ID: 906294791

View in Genome Browser
Species Human (GRCh38)
Location 1:44642963-44642985
Sequence GGTGCCACTCACCCACAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906294786_906294791 2 Left 906294786 1:44642938-44642960 CCCAAACTGTCAGAGGGTTTATG 0: 1
1: 0
2: 2
3: 14
4: 107
Right 906294791 1:44642963-44642985 GGTGCCACTCACCCACAAGGCGG 0: 1
1: 0
2: 0
3: 12
4: 124
906294787_906294791 1 Left 906294787 1:44642939-44642961 CCAAACTGTCAGAGGGTTTATGG 0: 1
1: 0
2: 0
3: 15
4: 248
Right 906294791 1:44642963-44642985 GGTGCCACTCACCCACAAGGCGG 0: 1
1: 0
2: 0
3: 12
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906294791 Original CRISPR GGTGCCACTCACCCACAAGG CGG Intronic
900379443 1:2376588-2376610 GGAGCCACTCACCCCAAAGGCGG - Intronic
900787746 1:4659342-4659364 GATGCCAATCAGACACAAGGAGG + Intronic
903593658 1:24477617-24477639 TCTGCCACTTACCCACCAGGTGG - Intergenic
903749104 1:25608762-25608784 GGCTCCACTCAACCACAAGGGGG + Intergenic
906294791 1:44642963-44642985 GGTGCCACTCACCCACAAGGCGG + Intronic
906511749 1:46413975-46413997 GGTGCCCATCACCCACAGGAGGG + Intergenic
907350543 1:53826427-53826449 GATACCACTCAGCTACAAGGAGG - Intronic
915550135 1:156627578-156627600 GGCCCCACCCAACCACAAGGGGG + Intergenic
919520807 1:198584330-198584352 GGCGCCCCTCACCTACCAGGTGG + Intergenic
919649150 1:200128430-200128452 GGTGACAATCAGCTACAAGGAGG - Intronic
921358466 1:214308170-214308192 GGTACCACTCACCTCCTAGGAGG - Intronic
924292665 1:242553884-242553906 GCTGCCACTCAACCAAAAAGGGG - Intergenic
1064314683 10:14244318-14244340 GGTTCCACCTAACCACAAGGGGG - Intronic
1067147785 10:43706218-43706240 GCTGCCACTCACCCTCAGGGAGG + Intergenic
1069995184 10:72337379-72337401 GGTCCCCCTCTCCCAAAAGGTGG - Intronic
1073566529 10:104540065-104540087 GGGGCCACGCCCCCAGAAGGTGG + Intergenic
1076631595 10:131855286-131855308 TGTGCCACACACACACAAGACGG + Intergenic
1077217875 11:1402582-1402604 GCTGCCCCTCACCCCCCAGGAGG - Intronic
1078638786 11:13076591-13076613 TGTGCAACTCCCCCACAAGGAGG - Intergenic
1079861203 11:25673736-25673758 GGTGCCAAGAACACACAAGGAGG - Intergenic
1080116874 11:28631320-28631342 GGTGCCACCCACACCCAAAGGGG + Intergenic
1081537796 11:44007933-44007955 GGTGCAGCTCTCCCTCAAGGTGG + Intergenic
1081783387 11:45729098-45729120 GCTGCCACTCACCTCTAAGGTGG + Intergenic
1084188906 11:67490103-67490125 AGTGCCACTTATCCACCAGGAGG + Exonic
1084893184 11:72247003-72247025 GGTGCACCTCACACACCAGGAGG - Intergenic
1089847717 11:121471458-121471480 TGCTCCTCTCACCCACAAGGAGG - Intronic
1090406946 11:126481965-126481987 GGTGGCTCTTATCCACAAGGAGG - Intronic
1091595055 12:1872661-1872683 GCTGCCACTCATCCCCAAAGTGG - Intronic
1092140966 12:6183151-6183173 GGGGCCACCCAGCCACAAAGAGG + Intergenic
1096049370 12:48593753-48593775 GGTGCCACTCACTCAGCAAGTGG - Intergenic
1096896734 12:54828538-54828560 GGTGGTACTCACCCACATTGAGG + Intergenic
1097101697 12:56594288-56594310 GCTGCCACTTGCCCAGAAGGTGG - Exonic
1098877417 12:75880846-75880868 GGTTCCACACAACCATAAGGGGG - Intergenic
1100331365 12:93585454-93585476 AGTGCCACCCAACCATAAGGGGG + Intergenic
1102295114 12:111730385-111730407 GGTGCCACTCACCTCCCAAGAGG + Intronic
1104083641 12:125455748-125455770 GGCTCCACCCAACCACAAGGGGG - Intronic
1104765041 12:131324763-131324785 GGTGCCACTCACCCATTCTGGGG - Intergenic
1104914543 12:132257943-132257965 GGGTCCACTCGCCCACAGGGAGG + Intronic
1105623044 13:22087556-22087578 GGTGCTAATCACACAGAAGGAGG - Intergenic
1106696353 13:32178182-32178204 ATTACCACTCACCCACAATGTGG + Exonic
1107419546 13:40233774-40233796 GGTGCCACACACACACAAATGGG - Intergenic
1108314427 13:49223477-49223499 GGTGCCATTCATACAGAAGGTGG - Intergenic
1110012918 13:70361952-70361974 GGTTCCACACACCCTCAAGGAGG - Intergenic
1112155067 13:96808289-96808311 GGTCCCACCCAGCCACAATGGGG - Intronic
1113454233 13:110436895-110436917 TGTGCCACCCACCCACTCGGAGG + Intronic
1119296827 14:73539452-73539474 GGTGCTTCTCACCCACACAGTGG + Intronic
1119301059 14:73571367-73571389 GGTGCTTCTCACCCACACAGTGG + Intronic
1119704340 14:76774582-76774604 GGAGCCCCTCACCCAGATGGGGG - Intronic
1121988919 14:98535788-98535810 GGTGTCACTGAACCACACGGAGG + Intergenic
1122981232 14:105193190-105193212 GGTGACACACGTCCACAAGGCGG - Intergenic
1124686390 15:31786443-31786465 CGTGCCACACACACAAAAGGAGG - Intronic
1125647463 15:41284278-41284300 CGTGCAACACACCCAGAAGGCGG - Intergenic
1125920353 15:43521725-43521747 GGTGCTACTCACACACATTGGGG + Exonic
1127153293 15:56101479-56101501 GGGCCCACTCACACACAAGACGG + Exonic
1129615353 15:77094840-77094862 GCTGCCAGTCACCCACCAGATGG + Intergenic
1129886608 15:79042468-79042490 GGTGGGGCTCACACACAAGGGGG + Intronic
1130295814 15:82646822-82646844 GGGGGGACTCACCCACAAAGGGG - Intronic
1130305855 15:82711664-82711686 GGAGGCACTCACCCTCAAAGTGG + Intergenic
1131757988 15:95586752-95586774 GGTGAGAATCATCCACAAGGGGG - Intergenic
1132311663 15:100862021-100862043 GGTGGCTCTCATCCACAACGAGG + Intergenic
1132580349 16:681886-681908 GGTGCCCCCCACCCACATGTGGG + Exonic
1132613691 16:830033-830055 AGCGCCACTCAGCCACAAGAAGG - Intergenic
1132623457 16:879116-879138 GCAGCCCCTCACCCACATGGAGG + Intronic
1132908519 16:2296768-2296790 GTTGCCACTCAGTCACTAGGGGG + Intronic
1133390499 16:5406291-5406313 GATGGCACTCACCCACACTGGGG - Intergenic
1137349997 16:47705343-47705365 GGTGCCACTCACTCACACACAGG - Intergenic
1137617953 16:49858021-49858043 GGCGCCACTCACCCGGGAGGGGG - Intergenic
1141392780 16:83678455-83678477 GGAGCCACTCACCCACCTGATGG - Exonic
1143758883 17:9086970-9086992 GGTGCCAGGCACACAGAAGGTGG - Intronic
1145007835 17:19347583-19347605 GGTGCCAGCCACACACCAGGTGG - Intronic
1148050849 17:44769361-44769383 GGTGCCCCTCACCAGCCAGGAGG + Intronic
1148842138 17:50505866-50505888 CTTGCCATTCACCCTCAAGGAGG + Intergenic
1152461321 17:80443911-80443933 GCTGCCAATCACCCCCAAGTAGG - Intergenic
1152944401 17:83191202-83191224 GGGGCCACAGACCCACACGGTGG + Intergenic
1155117572 18:22784311-22784333 GGTGGCACGGACTCACAAGGGGG + Intergenic
1158321246 18:56267113-56267135 GGTGGCAATCACCCAGATGGTGG - Intergenic
1160973814 19:1782529-1782551 GGAGCCTCACACCCCCAAGGAGG - Exonic
1162225895 19:9222082-9222104 GGTGCCAAAGACTCACAAGGGGG - Intergenic
1165146867 19:33736392-33736414 GGTGCAAATCATCCACAGGGAGG - Intronic
1165923656 19:39314236-39314258 GGTGCCACTGTCCCTCAAGGTGG + Exonic
1166202630 19:41248441-41248463 GGTGACATTCACCCACCAGTAGG - Intronic
928388471 2:30889557-30889579 GCTTCCCCTCACCCACAAGGTGG - Intergenic
932442245 2:71744932-71744954 GCTGCCTCTCACCAACACGGGGG - Intergenic
934762754 2:96865429-96865451 GCAGCCACTCACCCACAAGAAGG + Exonic
935301655 2:101698127-101698149 GGGCCCACTCACCCGCAGGGAGG - Exonic
936076699 2:109405846-109405868 GGTGCCACTGGCCCACAGGTGGG + Intronic
945986605 2:216359496-216359518 AGTGGAACTCACCCACCAGGAGG + Intronic
947711854 2:232321075-232321097 GGTGCCTGTCACCCATGAGGAGG + Intronic
947731096 2:232432210-232432232 GGTGCCTGTCACCCATGAGGAGG + Intergenic
948853501 2:240719600-240719622 GCTGCCCCTGACCCACATGGAGG - Intronic
948952286 2:241261758-241261780 TGTGCCACTTAACCACATGGGGG - Intronic
1172605672 20:36212019-36212041 TGTGCCACACACCCTCATGGTGG - Intronic
1175397290 20:58675191-58675213 GGAGCCCCTCATCCACCAGGAGG - Intronic
1178426765 21:32484880-32484902 GTCCCCACTCACCCACAGGGAGG + Intronic
1180218960 21:46345915-46345937 GCTGCCATTCAGCCACAAGAAGG - Intronic
1183110615 22:35645950-35645972 GGTTCCACTGGCCCACAAAGAGG - Intergenic
1184355236 22:43975233-43975255 GGTGCCTCTCACCATGAAGGCGG + Intronic
1185237969 22:49725529-49725551 GATGCCACACACACACCAGGAGG - Intergenic
952852675 3:37741781-37741803 GGTGCCACTGATGCACGAGGTGG + Exonic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
955418200 3:58712260-58712282 GGGACCACACACTCACAAGGAGG + Intergenic
958996576 3:100912799-100912821 AGTTCCACTCACCCACTAGTTGG + Intronic
959281555 3:104348026-104348048 GGTGCCACTCACCCCTTTGGAGG + Intergenic
960621361 3:119639581-119639603 GGTGCCACTCCCCAACCTGGAGG - Intronic
961378489 3:126482383-126482405 GGTGACACTGCCTCACAAGGTGG - Exonic
964472809 3:157072305-157072327 GGTGTCACTTTCCCACCAGGAGG - Intergenic
969432027 4:7161008-7161030 GGTGCCAGTCTCCCACCTGGTGG + Intergenic
970140791 4:12980023-12980045 TGACCCACTCACCCACGAGGGGG - Intergenic
971343299 4:25790114-25790136 TCTGCCACTCACCCAGAAAGAGG - Intronic
979080769 4:116337517-116337539 GGTGCCACTAACACACAATGAGG - Intergenic
985521313 5:375081-375103 GGAGCCAGTGACCCACAATGAGG + Intronic
1001901278 5:175432339-175432361 GATGAAACACACCCACAAGGGGG - Intergenic
1003917108 6:10797300-10797322 GGTGCCACCCATACACCAGGGGG - Intronic
1006923509 6:37641200-37641222 GGTGGCTCTCTCCCACCAGGGGG + Intronic
1007991481 6:46260614-46260636 GGTCCCACTCACCCAAAGGATGG - Intronic
1016774196 6:147886511-147886533 GGTCCCACCCACACTCAAGGGGG - Intergenic
1018629471 6:165809757-165809779 TGTGCCTTTCACCCACTAGGAGG - Intronic
1018775897 6:167015510-167015532 GATGCCACTCACCTACCATGCGG - Intronic
1019657046 7:2201411-2201433 GGAGCCCCTAGCCCACAAGGAGG + Intronic
1020276338 7:6626934-6626956 GGGGCCACTCCCCCATCAGGTGG + Intergenic
1021656046 7:22875055-22875077 GGTACCACTCACCAACCAGCTGG + Intergenic
1025674228 7:63631482-63631504 GGGGCCAATCACCCTCATGGCGG - Intergenic
1034511394 7:151537839-151537861 GAGGGCACTCACCCACAGGGAGG + Intergenic
1035406785 7:158604051-158604073 GGTGCCCCTTAGCCACCAGGAGG - Intergenic
1038531773 8:28324078-28324100 CGTGCCTCTGACCCACAGGGAGG + Intronic
1039920728 8:41892464-41892486 GGAGCCAGGCACTCACAAGGAGG - Intronic
1040107660 8:43549612-43549634 GGTGCCCCCCACCCACACTGGGG + Intergenic
1041094262 8:54333387-54333409 GGACCGACTCACCCACAGGGAGG + Intergenic
1047212234 8:122849257-122849279 GGAGCCACTCACCCACAGGTAGG - Intronic
1047770597 8:128027341-128027363 GGAACCTCTCACCCACAAGGTGG + Intergenic
1061926275 9:133807565-133807587 GTGGCCACTCACACACAGGGTGG + Intronic
1062136125 9:134929411-134929433 GGGGCTAGTCAGCCACAAGGAGG - Intergenic
1062143126 9:134971272-134971294 GGGGCCAGTAACCCACAATGGGG + Intergenic
1186133180 X:6491652-6491674 GGTCCCACCCACACACAAAGAGG - Intergenic
1190825925 X:54017884-54017906 GCTGCCACTCACCCAAGAGGTGG + Intronic
1200094136 X:153649429-153649451 GGTGCCACACCCCCACCAGTGGG + Exonic
1201337611 Y:12897303-12897325 GGTGCCATTTACACACTAGGTGG - Intergenic