ID: 906298249

View in Genome Browser
Species Human (GRCh38)
Location 1:44662320-44662342
Sequence GGCCGAGCCAGCACCTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906298249_906298254 3 Left 906298249 1:44662320-44662342 CCTCCACAGGTGCTGGCTCGGCC 0: 1
1: 0
2: 0
3: 20
4: 249
Right 906298254 1:44662346-44662368 GATAAGGGAGACAGTCCCACAGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906298249 Original CRISPR GGCCGAGCCAGCACCTGTGG AGG (reversed) Intronic
900511134 1:3061744-3061766 GGCAGAGCCTGGCCCTGTGGTGG - Intergenic
901650415 1:10739804-10739826 GGAAGAGCCAGGACCAGTGGGGG - Intronic
901699746 1:11038825-11038847 GGCAGAGCCAGGGCCAGTGGGGG + Intronic
903319341 1:22532900-22532922 GGCAGAGCCAGCACTTGGCGGGG + Intergenic
903595374 1:24490097-24490119 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
903738365 1:25544214-25544236 GCCCCAGCCAGCAGCTGCGGCGG + Intronic
904613089 1:31735880-31735902 GGGAGAGCCAGCAGCTGGGGTGG + Exonic
905298295 1:36968666-36968688 GGTGGGGCCAGCAGCTGTGGAGG - Intronic
906298249 1:44662320-44662342 GGCCGAGCCAGCACCTGTGGAGG - Intronic
907020367 1:51060722-51060744 AACAGAGCCAGCACCTGTGGTGG + Intergenic
907317716 1:53583136-53583158 GGCAGAGCCAGGACCTGAGCTGG + Intronic
907429997 1:54406164-54406186 CGCGGAGCCAGCGCCTGGGGGGG - Exonic
907917933 1:58887817-58887839 GGGCAAGCTTGCACCTGTGGAGG - Intergenic
909197894 1:72649592-72649614 ACCTGAGCCAGCACCTGTGCTGG + Intergenic
910625570 1:89303042-89303064 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
915248432 1:154572035-154572057 GGCTGAGCCTGCACCAGTGGCGG + Exonic
916680938 1:167104470-167104492 TGGCGAGCAAGCATCTGTGGTGG + Intronic
917406336 1:174711535-174711557 ACCCGGGCCAGCAGCTGTGGAGG + Intronic
919419771 1:197355618-197355640 ACCCGGGCCAGCAGCTGTGGAGG - Intronic
920604866 1:207371620-207371642 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
922800372 1:228362233-228362255 GGCAGAGCCAGGGCCTGGGGTGG + Intronic
1064347814 10:14548600-14548622 GGCAGAGACAGCCCCTGAGGAGG + Intronic
1066575479 10:36820069-36820091 ATCCTAGCCAGCAGCTGTGGAGG + Intergenic
1067204590 10:44201990-44202012 GGCTGGACCAGCACCTGGGGTGG + Intergenic
1067223028 10:44357442-44357464 TGCCGAGCCAGAACCTCTGGGGG + Intergenic
1070358642 10:75664924-75664946 GACAGACCCAGCACCTGTTGGGG + Intronic
1071288586 10:84171923-84171945 GGCCGAGGCAGCCCCTTAGGCGG - Intergenic
1072283794 10:93894156-93894178 GGCAGAGCCAGCACCTACCGCGG - Exonic
1075576888 10:123584248-123584270 GGCGGAGCCGGCTCCTGTGGAGG + Intergenic
1076035519 10:127196186-127196208 GGCCGGGCCGGCAGCGGTGGAGG - Intronic
1076373385 10:129968533-129968555 GGCCGCGTCACCACCCGTGGTGG - Intergenic
1076810043 10:132881705-132881727 GGCCCCAGCAGCACCTGTGGAGG - Intronic
1077718252 11:4602206-4602228 AGCAGAGCCAGGTCCTGTGGAGG - Exonic
1078316089 11:10294256-10294278 AGCCGAGCCAGCGCGGGTGGGGG - Intergenic
1082912326 11:58390794-58390816 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
1083299788 11:61734392-61734414 GGCCTAGCCAGCACCTCTCTCGG - Intronic
1084068281 11:66718117-66718139 GGGGGTGCCAGCACCTGGGGAGG - Intronic
1084591369 11:70092590-70092612 GGGGGACCCAGCACCTGGGGTGG + Intronic
1085454926 11:76660313-76660335 AACCGAGTCAGCCCCTGTGGGGG - Exonic
1086508194 11:87527976-87527998 CACAGAGCCAGCACCTGTGCTGG - Intergenic
1088843968 11:113649567-113649589 AGCCGGGCCAGCAGCTGTGGAGG - Intergenic
1090331493 11:125935855-125935877 GGCTGTGCCAGAACCTGTGGAGG + Intergenic
1090955904 11:131512702-131512724 GGCCCAGCCAGCACATGCTGGGG - Intronic
1091105016 11:132910294-132910316 GGCCCGGCCTGCCCCTGTGGGGG - Intronic
1092135202 12:6142334-6142356 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
1092578802 12:9817775-9817797 GGAAGTGCCTGCACCTGTGGTGG - Intergenic
1095568558 12:43655287-43655309 GACCATGCCAGCACCAGTGGTGG - Intergenic
1095587410 12:43864031-43864053 ACCCGGGCCAGCAGCTGTGGAGG + Intronic
1096579577 12:52575789-52575811 CTCTGAGCCAGCACCTGTAGTGG - Intergenic
1098519548 12:71420386-71420408 CACAGAGCCAGCACCTGTGCTGG - Intronic
1098607376 12:72408024-72408046 GGAGGAGCCAGCATCTGTGAGGG + Intronic
1099204355 12:79711072-79711094 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
1100839046 12:98593749-98593771 GGCCGGGCCTTCTCCTGTGGCGG + Intronic
1102261203 12:111444634-111444656 GGCTGTGTCAGCAGCTGTGGGGG - Intronic
1105344381 13:19560170-19560192 GGCCGAGCTGGCACCGGAGGGGG - Intergenic
1105883481 13:24623494-24623516 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
1106221328 13:27748537-27748559 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
1108266214 13:48711588-48711610 GGCAGAGCCAACATCTGGGGAGG - Intergenic
1108362304 13:49678532-49678554 ACCCGGGCCAGCAGCTGTGGAGG - Intronic
1109124924 13:58505643-58505665 ACCCAGGCCAGCACCTGTGGAGG - Intergenic
1109638091 13:65149796-65149818 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
1109854298 13:68107940-68107962 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
1110497854 13:76190237-76190259 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
1111549003 13:89783453-89783475 CACAGAGTCAGCACCTGTGGTGG - Intergenic
1112187328 13:97139892-97139914 GGGAGAGGCAGCAGCTGTGGTGG + Intergenic
1112337300 13:98525818-98525840 TGAGGATCCAGCACCTGTGGAGG + Intronic
1113371961 13:109732896-109732918 ACCCGAGCCAGCAGCTGCGGAGG - Intergenic
1122388325 14:101363958-101363980 GCCCGAGGCAGCATCTGTGGAGG - Intergenic
1123001047 14:105294238-105294260 GGCCCAGCAACCAACTGTGGTGG - Intronic
1123437319 15:20264186-20264208 GGGGGAGCCAGCACTTGTAGGGG - Intergenic
1124125792 15:26937320-26937342 TGCCGAGCCCTCACCTGTGCTGG - Exonic
1127182010 15:56430902-56430924 GGCCCACCCAGCACTTGGGGAGG + Intronic
1127916446 15:63459223-63459245 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
1130044769 15:80435227-80435249 GGCAGAGCTGGCACCTATGGAGG - Intronic
1130132864 15:81158760-81158782 GCCCGGGCCAGCGGCTGTGGAGG + Intergenic
1130632024 15:85579214-85579236 GGTGGAGCCAGCACCTATTGTGG + Exonic
1131153618 15:90062003-90062025 GGCCAGGCCAGCCCCTGGGGAGG - Intronic
1131986059 15:98043834-98043856 GGCCTAGACAGCCCCTGTGACGG - Intergenic
1132632682 16:927457-927479 GGCCGAGCCAGCTCCTCTCTGGG - Intronic
1132670634 16:1100897-1100919 GGAGGAGCCAGCACTGGTGGGGG + Intergenic
1133028485 16:2998716-2998738 GGCAGACCCAGCACCTTAGGGGG - Intergenic
1133319473 16:4904027-4904049 AGCCGAGCCAGGTCCTGTGAGGG + Exonic
1136548954 16:30971619-30971641 GCCCACGCCAGCACCTGTGGAGG + Exonic
1136847253 16:33586646-33586668 GGGGGAGCCAGCACTTGTAGGGG + Intergenic
1138168836 16:54829954-54829976 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
1141761179 16:86029650-86029672 GGCCCAGCCGGCAGCGGTGGGGG + Intergenic
1142377068 16:89711774-89711796 GGCGGAGCCAGAGGCTGTGGGGG - Intronic
1203108961 16_KI270728v1_random:1435301-1435323 GGGGGAGCCAGCACTTGTAGGGG + Intergenic
1143524266 17:7463209-7463231 GCCCCGGCCAGCCCCTGTGGGGG + Exonic
1143527976 17:7483352-7483374 GACAGAGCCAGCAGCTGCGGTGG + Exonic
1145762100 17:27430899-27430921 GGCCCATCCAGCAAGTGTGGTGG - Intergenic
1146571114 17:33954170-33954192 TGCCTACCCAGCATCTGTGGAGG + Intronic
1147327127 17:39674914-39674936 GGCCAGGCCGGAACCTGTGGAGG - Intronic
1148218926 17:45849088-45849110 GGCTGAGCCAGGGCCTGCGGAGG - Intergenic
1148821129 17:50360296-50360318 GCCCCAGCCAGTACCCGTGGAGG + Exonic
1148889828 17:50799633-50799655 GGCAGAGCCAGGAGCTGTGGGGG + Intergenic
1151518523 17:74612760-74612782 TGCTGAGCCGGAACCTGTGGTGG + Exonic
1152568175 17:81109542-81109564 GGCCGCCCCGGCCCCTGTGGAGG + Intronic
1152581159 17:81166136-81166158 CGCAGAGCCCGCACCGGTGGGGG + Intergenic
1152677845 17:81650860-81650882 GGCCTGGCCAGCCCCTGAGGGGG + Exonic
1152755627 17:82085858-82085880 TGGCCAGCCAGCACCTGTAGGGG + Exonic
1152800959 17:82330445-82330467 GGCAGAGCCAGCACCTGGGTGGG - Intronic
1153664051 18:7352241-7352263 GGCAGGGCCAGCACCTCTGCAGG - Intergenic
1154231440 18:12559311-12559333 ACCCGCGCCAGCAGCTGTGGAGG - Intronic
1155284223 18:24271924-24271946 GGCCGAGCCAGCGGCGGCGGAGG - Intronic
1155852281 18:30788582-30788604 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
1156629060 18:38944625-38944647 ACCCCAGCCAGCAGCTGTGGAGG - Intergenic
1158282308 18:55840918-55840940 AGCTGGGCCAGCAGCTGTGGAGG - Intergenic
1160033516 18:75281833-75281855 GGGAGAGCCCGAACCTGTGGGGG + Intronic
1160044381 18:75373112-75373134 GGCCTAGCCACCACCTGAGCAGG - Intergenic
1160782140 19:882546-882568 GGCCCAGAGAGCACGTGTGGGGG + Intronic
1160874333 19:1290219-1290241 AACCGAGGCAGCTCCTGTGGTGG + Intronic
1161986149 19:7655600-7655622 GGCTGGGCCAGCAGCAGTGGTGG + Intergenic
1162091091 19:8280580-8280602 ACCCGGGCCAGCAGCTGTGGAGG - Intronic
1162093325 19:8295418-8295440 ACCCGGGCCAGCAGCTGTGGAGG - Intronic
1162735628 19:12745530-12745552 GGCCCAGCCAGCAGGGGTGGGGG + Intronic
1163717171 19:18879375-18879397 GGCGGAACCAGAACCTGCGGTGG + Exonic
1164719757 19:30423776-30423798 GGCAGTGACAGCAGCTGTGGCGG + Intronic
1165033304 19:33014093-33014115 GGGGGAGCCAGCACTTGTAGGGG - Intronic
1166361606 19:42254950-42254972 GGCGGGGGCAGCACGTGTGGGGG - Intronic
1166729385 19:45050164-45050186 GGACAGGCCAGCACCTGTGAGGG + Intronic
1167026756 19:46925386-46925408 GGCCAAGCCAACCCCTGTGTGGG + Intronic
1167117356 19:47496022-47496044 GGCCAAACCAGCATCTGAGGTGG + Intronic
925608805 2:5685892-5685914 GGCGGAGCCTGCACCAGTGCTGG - Intergenic
926295018 2:11562735-11562757 GGCCGGGCCAGCACCTGCTGCGG - Intronic
927596583 2:24402997-24403019 ACCCGAGCCAGCAGCTGCGGAGG + Intergenic
928197943 2:29228531-29228553 GGCCAAGCCAGCTCCTGAAGGGG - Intronic
928518317 2:32064113-32064135 GGCCGCGCCAGCACCTGCCTCGG + Exonic
928880574 2:36092379-36092401 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
932131277 2:69189613-69189635 GGCCCAGGCAGGAGCTGTGGAGG + Intronic
933433571 2:82215409-82215431 AGCGGGCCCAGCACCTGTGGTGG + Intergenic
935087780 2:99865223-99865245 GGCCCAGCCATCAGGTGTGGGGG + Intronic
935790300 2:106584527-106584549 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
935878364 2:107536313-107536335 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
935922551 2:108031701-108031723 AGCTGGGCCAGCAGCTGTGGAGG + Intergenic
936573371 2:113634444-113634466 GTCCAGGCCAGCACCTGTGCAGG + Intronic
937235765 2:120431091-120431113 GGCTGGGGCAGCCCCTGTGGTGG + Intergenic
937608203 2:123826967-123826989 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
943827449 2:192414160-192414182 GGCCGAGGCAGCAGCAGTGGTGG - Intergenic
943827592 2:192414889-192414911 CACAGAGCCAGCACCTGTGCCGG + Intergenic
945029476 2:205650054-205650076 AGCCCAGCCAGCACCTCTGATGG - Intergenic
945869148 2:215208011-215208033 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
948801443 2:240435351-240435373 GGCGGTGGCACCACCTGTGGGGG - Intergenic
1170890043 20:20368715-20368737 GGCGGAGGCGGCACCTGCGGCGG + Exonic
1172653971 20:36525742-36525764 GGCCCTGCCAGCACCCGCGGGGG - Intronic
1172742931 20:37183472-37183494 GGCCGGGCCAGCACTTTGGGAGG - Intronic
1174219533 20:48942435-48942457 GGCTGAGCCAGGAGGTGTGGTGG - Intronic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1175784843 20:61705988-61706010 GTCCAAGCCAGCACCCGTGGGGG - Intronic
1176072062 20:63232432-63232454 GGCTGAGTCAGAGCCTGTGGAGG - Intergenic
1179632371 21:42686447-42686469 GACACAGCCATCACCTGTGGAGG - Intronic
1180193729 21:46181626-46181648 GGCCGCTCCAGCACCTGTGCTGG - Intronic
1181438171 22:22922323-22922345 TGTGGAGCCAGCACCGGTGGGGG + Intergenic
1181800897 22:25347153-25347175 ACCCAGGCCAGCACCTGTGGAGG - Intergenic
1181868151 22:25875628-25875650 GGCTGAATCAGCACCTTTGGGGG + Intronic
1181954690 22:26579688-26579710 GGCCGTGCTGGCACCTGTGTGGG + Intronic
1183015944 22:34986782-34986804 TGCTGAGCCAGCAGCTGTGGGGG + Intergenic
1183102250 22:35591187-35591209 GGCCTGGCCAGCACCTGTTGGGG + Intergenic
1183404828 22:37625240-37625262 TGCCAAGCCTGCAGCTGTGGGGG + Intronic
1183467962 22:37989565-37989587 AGCTGAGCCGGCACCTGGGGAGG - Intronic
1183619580 22:38964744-38964766 GGCGAAGCCTGCACCTGTGAAGG + Intronic
1183674079 22:39290150-39290172 AGCCCAGCCAGTGCCTGTGGAGG - Intergenic
1183990355 22:41593659-41593681 AGCCGGGCCAGCAGCTGTGGAGG + Intergenic
1185056469 22:48581287-48581309 GGCCGAGCCAGTCCCTGCCGAGG + Intronic
1185426811 22:50776436-50776458 GTCCAGGCCAGCACCTGTGCAGG - Intronic
950184052 3:10934253-10934275 GGCCGAGGCTGGACCTGAGGAGG + Intronic
950408120 3:12817101-12817123 GGCCCAGCCAGCCTCTTTGGTGG + Exonic
950423718 3:12913540-12913562 GGCAGAGAGAGCACCTGTGTGGG + Exonic
956611743 3:71130715-71130737 AGCCCAGCCAGCTACTGTGGAGG - Exonic
956659480 3:71583790-71583812 AGCCCAGCCAGCGCCGGTGGCGG + Intronic
956995860 3:74825546-74825568 GGCCGAGGCAGCCCCTTAGGTGG + Intergenic
957039602 3:75327155-75327177 GGCTGAGCCAGCAGAGGTGGGGG + Intergenic
957233083 3:77546340-77546362 GGCCGAACCACAAACTGTGGGGG - Exonic
958419873 3:93917724-93917746 ACCCGGGCCAGCAGCTGTGGAGG + Intronic
961044357 3:123698587-123698609 GGCTGAGCCAGCAGAGGTGGGGG + Intronic
961641982 3:128370561-128370583 GGCTAAGCCAGGGCCTGTGGAGG + Intronic
961831054 3:129623251-129623273 GGCAGAGCCAGCAGATGAGGTGG - Intergenic
962256533 3:133873527-133873549 GGCCGAGCCCTCCTCTGTGGCGG - Intronic
967161578 3:186743752-186743774 GGCAGAGCCAGCATCTGAGAGGG + Intronic
967253539 3:187567061-187567083 GCCCCAGCCAGGACCTGGGGAGG + Intergenic
967448504 3:189596262-189596284 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
967499155 3:190177271-190177293 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
968764082 4:2459078-2459100 GGCCAAGCCAGGAGCTGAGGTGG - Intronic
969303158 4:6309247-6309269 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
969583479 4:8078842-8078864 GCCAGACCCAGCACGTGTGGGGG + Intronic
972274750 4:37546711-37546733 GGCCGAGGCAGCCCCTTAGGTGG + Intronic
974188014 4:58465260-58465282 AGCCGGGCCAGCAGCTGCGGAGG + Intergenic
975093085 4:70426059-70426081 GGCAGAGAGAGCAACTGTGGTGG - Intergenic
975605196 4:76148134-76148156 GGCCGAGGCGGCACCCGAGGAGG - Intronic
977206521 4:94169983-94170005 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
978929801 4:114296374-114296396 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
983843182 4:172482094-172482116 ACCCGGGCCAGCAGCTGTGGAGG - Intronic
984918101 4:184741345-184741367 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
985611707 5:892911-892933 GGCTGAGGCAGCGGCTGTGGCGG + Exonic
986721574 5:10564268-10564290 GGCTGAGCGAGCCCCTGGGGTGG - Intergenic
987990249 5:25200245-25200267 ACCCGAGCCAGCAGCTGCGGAGG - Intergenic
989777379 5:45225750-45225772 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
991039562 5:62161883-62161905 CACAGAGCCAGCACCTGTGCTGG - Intergenic
992050362 5:72935377-72935399 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
993770288 5:91917415-91917437 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
995529133 5:113075174-113075196 ACCCGGGCCAGCAGCTGTGGAGG + Intronic
995988439 5:118208183-118208205 ACCCGGGCCAGCAGCTGTGGTGG - Intergenic
998114575 5:139526388-139526410 GGCCGAGGCAGCCCCTTAGGCGG + Intergenic
998168235 5:139856565-139856587 GGGCCAGCCAGCAGGTGTGGTGG - Intronic
1000605076 5:163318980-163319002 GGCCGAGGCAGCCCCTTAGGCGG - Intergenic
1000902486 5:166927169-166927191 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
1002064244 5:176644157-176644179 GGCTGAGCCAACCCCTGGGGAGG - Intronic
1002758021 6:179732-179754 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
1003608800 6:7590263-7590285 GGGCGAGCCTCCACCTGTGGAGG + Exonic
1006351103 6:33521729-33521751 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
1006440795 6:34052476-34052498 GGCCCATCCATCACCTGGGGTGG + Intronic
1010317595 6:74468664-74468686 TGCCGAGGCAGCACCTTAGGCGG + Intergenic
1012525332 6:100170238-100170260 GGCCGGGACAGGACCTGTGCAGG - Intergenic
1013410779 6:109881364-109881386 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
1016029607 6:139323820-139323842 GGCCGAGCCATCAGATGTAGGGG - Intergenic
1018153486 6:160963023-160963045 GTCAGAGGCAGCAGCTGTGGTGG - Intergenic
1018335670 6:162785899-162785921 GGCAGGGCCAGGACCCGTGGAGG + Intronic
1019047120 6:169157780-169157802 GGCCCTGCCAGCACCTCTGGTGG + Intergenic
1019347824 7:539277-539299 GGCAGAGGCACCACCTCTGGGGG + Intergenic
1020474748 7:8582077-8582099 CACAGAGCCAGCACCTGTGCTGG - Intronic
1021343015 7:19488311-19488333 CATGGAGCCAGCACCTGTGGTGG - Intergenic
1021677779 7:23098136-23098158 CACGGAGCCAGCACCTGTGCTGG + Intergenic
1022339176 7:29452384-29452406 GGCAGAGCCGGCACCTGAGAGGG + Intronic
1023396204 7:39754161-39754183 AGCCAGGCCAGCAGCTGTGGAGG - Intergenic
1024844971 7:53632934-53632956 GGCAGAGGAAGCACCTGTGCTGG + Intergenic
1024913209 7:54469884-54469906 GCCAGAGCCAGGCCCTGTGGCGG + Intergenic
1026840478 7:73667919-73667941 GGCCGAGCCAGCAGCCGAGCTGG + Exonic
1028982236 7:96979849-96979871 GGCCCAGCCATCACCTCTGCAGG + Intergenic
1035463901 7:159063361-159063383 ACCCGGGCCAGCAGCTGTGGAGG - Intronic
1036210053 8:6834508-6834530 GGCTGAGACAGGACCTGCGGGGG - Intronic
1037803817 8:22048890-22048912 GGCCGCGCCTGCACCTGCCGTGG - Intergenic
1040284928 8:46094749-46094771 GGCCCCGCCACCACCCGTGGGGG - Intergenic
1040465548 8:47691690-47691712 GACAGAGACAGCACCTGTGCTGG - Intronic
1040478073 8:47798353-47798375 GGCGTATCCAGCACTTGTGGTGG - Exonic
1040964587 8:53071359-53071381 AACCGGGCCAGCACCTGCGGTGG - Intergenic
1041226588 8:55706587-55706609 GGCCGAGGCAGCCCCTTAGGCGG + Intronic
1042948760 8:74179751-74179773 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
1045678412 8:104633106-104633128 ACCCGGGCCAGCAGCTGTGGAGG - Intronic
1046094288 8:109539597-109539619 GGGCCAGCCAGGACCTGAGGCGG + Intergenic
1047416448 8:124668153-124668175 GGCCCGGCCAGCAACTGAGGAGG + Intronic
1048112852 8:131487169-131487191 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
1048493861 8:134919481-134919503 GGAGTAGCCAGCACCTGCGGGGG + Intergenic
1049181745 8:141226491-141226513 GGACAGGCCAGCACCTGGGGTGG - Intronic
1049422755 8:142524229-142524251 GGGAGAGCCAGCAGCTGGGGAGG - Exonic
1052413217 9:28148021-28148043 GGCATGGCCAGGACCTGTGGCGG - Intronic
1053001615 9:34579893-34579915 GGCTGAGGCAGCTTCTGTGGGGG - Intronic
1056549763 9:87642536-87642558 GTCCTACCCAGCCCCTGTGGAGG - Intronic
1056576552 9:87859353-87859375 GGCATAGCCGGCACCTGCGGCGG + Intergenic
1056801455 9:89694954-89694976 TGCCGAGGCAGCAGGTGTGGAGG + Intergenic
1057270224 9:93646317-93646339 GGTAGAGGAAGCACCTGTGGGGG + Intronic
1058786494 9:108393652-108393674 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
1061620243 9:131807228-131807250 GGTCGAGCCAGCACACCTGGAGG + Intergenic
1061837018 9:133336206-133336228 GGCCGCGCCTGCCCGTGTGGTGG - Exonic
1062513837 9:136922373-136922395 GGCTGAGCCAGCAGCTGCAGAGG - Intronic
1186137402 X:6534104-6534126 GGCCGTGACGGCACCTGAGGCGG - Exonic
1186152597 X:6690729-6690751 GCCCGGGCCAGCGGCTGTGGAGG - Intergenic
1186267032 X:7843575-7843597 GGCCGTGACGGCACCTGAGGCGG + Exonic
1186298074 X:8170250-8170272 GGCCGTGACGGCACCTGAGGCGG - Exonic
1186324721 X:8465822-8465844 GGCCGTGACGGCACCTGAGGCGG + Exonic
1189467120 X:41285931-41285953 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
1190916565 X:54815542-54815564 GCCAGTGCCAGCACCAGTGGTGG + Exonic
1192494265 X:71604477-71604499 GGAAGAGCCTGCACCTGTGGTGG + Exonic
1194204461 X:90995544-90995566 ACCCGGGCCAGCAGCTGTGGAGG + Intergenic
1194340458 X:92699703-92699725 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
1195880205 X:109585747-109585769 TGTGGAGCCAGCACCTGTGCAGG - Intergenic
1196423371 X:115545134-115545156 GGCCGAGGCAGCTCCTTAGGCGG - Intergenic
1196860867 X:120026008-120026030 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
1200648817 Y:5816439-5816461 ACCCGGGCCAGCAGCTGTGGAGG - Intergenic
1201438748 Y:13986047-13986069 GGCCGTGACGGCACCTGAGGCGG - Exonic
1201445825 Y:14056661-14056683 GGCCGTGACGGCACCTGAGGCGG + Exonic