAGGAGG + Intergenic
1191107818 X:56783130-56783152 GTGTGGCCCTCAAACTGAGGCGG + Intergenic
1191249860 X:58255106-58255128 GTGTGCGTGTCTAACCCATGGGG - Intergenic
1192282017 X:69697726-69697748 GGGTGGTTCTCTAATTTAGGAGG - Intronic
1192945763 X:75964405-75964427 GGGTGGTTCTCTAATTCAGGAGG - Intergenic
1195167865 X:102238380-102238402 GTGTTGGTGGCAAACTCAGGGGG + Intergenic
1195190992 X:102448707-102448729 GTGTTGGTGGCAAACTCAGGGGG - Intronic
1200934763 Y:8728673-8728695 CTGTGGGGCTCTCTCTCAGGTGG - Intergenic