ID: 906284302

View in Genome Browser
Species Human (GRCh38)
Location 1:44576585-44576607
Sequence CACTGGGGCCCATCCTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906284302_906284312 30 Left 906284302 1:44576585-44576607 CCAGGACAGGATGGGCCCCAGTG 0: 1
1: 0
2: 2
3: 26
4: 206
Right 906284312 1:44576638-44576660 CAGCTGGGCTCCATCTTGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 291
906284302_906284311 26 Left 906284302 1:44576585-44576607 CCAGGACAGGATGGGCCCCAGTG 0: 1
1: 0
2: 2
3: 26
4: 206
Right 906284311 1:44576634-44576656 TGAGCAGCTGGGCTCCATCTTGG 0: 1
1: 1
2: 0
3: 27
4: 285
906284302_906284310 15 Left 906284302 1:44576585-44576607 CCAGGACAGGATGGGCCCCAGTG 0: 1
1: 0
2: 2
3: 26
4: 206
Right 906284310 1:44576623-44576645 TTGTAAACAGCTGAGCAGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 208
906284302_906284309 14 Left 906284302 1:44576585-44576607 CCAGGACAGGATGGGCCCCAGTG 0: 1
1: 0
2: 2
3: 26
4: 206
Right 906284309 1:44576622-44576644 CTTGTAAACAGCTGAGCAGCTGG 0: 1
1: 0
2: 3
3: 15
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906284302 Original CRISPR CACTGGGGCCCATCCTGTCC TGG (reversed) Intronic
900761038 1:4470642-4470664 CACTGGGGCCCTTCATGCCACGG - Intergenic
901875228 1:12163676-12163698 CACTGGAGGCCTTCATGTCCTGG - Intergenic
902325736 1:15699348-15699370 CACTGGGGCCCATCGTGAGGTGG - Intronic
902566403 1:17314458-17314480 CACTGGGGCATCTCCTGGCCGGG + Intronic
902615929 1:17623551-17623573 CACTGCGGCACATCCTCTCCGGG - Intronic
903192822 1:21666397-21666419 CACTGGGTCCTGTCCTGTCTTGG + Intronic
903344758 1:22677142-22677164 CACTGCGGCCCATCTGCTCCTGG + Intergenic
904355236 1:29934398-29934420 ATCTGGGGCCCAGCCGGTCCCGG + Intergenic
904500229 1:30908839-30908861 CACTGGGGCCCGCCCCGCCCCGG - Intergenic
904993763 1:34615079-34615101 CACTGTGCCAAATCCTGTCCAGG - Intergenic
906062745 1:42958965-42958987 GCCTGGGGCCCAGCCTGTCCTGG + Intergenic
906284302 1:44576585-44576607 CACTGGGGCCCATCCTGTCCTGG - Intronic
907541079 1:55215622-55215644 CGCTGCGGCCCCTCCCGTCCCGG - Intergenic
907987744 1:59549197-59549219 CTCTGGAGCCCTTCCTCTCCAGG + Intronic
908305541 1:62811632-62811654 CTCTTAGGCCCATCATGTCCTGG - Intronic
910866942 1:91797412-91797434 CAGTGCCTCCCATCCTGTCCAGG - Exonic
915593270 1:156882536-156882558 GACTGGGCCCCATCATGTCAGGG + Intergenic
915612637 1:157006836-157006858 CACTGGGGCCCTTCATCTTCTGG - Intronic
916635789 1:166667153-166667175 CACTGGGGCCCATCGTGGGGTGG + Intergenic
917284575 1:173410873-173410895 CACTGGGTTCCGTCCTGTCATGG - Intergenic
919808679 1:201396013-201396035 CCCTGGGCCCCAGCCTGTCCTGG - Intronic
923105177 1:230848925-230848947 AACTGCAGCCCATCCTGCCCAGG + Intronic
924858722 1:247899621-247899643 CAGTGGGGGCCGTCCAGTCCTGG + Intergenic
1062939890 10:1413213-1413235 CACTGGGACCCCTGCTGCCCTGG - Intronic
1063038995 10:2317685-2317707 CTCAGGAGCTCATCCTGTCCAGG + Intergenic
1063368659 10:5507209-5507231 CACTGAGGACCCTCCTGTCGAGG - Intergenic
1064564328 10:16624579-16624601 CACTGGTGCCCTTCCTGCTCTGG - Intronic
1065600101 10:27359293-27359315 CACTCAGAGCCATCCTGTCCTGG - Intergenic
1066005354 10:31141700-31141722 CACTGTGGCCACTGCTGTCCAGG + Intergenic
1067089189 10:43257970-43257992 CACTGGAGGCCCTCATGTCCTGG - Intronic
1067190998 10:44068282-44068304 CTGTGGGGCCTATCCTGGCCAGG + Intergenic
1069997698 10:72353202-72353224 CCCTGTGGCCCATCCTTTCTTGG + Intronic
1070307427 10:75247990-75248012 CACTGGCACCCATCCTGCCCCGG + Intergenic
1072868553 10:99090954-99090976 CACTGCAGCCAATTCTGTCCTGG + Intronic
1073048388 10:100653351-100653373 GACTGTGCCCCATGCTGTCCTGG + Intergenic
1075103640 10:119523219-119523241 CACTGGGGCCCAAACACTCCAGG + Intronic
1076341030 10:129744878-129744900 GCCTGGGGACCATCCTTTCCTGG - Intronic
1076720615 10:132391023-132391045 CACTCGGGCGCTTCCAGTCCAGG - Intergenic
1078102116 11:8336187-8336209 CACAGGGGCCCCACCTGGCCCGG + Intergenic
1079466042 11:20732032-20732054 CTCTGGGACCCATCCTTTCTAGG + Intronic
1081702059 11:45158386-45158408 TGCTGGGGCCCAGCCTGTCTGGG - Intronic
1081810038 11:45909474-45909496 GCCTGCGGCCCACCCTGTCCAGG + Intergenic
1083276008 11:61597555-61597577 CACTGGGGCCCAGCCCTTTCCGG + Intergenic
1083324268 11:61865583-61865605 CCCTGGGGCCACTCCCGTCCTGG + Intronic
1083433460 11:62627071-62627093 CTCTGGAGCCCATGGTGTCCAGG - Exonic
1083519588 11:63296011-63296033 CTCTGGAGTGCATCCTGTCCTGG - Intronic
1084118716 11:67056721-67056743 GGCTGGGGCCCTTCCTCTCCAGG - Intergenic
1084377071 11:68784737-68784759 CACTGGGGCCCATCCCCACCAGG - Intronic
1092015221 12:5153051-5153073 CACTTAGCACCATCCTGTCCTGG - Intergenic
1092570318 12:9714443-9714465 CAGTGGGGGCCATCCAGTCCTGG + Intergenic
1092974483 12:13731006-13731028 CACTGTGGCTCCTCCTGCCCTGG + Intronic
1098557398 12:71835048-71835070 CTCTGGAGCCCATGCAGTCCTGG - Intergenic
1099690826 12:85949137-85949159 CACTGCTGCCCTTCCTCTCCGGG + Intergenic
1100457079 12:94763096-94763118 CATTGGGACCCATCCTGGACAGG + Intergenic
1102044845 12:109823256-109823278 CACTGGGGCTCTGTCTGTCCTGG - Intronic
1102461110 12:113100089-113100111 CACAGGGGCTCAGCCAGTCCAGG + Intronic
1102554911 12:113720546-113720568 GACTGGGGTCTCTCCTGTCCTGG - Intergenic
1104781037 12:131420678-131420700 CAGTGGGGCCCATGCACTCCAGG - Intergenic
1113879561 13:113616318-113616340 CACTGGGACCCTTCCAGTCACGG + Intronic
1114494850 14:23125693-23125715 CACAGGAGCCCTTCCTGGCCTGG - Exonic
1116836163 14:49770356-49770378 CACAGGGGACCAGCCTGTCCTGG - Intronic
1117343002 14:54807773-54807795 CACAAGGGCCCAGTCTGTCCGGG - Intergenic
1121193846 14:92052713-92052735 TACTGGAGCCCATACTTTCCAGG + Exonic
1122239175 14:100350708-100350730 CTCTGTGGCCCATCCCCTCCTGG - Intronic
1122812399 14:104295550-104295572 CCCTGGGGTCCAGCCTGTCTGGG - Intergenic
1125513828 15:40307144-40307166 CACTGGGCATCATCCTGTCCAGG - Intronic
1125519611 15:40340522-40340544 CCCAGGGGCCCAGCCTCTCCAGG + Intronic
1127864652 15:63022361-63022383 AACGGAGGCCCCTCCTGTCCTGG - Intergenic
1129000533 15:72329749-72329771 GACTGGGGCTCATTCTGTCCAGG - Intronic
1129247902 15:74291104-74291126 CACTGGGGCCCTTCTTGGCTGGG + Intronic
1129516991 15:76162976-76162998 CACCGGGGCTCCTGCTGTCCTGG + Intronic
1129607299 15:77031110-77031132 GAATGGGGCCCAGCCTGGCCGGG + Intronic
1129701111 15:77769162-77769184 CCCTGGGCCCCACCCTGTCATGG - Intronic
1130733796 15:86527575-86527597 CACTCAGGCCTATCCTGTACTGG + Intronic
1131332596 15:91515556-91515578 CACTGGGGCCCATCCAGCTGAGG - Intergenic
1132642842 16:985454-985476 CACTGGGGCCCCTCCCGCCCTGG - Exonic
1132781786 16:1630625-1630647 CACTCAGGTCCATCCTGGCCAGG + Intronic
1132937060 16:2486524-2486546 GCCTGGGCCCCATCCTGCCCTGG - Intronic
1133201443 16:4206833-4206855 CAGAGGGGCCCAGCCTGGCCCGG - Intronic
1133302445 16:4790878-4790900 CGATGGGGCACAGCCTGTCCTGG + Intronic
1136054955 16:27681511-27681533 TACTGGAGCACATCCTCTCCTGG - Exonic
1136583764 16:31170366-31170388 GACAGGGGCACTTCCTGTCCTGG + Intergenic
1137402919 16:48167740-48167762 CACCAGGGCCCTTCCTCTCCAGG + Intronic
1138652185 16:58466909-58466931 CTCTTGGGCCCCACCTGTCCTGG + Intronic
1139265247 16:65632254-65632276 CACAGGGGCACATCCAGTGCTGG - Intergenic
1141604012 16:85142811-85142833 CACTGCTGCCCAACCTGGCCAGG + Intergenic
1142227221 16:88883428-88883450 CTCTGAGGCCCATCCTATTCGGG + Intronic
1143780733 17:9228021-9228043 CTGTGGGCCCCATCCTGCCCTGG + Intronic
1144642019 17:16942872-16942894 GACTGGGCCTCATCCTATCCAGG + Intronic
1144774696 17:17779402-17779424 CTGTGGGGCCCACGCTGTCCTGG - Intronic
1145806808 17:27740165-27740187 GACTGGGGCCCATCCAGGCAGGG + Intergenic
1147999536 17:44379778-44379800 CAATGGGGCTCAGCTTGTCCCGG + Exonic
1148149288 17:45386761-45386783 CAGTGGGTCCCCTCCTGTACTGG + Intergenic
1148856641 17:50582615-50582637 CACTGGGGCCAGACCTCTCCAGG + Intronic
1148896760 17:50843405-50843427 GACTGGGGGCCCTGCTGTCCCGG - Intergenic
1149866240 17:60152534-60152556 CCCTGGGGCCCATCTGGTCCAGG - Intronic
1151344623 17:73494081-73494103 CCCAGGGGCCCAGCCTGACCAGG + Intronic
1151889898 17:76945910-76945932 CACAGGGGCTCATTCTGTGCTGG + Intronic
1151916983 17:77125704-77125726 CACTCGGGGCCTTCCTGTGCTGG + Intronic
1151953087 17:77366012-77366034 CCCTGGGGCCCTTGGTGTCCTGG - Intronic
1151958468 17:77392602-77392624 CACTGTGGCCCAGCCAGGCCTGG + Intronic
1152215218 17:79028008-79028030 CCCGGGCCCCCATCCTGTCCAGG + Intronic
1152369504 17:79877648-79877670 CACTGGGGCTCCTCCAGTCCGGG + Intergenic
1152755787 17:82086480-82086502 ATCTGGGCCCCATCCAGTCCGGG + Exonic
1154453651 18:14501872-14501894 CACTGGGGCCCAACCTCTATGGG - Intergenic
1155239030 18:23847800-23847822 CACTGCAACCCATCCTGTCTGGG - Intronic
1157483217 18:48069192-48069214 CACTGGGCCCACCCCTGTCCAGG + Intronic
1161038442 19:2097809-2097831 CACTGGGGCCCAGGCTCACCTGG - Intronic
1161453674 19:4360008-4360030 AACTGGAGCCCACCCTGCCCTGG - Exonic
1162490321 19:10987607-10987629 CTCTGGGGCCCATCCCGGGCTGG - Intronic
1163364616 19:16869095-16869117 CACGGGGCCCCGTTCTGTCCTGG + Intronic
1164521474 19:28983248-28983270 CATAGAGGCCCTTCCTGTCCCGG - Intergenic
1165393980 19:35553974-35553996 CAGTGGGGCCCAGGCTGTCCAGG - Intronic
1166253316 19:41585901-41585923 CACTGGGGCCCCAGCTGTGCAGG + Intronic
1167315556 19:48761072-48761094 CACTGGGCACCATCCTGACCCGG + Intergenic
1167718544 19:51160978-51161000 CACTTGGGCCTGTTCTGTCCAGG - Intergenic
926144481 2:10388292-10388314 CACTGAGGCACCTCCTGTTCTGG - Intronic
927060772 2:19417166-19417188 CACTGGGGTCCATCCAATCTTGG - Intergenic
928595786 2:32857676-32857698 CCCTGGGACCGATCCTGTCAGGG - Intergenic
930035097 2:47080291-47080313 CACAGAGGCCCCTCCTGTCCTGG + Intronic
931160913 2:59689257-59689279 CACTGGGGCCCATCGGGTGGTGG + Intergenic
932436524 2:71705253-71705275 CACTGGGGGCCACACTGCCCTGG + Intergenic
932780535 2:74556020-74556042 TACTGGAGCCACTCCTGTCCTGG + Exonic
935444262 2:103139660-103139682 CCCTGGGTGCCTTCCTGTCCGGG - Intergenic
938097684 2:128474216-128474238 CCCAGCGCCCCATCCTGTCCTGG - Intergenic
940992254 2:160109723-160109745 CAATGTGGCCCATCGAGTCCAGG + Intronic
944498554 2:200333658-200333680 CACTGGGGCCCATCATGGGGTGG - Intronic
945496991 2:210520469-210520491 CACTGGGGCCCATCGTGAGGTGG - Intronic
947552671 2:231057404-231057426 CACAGGGGCCCATCCCACCCCGG - Intronic
948621901 2:239240727-239240749 CACTGGGGCACATCATGTGCTGG - Intronic
948643896 2:239392062-239392084 CACCAGGCCCCATCCTGCCCGGG + Intronic
1169021586 20:2334932-2334954 CTCTGGAGCCCACCCTGACCGGG + Intronic
1169146953 20:3259004-3259026 CTCTGGAGCCCTTGCTGTCCTGG - Intronic
1169353823 20:4891532-4891554 CAGTGGGGCCCACCCTGGCTGGG + Intronic
1170869313 20:20190238-20190260 CACTGTGGCACATCATGTCATGG + Intronic
1171461358 20:25299822-25299844 CACTGGTCCCCCTCCTGGCCAGG - Intronic
1172622438 20:36328361-36328383 CTCTGGGGCCCAACTTGTCAGGG - Intronic
1173653573 20:44683442-44683464 AACTCCTGCCCATCCTGTCCAGG + Intergenic
1174777563 20:53359272-53359294 GACTGGGGCCAAACCTGTTCTGG + Intronic
1175391138 20:58628162-58628184 CACTGAGGAGCATCCTGTCTAGG + Intergenic
1175759204 20:61549978-61550000 CACTGGCACCCATCCTCCCCGGG + Intronic
1176820531 21:13651433-13651455 CACTGGGGCCCAACCTCTATGGG + Intergenic
1177650999 21:23961997-23962019 CACGGGGGCCTGTCCTGTCGGGG + Intergenic
1178580184 21:33831688-33831710 CAGTGTGGCTCTTCCTGTCCTGG - Intronic
1178589353 21:33896244-33896266 CCCTGTGGCCCATCCTGAACTGG - Exonic
1180792812 22:18585975-18585997 CACCAGGGCTCCTCCTGTCCAGG + Intergenic
1181003571 22:19999144-19999166 CCCTGGAGCCCCTCCTGTACTGG + Intronic
1181228924 22:21409344-21409366 CACCAGGGCTCCTCCTGTCCAGG - Intergenic
1181249727 22:21525521-21525543 CACCAGGGCTCCTCCTGTCCAGG + Intergenic
1184089181 22:42283508-42283530 CCCTCGGGCCCCTCCTCTCCCGG + Intronic
1184554877 22:45227715-45227737 CAGTGGGGCCCGTTCTCTCCCGG - Intronic
1184663152 22:45974806-45974828 CACTGGCCACCATCCTGTTCAGG + Intronic
1184879192 22:47294460-47294482 ACTTTGGGCCCATCCTGTCCTGG + Intergenic
1185277281 22:49955236-49955258 GGCTGGGGCCTATCCTGTCTGGG + Intergenic
949977374 3:9473367-9473389 CACTGGTGCCCATGGTGTGCAGG + Exonic
950097647 3:10339190-10339212 CACTGGGGCCCACCCCCTACAGG - Intronic
953927030 3:46987861-46987883 CACTGGGGCCCAGGGTGCCCCGG + Intronic
954314921 3:49795831-49795853 CCCTGGGCCCCCTCCTGTCAGGG + Intronic
954865602 3:53726930-53726952 TACGGGGGCCCATCCTCTTCAGG + Exonic
956868313 3:73391068-73391090 CAGTGAGGCCCAGCTTGTCCTGG + Exonic
958077252 3:88696509-88696531 CACTGGGGCCTCTCCAGTCGGGG + Intergenic
960234162 3:115262238-115262260 CACAAGGGCTCATCCTGTGCTGG + Intergenic
960966149 3:123106138-123106160 CATTGGTGCCCACCCTGCCCTGG + Intronic
964526047 3:157616168-157616190 AACTATGGCCAATCCTGTCCAGG - Intronic
965311632 3:167135341-167135363 CACTGGGGCCCATCATGGGGTGG + Intergenic
966936983 3:184717150-184717172 CACTGGGCCTCATTGTGTCCAGG - Intergenic
968509368 4:988595-988617 CACTGTGGGCCAGCCTGTCTCGG + Exonic
968529080 4:1080746-1080768 CACAGGCGCCCTCCCTGTCCAGG + Intronic
968712109 4:2126771-2126793 CACTCTGGCCTTTCCTGTCCTGG - Intronic
969289324 4:6228544-6228566 CAATGGGGCCCCTGCTGTCCTGG + Intergenic
969526334 4:7705968-7705990 CAATGCTGCCCATCCTGCCCAGG + Intronic
969626602 4:8308899-8308921 CTCGGGGGCACATTCTGTCCTGG - Intergenic
971027619 4:22604097-22604119 CGGTGGGGGCCATCCAGTCCCGG - Intergenic
978628158 4:110711265-110711287 CACTGCTGACCATCCTGTCATGG - Intergenic
983506453 4:168558317-168558339 GACTGGGGTCTAACCTGTCCTGG - Intronic
985691494 5:1315174-1315196 CAGTAGAGCCCATCCTGCCCAGG + Intergenic
988923003 5:35962024-35962046 CACTGGGATCCATCCCATCCAGG + Intronic
989776967 5:45220675-45220697 CAGTGGCTCCCTTCCTGTCCTGG + Intergenic
991144197 5:63282154-63282176 CACCGGGGCCCGTCATGGCCGGG - Intergenic
997416382 5:133732005-133732027 CACTGGGGACCATCCTCAGCTGG - Intergenic
998005000 5:138651019-138651041 CACTGGGGAGCATCCAGTTCAGG + Intronic
1000037999 5:157463347-157463369 CCCTGGGCCCTATCCTCTCCTGG - Intronic
1001728947 5:173933824-173933846 CTCTGGGGCCCATCTTGTTGAGG + Intronic
1002057871 5:176609242-176609264 CACTCGGGGCCACCCTGCCCTGG - Intronic
1002313872 5:178330950-178330972 CACTCTGTCACATCCTGTCCTGG + Intronic
1005793431 6:29331332-29331354 CACTGAGGCCACTCCTGTGCTGG + Intergenic
1006025341 6:31143211-31143233 CACTAGGGCCCATCCTGGGCTGG - Intronic
1007323424 6:41043023-41043045 ACCTGGGGCCCATCCTGGTCTGG + Exonic
1012226842 6:96714420-96714442 CACTGGGTCCCAGGCAGTCCTGG - Intergenic
1015005316 6:128273189-128273211 CACTGGGGCCTGTCCTGTCGCGG + Intronic
1016581502 6:145633578-145633600 CAAAGGGGCCCAGCCTGGCCAGG + Intronic
1019432175 7:1004193-1004215 CACAGGGGCCCACGCTGGCCGGG - Intronic
1020043495 7:5022178-5022200 CAGTGGGGGCCATCCAGTCCCGG + Intronic
1023904678 7:44513732-44513754 CCCTGGGACCCTTCCTGCCCTGG - Intronic
1024042675 7:45567384-45567406 CACTGGGGCCAATGGAGTCCTGG + Intergenic
1029822166 7:103156991-103157013 CAGTGGGGGCTATCCAGTCCCGG - Intergenic
1032764896 7:134981982-134982004 CACTGGGGCCTATCCTGGGGTGG + Intergenic
1032797520 7:135289515-135289537 CACTGTGGCCCACCTAGTCCAGG + Intergenic
1033553699 7:142470152-142470174 GACTGAGGCTCATACTGTCCGGG - Intergenic
1034350880 7:150414014-150414036 CAGCGGGGCTCATCCTGACCTGG + Intergenic
1035610151 8:956550-956572 CTCTGTGGCCCCTCCTGCCCTGG - Intergenic
1035662120 8:1356091-1356113 CAGTGGGGCCCACCTTGTCCAGG - Intergenic
1036708499 8:11062166-11062188 CACATCGGCCCATCCTGCCCTGG + Intronic
1036760060 8:11502677-11502699 CACTGGGGGCCAGCTTGTGCCGG - Intronic
1037905546 8:22714067-22714089 CACTGGTGCACCCCCTGTCCTGG - Intronic
1037907022 8:22721557-22721579 CACTGAACCCCATCCTGTTCAGG - Intronic
1039519780 8:38160440-38160462 CACTGGGACTCATCCTGACCTGG + Intergenic
1041082260 8:54224997-54225019 CACTGGGGGTCAATCTGTCCAGG + Intergenic
1044521068 8:93199845-93199867 CACTGGGGCCTATCATGGGCTGG - Intergenic
1049068421 8:140337902-140337924 CACTGGGGTCCAGCCTGTTCTGG - Intronic
1049161134 8:141098670-141098692 CTCTGGTGTCCTTCCTGTCCTGG - Intergenic
1049485686 8:142858809-142858831 CACAGAGGCCCTTCCTCTCCAGG - Intronic
1049605065 8:143525544-143525566 CCCTGGGGCCCATCCTGAGGGGG + Intronic
1056867850 9:90245764-90245786 CACTGGCCTCCTTCCTGTCCTGG + Intergenic
1057379990 9:94559045-94559067 CACGGGGACCCAGCCTGTACTGG - Exonic
1057380269 9:94561035-94561057 CACTGGAGGCCATGCTGTCCAGG + Intronic
1058700964 9:107599848-107599870 CACTGTGGCCCTTCCTGTCCTGG + Intergenic
1058892122 9:109370353-109370375 CACTGAGGCCCACCCTACCCTGG - Intergenic
1061090124 9:128421459-128421481 CACTGGGGCCCAACGTGGCAGGG + Intronic
1061374334 9:130215217-130215239 CCCAGGGGCCCATCCTGGCCTGG + Intronic
1061456415 9:130701255-130701277 CACTGGGGCTGAGGCTGTCCTGG + Intronic
1061974525 9:134061611-134061633 CAGTGGGGGCCATCCAGTCAGGG - Intronic
1062181131 9:135191854-135191876 GGCTGGGTCCCATCCTGGCCAGG - Intergenic
1062370758 9:136237445-136237467 ACCTGGAGCCCATCCTGTGCCGG + Intronic
1062460650 9:136661320-136661342 CCCAGGGGCTCATCCTGCCCTGG - Intronic
1203526719 Un_GL000213v1:97488-97510 CACTGGGGCCCAACCTCTATGGG - Intergenic
1186804210 X:13123434-13123456 CACCGGCTCCCATGCTGTCCGGG - Intergenic
1190456736 X:50634739-50634761 CACTGGTGCCCATCCTGTACGGG + Exonic
1192850513 X:74951100-74951122 CACTGGGGCCTGTCATCTCCAGG - Intergenic
1192945772 X:75964440-75964462 TACTAGGTCCCATCCTTTCCAGG + Intergenic
1197346077 X:125326794-125326816 CCATGGGGACCAGCCTGTCCAGG - Intergenic
1198215420 X:134550216-134550238 CTATGGGGCTCACCCTGTCCCGG - Intergenic
1198723231 X:139647597-139647619 CACTGGGATCCATGCTTTCCAGG - Intronic
1198834839 X:140794175-140794197 CAGTGTGGCCCTTCCTGTCCTGG + Intergenic
1199851807 X:151729221-151729243 CACTAGGGTCCAGCCTGTCTTGG + Intergenic