ID: 906289438

View in Genome Browser
Species Human (GRCh38)
Location 1:44610342-44610364
Sequence TGTTATCGGCAGAGGATGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 5, 3: 224, 4: 373}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906289438 Original CRISPR TGTTATCGGCAGAGGATGGC GGG (reversed) Intronic
900705381 1:4077104-4077126 TTTTATAGGCAGAGCATGGATGG - Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
903120066 1:21210388-21210410 AGTTATCCACAGAGGATGGTGGG - Intergenic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904387536 1:30153607-30153629 TGTTACCAGCAGAGGAAGACTGG - Intergenic
904820183 1:33237656-33237678 AGTCGTTGGCAGAGGATGGCTGG + Intergenic
904839182 1:33360368-33360390 TGCCCTTGGCAGAGGATGGCAGG + Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905415407 1:37800409-37800431 TGGGAACGGCAGAGGCTGGCAGG + Exonic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906289438 1:44610342-44610364 TGTTATCGGCAGAGGATGGCGGG - Intronic
907465980 1:54637238-54637260 TGGTCTCGGCAGAGGTGGGCGGG + Exonic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
909717566 1:78728042-78728064 TTTTATGGGCACAGGATGGGGGG - Intergenic
910163650 1:84299598-84299620 TTTTATCAGCAGAGGATTGATGG + Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911429988 1:97773536-97773558 TTTTATAGGCACAGGATGGGGGG - Intronic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG + Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912346840 1:108971459-108971481 TTCTATCTGCAGAGGATGACAGG + Exonic
912551917 1:110490243-110490265 TGGTATAGGCGGAGGGTGGCAGG - Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917254911 1:173103865-173103887 TTTTATAGGCACAGGATGGGGGG + Intergenic
917589230 1:176459838-176459860 TTTTATGGGTAGAGGATGGGGGG + Intergenic
918748061 1:188231763-188231785 TGTTATCTGCAGATGCTGGAAGG - Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918926529 1:190793203-190793225 TTTTATGGGCACAGGATGGGGGG + Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
921380119 1:214516038-214516060 TGTTATCGAAAGAGGAGTGCAGG - Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
924581664 1:245329311-245329333 TGTTAGTGGCAGATGATGGGCGG - Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1064561502 10:16599067-16599089 TGTTAGCTTCAGAGGATGGTGGG - Intronic
1064795860 10:19010254-19010276 TTTTATAGGCACAGGATGGGGGG + Intergenic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065607016 10:27428505-27428527 AGTTATCCACTGAGGATGGCAGG - Intergenic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067969896 10:50958024-50958046 TTGGATGGGCAGAGGATGGCGGG + Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068321743 10:55426960-55426982 TTTTATGGGCACAGGATGGTGGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070470622 10:76775566-76775588 TTTTATGGGCACAGGATGGGGGG + Intergenic
1071152622 10:82652600-82652622 TTTTATAGGCAGAGGATGTCAGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074581624 10:114724687-114724709 TGTTCTCGTGAGAGGAAGGCAGG - Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1078776982 11:14402875-14402897 AGTTGTCAGCAGAGGATAGCCGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081730493 11:45368715-45368737 TGTGATGGGCAGAGGCTGGGTGG + Intergenic
1081785176 11:45741410-45741432 TGTTATCCACAGAGGTTGACTGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082999658 11:59279854-59279876 TAGTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG + Intergenic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1086311463 11:85540267-85540289 TTTTATGGGCACAGGATGGGGGG - Intronic
1087140052 11:94756213-94756235 TTTTATGGGCACAGGATGGGGGG + Intronic
1088065129 11:105708299-105708321 TGTTATCAACATAGGGTGGCTGG + Intronic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089080323 11:115771068-115771090 TGTTAAAAGCAAAGGATGGCAGG + Intergenic
1089762342 11:120737138-120737160 GGTTATCTCCTGAGGATGGCCGG + Intronic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093392086 12:18635562-18635584 GGTTATCTGCATAAGATGGCAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093878506 12:24377016-24377038 CGTTTAGGGCAGAGGATGGCTGG - Intergenic
1093878659 12:24378894-24378916 GGTTTGGGGCAGAGGATGGCTGG - Intergenic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094819396 12:34212699-34212721 GGTTATCTGCAGATAATGGCAGG - Intergenic
1095095414 12:38145375-38145397 GGTTATCTGCAGATAATGGCAGG + Intergenic
1095190258 12:39250137-39250159 AGCTATCTACAGAGGATGGCAGG - Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096517699 12:52166255-52166277 TGTTGTAGCCAGAGGAAGGCTGG + Intergenic
1097076998 12:56402414-56402436 AGTTATCGCCAGAAGATGGCAGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101216714 12:102593102-102593124 TTTTATAGGCACAGGATGGGGGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102632453 12:114293201-114293223 TGTTAGCTGCAGGGGTTGGCTGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108248574 13:48542261-48542283 TTTTATAGGCACAGGATGGGGGG - Intergenic
1108302439 13:49092012-49092034 TGTTATCTGCGGAAGATGGCAGG + Intronic
1108359478 13:49656218-49656240 TGTGATGGGCAGAGGATAGAAGG + Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109293221 13:60500091-60500113 AGTTATCCACAGAAGATGGCAGG - Intronic
1109924619 13:69120091-69120113 TGTTGTTGGCAGGGCATGGCAGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1110964558 13:81676362-81676384 TTTTATGGGCACAGGATGGGGGG + Intergenic
1111168257 13:84491501-84491523 TTTTATGGGCACAGGATGGGTGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1114059043 14:19002194-19002216 TGTAATCGGCCCAGGATGGAGGG - Intergenic
1114103500 14:19399560-19399582 TGTAATCGGCCCAGGATGGAGGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114905378 14:27120449-27120471 TGCTATCTGAAGAAGATGGCAGG + Intergenic
1115012979 14:28572873-28572895 TTTTATAGGCACAGGATGGCAGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118667497 14:68086385-68086407 TTTTATAGGCACAGGATGGGGGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1123018638 14:105387300-105387322 CATTCTCGGCAGAGGAGGGCGGG - Intronic
1124405227 15:29385835-29385857 TTTTATGGGCACAGGATGGGGGG - Intronic
1124891507 15:33738023-33738045 TGATATGGGGAGAGGATGGTGGG - Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1126474828 15:49054587-49054609 TGTAAGCGTCACAGGATGGCAGG + Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1131398714 15:92107682-92107704 TGCTGTCTGCAGAGCATGGCAGG - Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1133384117 16:5354961-5354983 TGTGATCAGCAGAGGTTGGAAGG + Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1149007053 17:51817109-51817131 TCTTATCCACACAGGATGGCTGG + Intronic
1150219603 17:63488690-63488712 TGTTATGGGCATGGGAGGGCTGG + Exonic
1150855102 17:68745054-68745076 TTTTATGGGCACAGGATGGGGGG - Intergenic
1150998984 17:70351926-70351948 TTTTATGGGCACAGGATGGGGGG - Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151346776 17:73507237-73507259 TGATCCCTGCAGAGGATGGCTGG - Intronic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158155654 18:54422707-54422729 TGTTATTGGCAGGGGGTGGCAGG + Intergenic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1161657015 19:5522630-5522652 TGTTGTGGGCAGAGGAGGGAGGG - Intergenic
1162731912 19:12723420-12723442 TGTTATCGGCAGGGCAGGGAGGG - Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1165032468 19:33008052-33008074 TGTGATCGGCAGACGCAGGCTGG - Exonic
1165300819 19:34967661-34967683 TTTTATGGGCATAGGATGGGGGG - Intergenic
1167447362 19:49545608-49545630 TCTTATCGGGAGAGGGAGGCTGG + Intronic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168320971 19:55509204-55509226 TCTTATGGGGAGAGGGTGGCTGG - Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925597740 2:5572830-5572852 TGTTATCGGAAGAGGAGGTGAGG + Intergenic
926609389 2:14930688-14930710 TGTTATCGGCATAGGACATCTGG + Intergenic
926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927517114 2:23678524-23678546 TGATATTGGCAGAGACTGGCCGG - Intronic
927517199 2:23679300-23679322 TGATATTGGCAGAGACTGGCTGG + Intronic
929906956 2:46054797-46054819 TTTTATAGGCACAGGATGGGGGG - Intronic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
932167203 2:69519158-69519180 AGTTTGCGGCAGAGGCTGGCTGG + Exonic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933466423 2:82657997-82658019 TTTTATGGGCACAGGATGGGTGG - Intergenic
934511606 2:94948517-94948539 TGTTACCCGCAGAAGTTGGCTGG + Intergenic
935128607 2:100244805-100244827 AGTTATAGTCAGAGGGTGGCTGG + Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
937047894 2:118861862-118861884 TTTTATGGGGAGAGGATGGTGGG - Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937743744 2:125386688-125386710 TTTTATAGGCACAGGATGGGGGG + Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937891230 2:126940480-126940502 TTTTATGGGCACAGGATGGGGGG + Intergenic
938150732 2:128880172-128880194 TTTTATAGGCACAGGATGGGGGG + Intergenic
938477515 2:131629453-131629475 TGTAATCGGCCCAGGATGGAGGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939798602 2:146679052-146679074 TTTTATGGGCACAGGATGGGGGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940481745 2:154241197-154241219 GGTTATAGGCACAGGATGGCAGG + Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944213130 2:197227060-197227082 TGTTTTCTGCTGAGGATGGCAGG - Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946170281 2:217891187-217891209 GCTTCTCGGCACAGGATGGCAGG - Intronic
946416154 2:219540749-219540771 AGGTATGGGCAGAGGTTGGCAGG - Intronic
946471382 2:219964241-219964263 TTTTATGGGCATAGGATGGAGGG - Intergenic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947637548 2:231687759-231687781 TGTGAGGGGCAGAGGATCGCAGG - Intergenic
948159750 2:235814090-235814112 TTTTATAGGCACAGGATGGGGGG + Intronic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1172385462 20:34531059-34531081 GGGTAGCAGCAGAGGATGGCAGG - Intronic
1175391339 20:58629321-58629343 TGTCATCTGCAGAGGCTGGCTGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176870521 21:14080129-14080151 GGTTATCTGCAGATAATGGCAGG - Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178625347 21:34212075-34212097 TTTTATTGGCGGAGGGTGGCAGG + Intergenic
1178961346 21:37068984-37069006 TGTTTTCTGCAGGGGAGGGCAGG + Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180477527 22:15724810-15724832 TGTAATCGGCCCAGGATGGAGGG - Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1181786245 22:25229415-25229437 TCCTATTGGCAGAGGATGGGGGG - Exonic
1181818415 22:25457238-25457260 TCCTATTGGCAGAGGATGGGGGG - Intergenic
1182491505 22:30675287-30675309 GGTTATGGGCAGAGGTGGGCAGG - Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
949956684 3:9274922-9274944 TTTTATGGGCACAGGATGGAGGG + Intronic
950308774 3:11937589-11937611 TGTGATCAGTAGAGAATGGCTGG + Intergenic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951229194 3:20157293-20157315 TGTTAACAGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957758362 3:84522555-84522577 TTTTATAGGCACAGGATGGGGGG - Intergenic
958179879 3:90046512-90046534 AGTTATCCACAGAGGATAGCAGG + Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
961082762 3:124040584-124040606 TGGTATAGCCAGAGGATGACAGG + Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
962095156 3:132285435-132285457 TTTTATAGGCACAGGATGGGGGG + Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965863420 3:173174666-173174688 AGTTATCCGCATAGGAAGGCTGG - Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
970941614 4:21640944-21640966 AGTTATCTGCAGAGAGTGGCAGG - Intronic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
973784258 4:54320534-54320556 TTTTATCTGCAAAGGATGCCGGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
975675010 4:76818663-76818685 TCTTATAGGCAGGAGATGGCTGG + Intergenic
976031390 4:80758430-80758452 TTTTATGGGCATAGGATGGGGGG + Intronic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978327367 4:107574868-107574890 TTTTATAGGCACAGGATGGAGGG - Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978899080 4:113926848-113926870 TGTTATCTGCAGAAGACGGCAGG + Intronic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979184335 4:117770274-117770296 TTTTATGGGCACAGGATGGGGGG - Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980626667 4:135381885-135381907 TCTTATAGGCATAGGATGGGAGG - Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980731684 4:136832265-136832287 TTTTATGGGCATAGGATGGGGGG + Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981971051 4:150662289-150662311 TGCTATTCGCAGAGGATGACAGG + Intronic
982354484 4:154451268-154451290 AGTTGTCTGCAGAGAATGGCAGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983186424 4:164706102-164706124 TTTTATGGGCACAGGATGGGTGG - Intergenic
983339033 4:166434439-166434461 AGTTATCTGCAGAGAATGGAAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
985228102 4:187784463-187784485 TTTTATGGGCACAGGATGGGGGG - Intergenic
985382574 4:189410619-189410641 TGGTATAAGGAGAGGATGGCTGG - Intergenic
986076223 5:4340613-4340635 TTTTATAGGCACAGGAAGGCAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
988779520 5:34507374-34507396 TGTGATTTGCAGAGGATAGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
990792393 5:59496315-59496337 TTTTATAGGCACAGGATGGTAGG + Intronic
991001845 5:61790934-61790956 TGTTGTGGGCAGATGGTGGCTGG - Intergenic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996101541 5:119450187-119450209 TTTTATGGGCACAGGATGGGGGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997824814 5:137097050-137097072 TGTTATGTGCATAGTATGGCAGG + Intronic
999130315 5:149278053-149278075 TGTTCTTGGCAGAGGGTGGGAGG - Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000283292 5:159801317-159801339 TATTATCGGCAGACTATAGCAGG - Intergenic
1000369305 5:160519604-160519626 TCTTATGGGCAGAGCATTGCTGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001585152 5:172828987-172829009 TGTTTTAAGCAGAGAATGGCTGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006366423 6:33618842-33618864 TGTTTTCTGCAGAGGGTGGGAGG + Intergenic
1006952158 6:37831792-37831814 TGTTAGCTGCAGTGTATGGCAGG + Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010332103 6:74635310-74635332 TGTTCTAGGCAGAGGCAGGCAGG - Intergenic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011899562 6:92275288-92275310 TTTTATGGGCACAGGATGGTGGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012698694 6:102423396-102423418 ACTTATGGGCAGAGGATGGGAGG + Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013726071 6:113097241-113097263 TGTTATCAGCAGAGGCTGAGTGG + Intergenic
1014247300 6:119082002-119082024 TTTTATAGGCACAGGATGGTGGG + Intronic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020284252 7:6667953-6667975 TTTTATGGGCACAGGATGGGGGG - Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1023047227 7:36220743-36220765 TGTTATGGGCAGAGGGTGAAAGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1025104784 7:56162086-56162108 TTTTATAGGCACAGGATGGGGGG - Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026280992 7:68921641-68921663 TTTTATGGGCACAGGATGGGGGG - Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1031696147 7:124857492-124857514 TTTTATGGGCACAGGATGTCAGG - Intronic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1033265547 7:139883426-139883448 TGTTATAGAAAGAGGATGGGGGG - Intronic
1033296581 7:140143347-140143369 TGTCATCTGAAAAGGATGGCAGG + Intronic
1034093012 7:148381607-148381629 TTTTATAGGCACAGGATGTCAGG + Intronic
1034108627 7:148514442-148514464 TCTTATCAGCAGAGGTTGGCGGG + Intergenic
1034931251 7:155165778-155165800 TTTTATAGGCACAGGATGGGGGG - Intergenic
1035184063 7:157112079-157112101 CGTTCTGGGCAGAGGAGGGCAGG - Intergenic
1036527350 8:9547549-9547571 AGTTATCCACAGAGGATGGCAGG + Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1039292313 8:36109912-36109934 AGTTATCTACAGAGGATAGCAGG + Intergenic
1040576169 8:48653145-48653167 TGATGTGGGCAGAGGATGACTGG + Intergenic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1040975389 8:53188387-53188409 TGTTATCAGCAGAGGAATGATGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042328614 8:67554989-67555011 TGCTATCAGCAGAAGAGGGCTGG + Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044274385 8:90283641-90283663 TTTTATGGGCACAGGATGGGAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044765763 8:95572392-95572414 TTTTATAGGCACAGGATGGGGGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1048328050 8:133453614-133453636 TGTTAGCGCCAGATGACGGCAGG + Intergenic
1048800374 8:138189064-138189086 TTTTATGGGCATAGGATGGGGGG - Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051556272 9:18385853-18385875 AGTTATAGGCAGTGGGTGGCAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1053809709 9:41839681-41839703 TTTTATAGGCACAGGATGGGAGG + Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054620884 9:67347747-67347769 TTTTATAGGCACAGGATGGGAGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056177330 9:84048378-84048400 TGTTATAGGCAGAAGAGGCCTGG + Intergenic
1056292814 9:85160804-85160826 TGATGCCGGCAGAGGGTGGCAGG - Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056816786 9:89807636-89807658 TTTTGTGGGCAGAGGAGGGCAGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058544169 9:106042782-106042804 TTATATCTGCAGAAGATGGCAGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059853562 9:118369975-118369997 TGTTATTGACAGAGGCTGGAGGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187324448 X:18273781-18273803 TTTTATGGGCACAGGATGGGGGG - Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188115397 X:26237401-26237423 TGTTATGGACAGAGGAATGCAGG + Intergenic
1188247262 X:27851404-27851426 TGGTATCGTCAGAGGAAGGTGGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190255269 X:48757773-48757795 AGTTATCTGCAGAGAATAGCAGG - Intergenic
1190527882 X:51346279-51346301 AGTTATATGCAGAGCATGGCAGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191146001 X:57165926-57165948 TTTTATAGGCACAGGATGGGGGG - Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191939537 X:66463239-66463261 TTTTATGGGCACAGGATGGAGGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194313680 X:92346458-92346480 TATTATGGGAAGAGGATGACTGG - Intronic
1194421178 X:93674141-93674163 GGTTATTGGCAGAGGAGGGAGGG + Exonic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196998169 X:121407281-121407303 TCTTATGGGCACAGGATGGGGGG - Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198147164 X:133868784-133868806 TGTTATCAGCAGAGGAAGGGAGG - Intronic
1198169999 X:134096222-134096244 AGTTATCTGTGGAGGATGGCAGG - Intergenic
1198883368 X:141306318-141306340 TTTTATGGGCACAGGATGGGAGG - Intergenic
1198934038 X:141887847-141887869 TGTTATCTGCAGAAGATTGAAGG - Intronic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200621951 Y:5460576-5460598 TATTATGGGAAGAGGATGACTGG - Intronic
1201339863 Y:12922941-12922963 TTTTATAGGCACAGGATGGGGGG + Intergenic
1201765801 Y:17572653-17572675 GGTTATCTGCAGATAATGGCAGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1201835751 Y:18333336-18333358 GGTTATCTGCAGATAATGGCAGG + Intergenic
1202019662 Y:20451451-20451473 TATTATAGGCACAGGATGGAGGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic