ID: 906283294

View in Genome Browser
Species Human (GRCh38)
Location 1:44568586-44568608
Sequence ACTCCTTTGCAGGATTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906283288_906283294 17 Left 906283288 1:44568546-44568568 CCCTGAATGAAGAAAGACCCTAG 0: 1
1: 1
2: 0
3: 10
4: 160
Right 906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 174
906283291_906283294 -1 Left 906283291 1:44568564-44568586 CCTAGAGAAATGTACTAGTCTAA 0: 1
1: 0
2: 0
3: 11
4: 168
Right 906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 174
906283287_906283294 30 Left 906283287 1:44568533-44568555 CCAGCTGGGATATCCCTGAATGA 0: 1
1: 0
2: 0
3: 4
4: 123
Right 906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 174
906283290_906283294 0 Left 906283290 1:44568563-44568585 CCCTAGAGAAATGTACTAGTCTA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 174
906283289_906283294 16 Left 906283289 1:44568547-44568569 CCTGAATGAAGAAAGACCCTAGA 0: 1
1: 0
2: 0
3: 13
4: 198
Right 906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906283294 Original CRISPR ACTCCTTTGCAGGATTTGGA AGG Intronic
902729295 1:18358110-18358132 AATCCTAGCCAGGATTTGGAAGG + Intronic
906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG + Intronic
908873072 1:68636931-68636953 TCTCATTTGGAGGTTTTGGATGG + Intergenic
909354007 1:74686273-74686295 ATTGCTTTGCAGGACTTGAAGGG + Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
911979030 1:104542692-104542714 ACTCCTCTGGAGGCTTGGGAGGG + Intergenic
912975794 1:114329052-114329074 AGTTCTGTGCAGGATTAGGAAGG - Intergenic
917047798 1:170882329-170882351 AATCCTTGGAAGGATTTGGGAGG - Intergenic
917104897 1:171482680-171482702 TCTCCTTAGCAGCACTTGGATGG - Intergenic
917701315 1:177584409-177584431 ACTGATCTGCATGATTTGGATGG - Intergenic
917877841 1:179302759-179302781 ACTCCTTTGCAGGGTTTCTCTGG - Exonic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
920307572 1:205029061-205029083 CCTGCTTTGAAGGATTGGGAGGG - Intergenic
921825634 1:219668989-219669011 ACTCCTTTTCAGGATCTCCAAGG - Intergenic
921930248 1:220748721-220748743 ACCCCTTTGCAGGATTTCACCGG - Exonic
923614977 1:235529966-235529988 ACTCCTTTCCTGGATTGAGAAGG + Intergenic
1064301333 10:14125629-14125651 ACACATTTGCAGGATTTAGCTGG - Intronic
1065784698 10:29202406-29202428 CCTTCCTTTCAGGATTTGGAGGG + Intergenic
1067930572 10:50556703-50556725 ACTCCTTTCCAGAATTTAGTTGG + Intronic
1068741322 10:60475121-60475143 ATTCATTTGAAGGATTTGGAAGG + Intronic
1068850332 10:61731560-61731582 ACTCCTTAGAAGTATTTTGAGGG - Intronic
1070657711 10:78282681-78282703 ACCCCTTTGCAGGATTGTGGGGG + Intergenic
1070949346 10:80418554-80418576 TCTCCCTTGCAGGACTTGGCCGG - Intronic
1071544376 10:86517236-86517258 ATTACTGTGGAGGATTTGGATGG - Intronic
1074383647 10:113000340-113000362 ACTACTTTGTAGGTTCTGGAGGG + Intronic
1074607873 10:114992189-114992211 CCTACTTTGCAGGATTTTGGAGG - Intergenic
1075438023 10:122459704-122459726 ACTGCTTTGCGGGAGGTGGAGGG - Intergenic
1078838034 11:15050774-15050796 ACTCCTTAGCAGCATTTGAAAGG + Intronic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1080925735 11:36754143-36754165 AGTCCTTACCAGGGTTTGGAGGG - Intergenic
1081284273 11:41248244-41248266 AGTTCTTTCCAGGATTTGGCAGG - Intronic
1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG + Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1086526135 11:87728156-87728178 ACCCCTTTGCAGAGTTTTGAAGG - Intergenic
1086775709 11:90830273-90830295 GCTCCTATGGAGCATTTGGATGG + Intergenic
1087190487 11:95249245-95249267 AATCTTTTGCATGATTTAGAAGG - Intergenic
1088526924 11:110766447-110766469 ACTCCTTAGCACGAATTAGAAGG - Intergenic
1089887515 11:121842345-121842367 TCTCTTAGGCAGGATTTGGATGG - Intergenic
1090447810 11:126779203-126779225 ACTCCTTGGTAAGGTTTGGAAGG + Intronic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1093362749 12:18251795-18251817 AGTCATTTTCAGGATTTGGGAGG + Intronic
1093495349 12:19750767-19750789 AATTCTTTGCAGGATTTGGTTGG + Intergenic
1095155392 12:38847078-38847100 AGTCATTTGCAGGTTTGGGAGGG + Intronic
1096419512 12:51444992-51445014 AATCCTTTGCGGGGTTTGTAGGG + Intronic
1096923412 12:55114769-55114791 AGACCTGTGCAGGATTTGTAAGG + Intergenic
1097448000 12:59697519-59697541 AGTCCTTTTCTGAATTTGGATGG + Intronic
1097964067 12:65560412-65560434 ACCCCTTTGCAGTATAGGGAAGG + Intergenic
1099386082 12:82015239-82015261 ACTCCTTTCCAGCATTAAGATGG - Intergenic
1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG + Intronic
1102592761 12:113969491-113969513 TCTCCCTTGGAGGTTTTGGAGGG + Intergenic
1103418680 12:120762470-120762492 ACTTCTGTGCAGGTTTTGGGGGG - Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1104852727 12:131885168-131885190 ACTCCCTTGCAGGATGCGGGTGG - Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1107405940 13:40113393-40113415 ACTCCTTTGCAGGAAATTCAAGG - Intergenic
1109202439 13:59445936-59445958 ACTCATTTGAAGACTTTGGATGG - Intergenic
1109650379 13:65316066-65316088 ACTGCTTTACAGGATTTGTAAGG - Intergenic
1109807181 13:67458534-67458556 ACTCCTTTGCAAGAATTTGCAGG + Intergenic
1110463714 13:75777540-75777562 AATTCTCTGTAGGATTTGGAAGG + Intronic
1110831290 13:80034483-80034505 ACTACTTTGAAGTTTTTGGAGGG - Intergenic
1111383534 13:87493242-87493264 ACTGCTCTGTAGGATTTAGATGG - Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115150940 14:30284918-30284940 ACTACTTTTCAGGATTTTTATGG - Intergenic
1116205396 14:41858922-41858944 ACTCCAGGGCAGGATTTGTATGG - Intronic
1116371103 14:44133668-44133690 ACTCCTTTGTAGATTTTGAATGG - Intergenic
1116533617 14:46004135-46004157 TCTTCTTTGCATGCTTTGGAAGG + Intergenic
1117022712 14:51588187-51588209 AGTCATTTGCAGGTTTGGGAGGG - Intronic
1118919384 14:70136249-70136271 TCTCCTCTACAGGTTTTGGAGGG + Intronic
1120407781 14:84110388-84110410 ACTTCTTTGCAAGATATTGATGG + Intergenic
1120902579 14:89588626-89588648 ACACCTTTCCAGTATTTGGTTGG - Intronic
1122634548 14:103123860-103123882 AGTCCTGGGCAGGATGTGGAAGG - Exonic
1122908399 14:104813997-104814019 ACTCTTTTGCAGCCTTTGGGAGG + Intergenic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG + Intergenic
1126231076 15:46325845-46325867 CCTTGTCTGCAGGATTTGGAAGG - Intergenic
1128679404 15:69637040-69637062 ACTTCTTTGCTGTCTTTGGAGGG - Intergenic
1132327734 15:100985827-100985849 ACTCCTTTGCAGGAAGTGCAGGG - Intronic
1133562185 16:6960581-6960603 CCTCCTCTGCAGAGTTTGGAAGG - Intronic
1141163644 16:81645764-81645786 ACTCCTTTACAGAACTTGGTAGG + Intronic
1145402147 17:22550128-22550150 ACTGCTTTGCAGCATTAGTAGGG + Intergenic
1148884787 17:50764435-50764457 GCTCCTTTTCATGATTTGGGTGG - Intergenic
1149283914 17:55140483-55140505 AATCCTTAGCAGTACTTGGATGG + Intronic
1151747128 17:76017758-76017780 ACACCCTTGGAGGACTTGGAGGG - Exonic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1153339777 18:3961698-3961720 ACAGCTTTGCAGGCCTTGGAAGG + Intronic
1154012342 18:10586391-10586413 ACTCCTTTGGACATTTTGGAAGG - Intergenic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1154370065 18:13752322-13752344 TCTCATTTGCAGGATATGGCTGG - Exonic
1155082535 18:22424873-22424895 ACTCTTCTGGAGCATTTGGAGGG - Intergenic
1155595190 18:27477872-27477894 ACTTCTTTGCAGCAATTAGAAGG - Intergenic
1156637645 18:39050436-39050458 TCTTCTTTTCAGGATTTGGCTGG - Intergenic
1159119685 18:64154403-64154425 ACTCCTTTGTATGATTTCCAAGG + Intergenic
1159714044 18:71798970-71798992 TCTCCTCTAGAGGATTTGGAGGG - Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1165769414 19:38370142-38370164 ACTCCTCTGCAGGGGTTGGGAGG - Exonic
1167740941 19:51324622-51324644 ACTCCTTTGCAAAATGGGGATGG + Intronic
925044444 2:761410-761432 ACTTGTGTTCAGGATTTGGAGGG - Intergenic
927080189 2:19619931-19619953 ATGCCTTTGCAGGGTTTTGAGGG - Intergenic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
931049145 2:58390440-58390462 AATCTTATGCACGATTTGGAGGG + Intergenic
931593856 2:63918210-63918232 ACTTCTTTGGAGGATATTGATGG - Intronic
932508104 2:72256201-72256223 TCTCCCTTAGAGGATTTGGAGGG + Intronic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
934078661 2:88449561-88449583 AAACATTTGCAGGATTTGTAGGG - Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
937104813 2:119300470-119300492 ACTCCTTAGCATGACTTGTAAGG + Intergenic
939023224 2:136982663-136982685 AATCCTTTTCAGGATTTAGTGGG + Intronic
948276795 2:236715145-236715167 CCTCCTTGGAAGGATTTGCAAGG - Intergenic
948527146 2:238578055-238578077 ACTTCATTGCAAGACTTGGAGGG + Intergenic
948564164 2:238873022-238873044 TCTCCTTGGCTGGATGTGGATGG - Intronic
949020162 2:241736432-241736454 CCTCCTCTGGAGGCTTTGGAGGG - Intronic
1171577281 20:26343877-26343899 ACTCTTTTGTAGAATTTGCAAGG + Intergenic
1172931869 20:38592113-38592135 CTTCCTCTGCAGGGTTTGGAGGG - Intergenic
1173851705 20:46222676-46222698 CCCCTTTTGCAGCATTTGGAGGG - Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1182056097 22:27355885-27355907 ACTTCTTTGCAGGGTTGGGGAGG + Intergenic
1184771077 22:46596922-46596944 ACTCCTTTGCAGAGCTTGGATGG + Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
952992577 3:38844571-38844593 GCTCCTGTGCAGGACTGGGAGGG - Intergenic
955961670 3:64346946-64346968 ACACCTTTTCTGGATTTGGAGGG - Intronic
957602144 3:82351282-82351304 ACTCATTTGCATGGTTTTGAAGG - Intergenic
957954535 3:87168144-87168166 ACTCCTTTGCACGCTTTCAAAGG - Intergenic
958278245 3:91618994-91619016 AGTCCTTTGTAGAATTTGCAAGG + Intergenic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
966581394 3:181569394-181569416 ACTCTTTTGAAGGATGTGAAAGG + Intergenic
970284863 4:14500659-14500681 AGTCCATTGTAGGATTTGGTTGG + Intergenic
972121798 4:35712769-35712791 ACCCCTCTGCAGGAGTTGGTGGG - Intergenic
974392200 4:61285889-61285911 TCTCCTTTGCATGAGTTGGAGGG - Intronic
976152875 4:82110417-82110439 ACCCCTTTGCAGGGTTTGTGAGG - Intergenic
976876810 4:89862983-89863005 ATTTCTTTGCAAGATTTGGTAGG + Intergenic
979808866 4:125010949-125010971 ACTCCTTTTCTTGATTTGTATGG - Intergenic
980870955 4:138610143-138610165 AGTCCTTTCTAGAATTTGGAGGG - Intergenic
981295201 4:143123779-143123801 ACTCCTTTGCCCAATTTTGATGG + Intergenic
986279936 5:6314546-6314568 CCTCCTCTGGAGGCTTTGGAGGG + Intergenic
986759604 5:10868200-10868222 ACTCTCTTGCAGGAGATGGAAGG + Intergenic
986968838 5:13308018-13308040 ATTTCTATGCAAGATTTGGAGGG + Intergenic
989312479 5:40036261-40036283 AATCTTGTGCAAGATTTGGAGGG + Intergenic
989570304 5:42940030-42940052 ATTCCTTTGCACAGTTTGGAGGG + Intergenic
990063593 5:51683436-51683458 ACTCCTGGGCAGCATCTGGAAGG - Intergenic
990446676 5:55899599-55899621 ACTCCTTTACACGAGTGGGATGG + Intronic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993654910 5:90565350-90565372 ACTGGTTTCCAGGAATTGGAAGG - Intronic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
999073875 5:148776865-148776887 ACTCCAGTTCAGGATTTGGGTGG + Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1000963743 5:167630582-167630604 ACTCCTTTGAGGGATTTTGAGGG + Intronic
1003385768 6:5666023-5666045 GCTCCATGGCAGGATCTGGAGGG + Intronic
1005718681 6:28579350-28579372 ACTCCTTTGCAGAATCCAGAGGG + Exonic
1008044156 6:46834683-46834705 CCTCCTTTTCAGCATTTGGTGGG - Exonic
1009064968 6:58448702-58448724 ACTCTTTTGTAGAATTTGCAAGG + Intergenic
1010975721 6:82311799-82311821 ACTGCTTTGCAGGTATTTGAAGG + Intergenic
1014149884 6:118042577-118042599 ACTCCTTGGCAAGATGTGGAAGG - Intronic
1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG + Exonic
1019607292 7:1916611-1916633 ACTCCCTTGCAGGGCCTGGAGGG - Intronic
1020760632 7:12264343-12264365 ACTGCTGTGCAGGAATTGGTAGG + Intergenic
1023314526 7:38921610-38921632 CCTTCTTTGCAAGATTTGGATGG + Intronic
1023656734 7:42430481-42430503 ACTCTTTTTCAGGTTTTGGTTGG - Intergenic
1024458257 7:49632916-49632938 ACTGTCTTCCAGGATTTGGATGG + Intergenic
1029932270 7:104384895-104384917 TCTTCTGGGCAGGATTTGGATGG - Intronic
1032799093 7:135303840-135303862 ACTCCTATCTAGGCTTTGGAAGG - Intergenic
1034036835 7:147833728-147833750 ACTCCTGTGGGAGATTTGGATGG - Intronic
1034862788 7:154614128-154614150 ACTGCTGTGCTGGATTGGGAAGG - Intronic
1034999866 7:155604060-155604082 CCTCCCTTGCAGTATTTGGACGG - Intergenic
1036958002 8:13211690-13211712 ACACCTTACCAGGATTTGGTAGG + Intronic
1037688671 8:21164857-21164879 ACTCCTTAGCATGATGTGCAAGG - Intergenic
1041409059 8:57533698-57533720 ACTCCTCTGCTGGGTTTGTAAGG - Intergenic
1044738803 8:95304769-95304791 CCTTCTCTTCAGGATTTGGAAGG - Intergenic
1046396877 8:113651449-113651471 AATCCCTTGCAGGAGTGGGAGGG - Intergenic
1046662697 8:116965587-116965609 ACATCTTTGCAGGATTTTGAGGG + Intronic
1047209128 8:122826586-122826608 GCTCCGTGTCAGGATTTGGATGG - Intronic
1047240830 8:123086487-123086509 ACTCCATCCCAGGATTTGGGAGG - Intronic
1047346889 8:124037623-124037645 AATCCTTTGCAGGATTAGAGTGG + Intronic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1053653443 9:40192315-40192337 CCTCCTTTTCAGCATTTGGTGGG + Intergenic
1053903846 9:42821605-42821627 CCTCCTTTTCAGCATTTGGTGGG + Intergenic
1054531140 9:66183903-66183925 CCTCCTTTTCAGCATTTGGTGGG - Intergenic
1056594078 9:87991070-87991092 ACTCCAGTGCAGGATATGGATGG - Intergenic
1058304929 9:103427995-103428017 AATAATTTGCAAGATTTGGAGGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1061401629 9:130371589-130371611 AAGTCCTTGCAGGATTTGGATGG - Intronic
1186216769 X:7308978-7309000 AGTCCTTTGAAGGGTTTTGATGG - Intronic
1188812055 X:34662398-34662420 ACAACTTTCCAGGATCTGGAAGG - Intergenic
1190278423 X:48913924-48913946 GCTCCTTTGTAGGATTGGGAAGG + Exonic
1191566691 X:62545653-62545675 ACTCTTTTGTAGAATTTGCAAGG + Intergenic
1192056739 X:67781153-67781175 ACTCCGTTTCAGGCTTTGTAGGG - Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1194408383 X:93526753-93526775 ACTCTTTTACAGGATCTGGAGGG - Intergenic
1198485830 X:137086796-137086818 ATTCCTTTTCAGGCTCTGGATGG + Intergenic
1199935241 X:152567139-152567161 ACTCCTCTTTAGGATTTGCAAGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic