ID: 906298530

View in Genome Browser
Species Human (GRCh38)
Location 1:44664035-44664057
Sequence GCCTCAGCACCCTGAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308884
Summary {0: 2, 1: 49, 2: 2684, 3: 99084, 4: 207065}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906298530_906298534 -1 Left 906298530 1:44664035-44664057 CCAGCTCCTCAGGGTGCTGAGGC 0: 2
1: 49
2: 2684
3: 99084
4: 207065
Right 906298534 1:44664057-44664079 CAGGAGGATAGCTTAAGCCCAGG 0: 15
1: 794
2: 10325
3: 41050
4: 160626
906298530_906298535 8 Left 906298530 1:44664035-44664057 CCAGCTCCTCAGGGTGCTGAGGC 0: 2
1: 49
2: 2684
3: 99084
4: 207065
Right 906298535 1:44664066-44664088 AGCTTAAGCCCAGGAGATCAAGG 0: 1
1: 41
2: 763
3: 6244
4: 18030

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906298530 Original CRISPR GCCTCAGCACCCTGAGGAGC TGG (reversed) Intronic
Too many off-targets to display for this crispr