ID: 906301535

View in Genome Browser
Species Human (GRCh38)
Location 1:44685599-44685621
Sequence ATAAGCTATCTGGCCAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 395}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906301535_906301538 29 Left 906301535 1:44685599-44685621 CCATACCTGGCCAGATAGCTTAT 0: 1
1: 0
2: 3
3: 36
4: 395
Right 906301538 1:44685651-44685673 CAGAGTCTCACTCTGTCACCAGG 0: 876
1: 3114
2: 7610
3: 12171
4: 14245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906301535 Original CRISPR ATAAGCTATCTGGCCAGGTA TGG (reversed) Intronic
900781399 1:4620413-4620435 ATCAGCTTTGTGGCCAGGTGCGG + Intergenic
900819024 1:4872018-4872040 AGAAGCTAGCAGGCCAGGGAAGG - Intergenic
900875802 1:5341689-5341711 AGAAGCTTGCTGGCCAGCTAGGG - Intergenic
901017425 1:6240021-6240043 ATCACCAATCTGGCCAGGCATGG - Intergenic
901902515 1:12377527-12377549 ACTAGCAATCTGGCCAGGCACGG + Intronic
902152331 1:14453543-14453565 ATAGTCTATCTGCCCAGGCATGG + Intergenic
903730822 1:25494019-25494041 AGAAACTATCTGGCCGGGCACGG - Intronic
904119787 1:28190258-28190280 AAATGTTATCTGGCCAGGCATGG - Intronic
906301535 1:44685599-44685621 ATAAGCTATCTGGCCAGGTATGG - Intronic
906599366 1:47111062-47111084 GTAAGCTAGCTGGCCATGTCAGG + Intronic
907225744 1:52944729-52944751 ATAAGAAATCTGGCCGGGCATGG + Intronic
907255254 1:53174015-53174037 TGAAGCTATCTAGCCAGGCAGGG - Intergenic
908154185 1:61335550-61335572 ATAAGCTAACTGGCCAGGCGCGG + Intronic
909424784 1:75510516-75510538 ATAGGCTATTTGGCCAGTTGGGG + Intronic
909646577 1:77923283-77923305 TTAAGATACCTGGCCAGGCATGG - Intronic
909841957 1:80338426-80338448 AAAAGCTTCCTGGCCAGGTGCGG + Intergenic
910475599 1:87602910-87602932 ATAAGATAATTGGCCAGGTGCGG + Intergenic
910835456 1:91504397-91504419 AAAAGCTTACTGGCCAGGCATGG - Intronic
911071153 1:93832790-93832812 ATAAGCGAGCTGGGCAGGTGGGG - Intronic
911194332 1:94978349-94978371 ATAAATTATTTGGCCAGGCATGG - Exonic
911660117 1:100491860-100491882 AAAAGGTATCTGGCTAGGCACGG - Intronic
913240978 1:116829030-116829052 ATATTTTATCTGGCCAGGTGCGG - Intergenic
914737692 1:150434062-150434084 ATGAAATATCTGGCCAGGCATGG + Intronic
914782843 1:150801407-150801429 AGAAGAGATGTGGCCAGGTACGG - Intronic
916846776 1:168659153-168659175 ACACAGTATCTGGCCAGGTACGG - Intergenic
917472454 1:175337336-175337358 ATCATATATCTGGCCAGGCAGGG - Intronic
917715303 1:177730107-177730129 ATAAACTATCTGGCTAGTTTTGG - Intergenic
917911445 1:179651306-179651328 AGTAGTTATCTGGCCAGGCACGG + Intronic
918304974 1:183237586-183237608 AAAAGCTCTCTGACCAGGCACGG + Intronic
921123180 1:212154307-212154329 ATAATATATGTGGCCAGGAAGGG + Intergenic
921857279 1:220000688-220000710 ATAAGGGGTCTGGCCAGGCACGG + Intronic
922288745 1:224192761-224192783 AAAAGCTATTTCGCCAGGCACGG + Exonic
922295086 1:224243070-224243092 ATAAAATTACTGGCCAGGTACGG - Intronic
922475124 1:225901682-225901704 AGATGCTAACTGGCCAGGCACGG + Intronic
922599061 1:226835999-226836021 ATAAGGGAGCTGGGCAGGTAGGG - Intergenic
923589164 1:235303211-235303233 ATAAACTCTCTGGCCGGGTGTGG - Intronic
923622757 1:235591492-235591514 AAAGGGTACCTGGCCAGGTAGGG - Intronic
924226959 1:241929795-241929817 AGAAACTTTCAGGCCAGGTATGG + Intergenic
1063287409 10:4705602-4705624 ATAAGTAATGTGGCCAGGCATGG - Intergenic
1065572274 10:27083431-27083453 ATAAATAAACTGGCCAGGTATGG + Intronic
1065993715 10:31036746-31036768 AAAAGATTTCTGGCCAGGCACGG + Intergenic
1066095768 10:32070330-32070352 ATAAAAAATCTGGCCAGGCACGG - Intergenic
1066121999 10:32298085-32298107 ATAATCTAACTGGCCAGGCGCGG - Intronic
1068804913 10:61184705-61184727 AAAAGATAGCTGGCCAGGCATGG + Intergenic
1069433692 10:68360451-68360473 ATAATCTTTCAGGCCAGGTGCGG + Intronic
1070072679 10:73104984-73105006 AAGAGATATCTGGCCAGGCATGG + Intergenic
1070111527 10:73491675-73491697 ATAAGTAATCTGGCTAGGCACGG + Intronic
1070233230 10:74594881-74594903 ATAGGCTATATGGCCGGGTGTGG + Intronic
1070233350 10:74595702-74595724 ATAGGCTATATGGCCGGGTGTGG + Intronic
1070254275 10:74800635-74800657 ATAGCCATTCTGGCCAGGTATGG - Intergenic
1071469046 10:85966521-85966543 AAGAGATATCTGGCCAGATACGG + Intronic
1072868852 10:99094845-99094867 ATAAGGTATTTGGCCTGGTGTGG - Intronic
1073014100 10:100384471-100384493 ATAAGGGAGCTGGGCAGGTAGGG - Intergenic
1073369273 10:102972344-102972366 AGAAGCTTCCTGGCCAGGCACGG + Intronic
1077617406 11:3687222-3687244 ATAAGAAAACAGGCCAGGTATGG - Intronic
1077735847 11:4790049-4790071 AGAAGCAATTAGGCCAGGTACGG + Intronic
1077864077 11:6208882-6208904 ATTAGCTTTCTGGCCAGGCGCGG + Intronic
1078325809 11:10379932-10379954 AGAAGGTATGTGGCCAGGTCAGG + Intronic
1078855500 11:15203342-15203364 ATAAGCAATCTGGCCTGGAGAGG - Intronic
1079891289 11:26056486-26056508 ATAGACTTTCAGGCCAGGTATGG + Intergenic
1080038306 11:27732314-27732336 ATAAGCTCACAGGCCAGGTGCGG - Intergenic
1080994397 11:37581696-37581718 ATAAGGGAGCTGGGCAGGTAGGG + Intergenic
1081159786 11:39737137-39737159 ATAAGGGAACTGGGCAGGTAGGG - Intergenic
1081326535 11:41752666-41752688 AGAATCTTTCTGGCCAGGTGCGG + Intergenic
1083788473 11:64968542-64968564 ATGAGCCATCAGGCCAGGCATGG + Intronic
1085565919 11:77513376-77513398 ATAGTCTTTCTGGCCAGGCATGG + Intergenic
1088514336 11:110613471-110613493 ATAAGATATATGGTCAGGTTGGG - Intronic
1088743210 11:112783955-112783977 AAAATGTAGCTGGCCAGGTACGG - Intergenic
1089234491 11:117011685-117011707 ATAAGGTTTCTGGCCAGGCATGG + Intronic
1090750888 11:129745552-129745574 ATGAGCTATTCGGCCAGGCACGG + Intergenic
1090769364 11:129906259-129906281 ACAAGCTTTCTGCCCAGGTCTGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092521181 12:9274906-9274928 ATATATTATCTGGCCAGGCACGG + Intergenic
1092662512 12:10754467-10754489 ATATGCTATGTGGCCAGGCATGG - Intergenic
1092880166 12:12881943-12881965 AGAAGATATCAGGCCAGGCACGG + Intergenic
1093455316 12:19359671-19359693 ATAAGCTTTCTGGCCGGGCGCGG + Intronic
1093645484 12:21581322-21581344 ATAACATAACTGGCCAGGTCAGG - Intronic
1094643357 12:32297893-32297915 ATAAGAAAACTGGCCAGGCACGG + Intronic
1095258046 12:40063950-40063972 ATAAAATATATGGCCAGGCATGG + Intronic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1095733265 12:45528589-45528611 ATAATTTATTTGGCCAGGCACGG + Intergenic
1095778216 12:46032549-46032571 ATAAGCGAACTGGGCAGGTGGGG - Intergenic
1096204520 12:49709557-49709579 ATAAGCTATGTGGCTATCTAGGG + Intronic
1096317645 12:50582438-50582460 AAAAGCTATTAGGCCAGGTGTGG - Intronic
1096736487 12:53659428-53659450 AAAGCCTATCTGGCCAGGAAAGG + Intronic
1096912039 12:54993916-54993938 ATGAGCAATCTGGCCGGGCATGG - Intergenic
1097061061 12:56284349-56284371 ACAAACTTTGTGGCCAGGTACGG + Intronic
1097069499 12:56344578-56344600 ATAAACTCTCAGGCCAGGCATGG + Intronic
1097206728 12:57328350-57328372 ATAAGACAACTGGCCAGGCATGG - Intronic
1098137308 12:67416281-67416303 AGAAGCAACCTGGCCAGGCACGG - Intergenic
1098335498 12:69400555-69400577 AAAAGGTATATGGCCAGGCATGG + Intergenic
1098516129 12:71378000-71378022 AGAAGCTACCTGGCCAATTAAGG - Intronic
1099176837 12:79431852-79431874 ATAAACTATGGGGCCAGGCATGG - Intronic
1100155738 12:91798394-91798416 AAAAGCTTTCTGGCCAGGCGTGG + Intergenic
1100497654 12:95140932-95140954 ATAATCAATCTGGTCAGGCATGG + Intronic
1101923533 12:108952552-108952574 AATAACTATCTGGCCAGGCACGG + Intronic
1103669059 12:122596548-122596570 AACAGCTTTTTGGCCAGGTATGG + Intronic
1104441055 12:128793454-128793476 ATAAGCACTCTGACTAGGTAAGG + Exonic
1105718340 13:23089511-23089533 ATAAAATATCTGGCAAGGTGTGG - Intergenic
1106250950 13:27981131-27981153 ATTGGATATCTGGCCAGGTGAGG - Intronic
1106427800 13:29649480-29649502 ATAAAATATTTGGCCAGGTGTGG + Intergenic
1106972074 13:35153321-35153343 AGAACCTATGTGGCCAGGCATGG - Intronic
1107254041 13:38401915-38401937 AAAAGGTATCTTGCCAGGTGTGG + Intergenic
1107897578 13:44981519-44981541 ATCAACTATATGGCCAGGCATGG + Intronic
1107923603 13:45235893-45235915 ATAAAGTATCTGGCCATGTGCGG - Intronic
1108003523 13:45925683-45925705 ATAAGAACTCTGGCCAGGTGTGG - Intergenic
1108455151 13:50605663-50605685 ATAATCTATCTGGTCTGGGAAGG - Intronic
1108457449 13:50630482-50630504 ATATGCAAGCTGGCCAGGGATGG + Intronic
1109278100 13:60324205-60324227 ATAAGACATCTGGCCAGGTGTGG - Intergenic
1111582229 13:90237282-90237304 TTAAGCTCTCTGGCCAGGCACGG + Intergenic
1114194749 14:20467696-20467718 ACAATATATCTGGCCAGGTGTGG + Intergenic
1114530379 14:23391704-23391726 AGAAGCTACATGGCCAGGTCTGG - Intronic
1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG + Intergenic
1115982004 14:39063704-39063726 ATATGCTATTTGGCCAGGGGCGG + Intronic
1116884527 14:50206983-50207005 ATATGTTTTCTGGCCAGGCATGG - Intronic
1117756032 14:58975107-58975129 AGAAGCTTTGTGGCCAGGGATGG - Intergenic
1117943446 14:60993136-60993158 AAATGTTATCTGGCCAGGTGCGG - Intronic
1118530249 14:66696575-66696597 ATAAGCTTTCTGACTTGGTATGG - Intronic
1119044179 14:71302927-71302949 ATAAAGAAACTGGCCAGGTATGG - Intergenic
1119236599 14:73025357-73025379 ATGAGATTTCTGGCCAGGTGCGG - Intronic
1119350137 14:73957719-73957741 ATACGCTCTATGGCCAGGCACGG - Intronic
1119440224 14:74623257-74623279 AAAAGGAATCTGGCCAGGCACGG + Intergenic
1119783407 14:77294587-77294609 ATCAGATCTCTGGCCAGGTGCGG - Intronic
1120800003 14:88677193-88677215 ATAGGGAATCTGGCCAGGTGTGG - Intronic
1122381244 14:101308686-101308708 ATAAGAGAACTGGGCAGGTAGGG + Intergenic
1123767910 15:23500218-23500240 ATAAGAAAGCTGGCCAGGTGTGG + Intergenic
1124427782 15:29577095-29577117 ATAATATAGCTGGCCAGGTCTGG - Intergenic
1125642908 15:41246606-41246628 AAAAGCTTTTTGGCCAGGCACGG - Intronic
1126067981 15:44840794-44840816 ATTAACTGTCTGGCCAGGTGTGG + Intergenic
1126091846 15:45059784-45059806 ATTAACTGTCTGGCCAGGTGTGG - Intronic
1126481171 15:49121728-49121750 ATAAGTTTTGTGGCCAGGCAAGG - Intronic
1126832195 15:52619553-52619575 ATAAATTATTTGGCCAGGTGTGG + Intronic
1127426354 15:58862766-58862788 ATAGGATTTCTGGCCAGGTGCGG + Intergenic
1127452961 15:59134397-59134419 TTAAGCCAGTTGGCCAGGTACGG + Exonic
1127574906 15:60282041-60282063 TTAAACTTTCTGGCCAGGCATGG + Intergenic
1127670460 15:61189565-61189587 AACAGATATCTGGCCAGGTGTGG + Intronic
1128483940 15:68066397-68066419 AAAAGCAATCAGGCCAGGCATGG - Intronic
1128573566 15:68753760-68753782 ATGAGTTATCTGGCCGGGCATGG + Intergenic
1128952424 15:71900142-71900164 ATAAGTTTTCTGGCCAGGTGCGG + Intronic
1130180075 15:81618202-81618224 ATAAACTTTATGGCCAGGCACGG + Intergenic
1130845328 15:87738769-87738791 ATGAGCTATCTGGACAAGTGCGG - Intergenic
1130877329 15:88025979-88026001 CTGAGCTATCAGGCCAGGCACGG + Intronic
1131244761 15:90781332-90781354 ATACACTAACTGGCCGGGTATGG + Intronic
1131672613 15:94635812-94635834 ATGAATTATCTGGCCAGGCACGG + Intergenic
1132329194 15:100999454-100999476 TTAAGTTCTCTGGCCAGGTAGGG - Intronic
1132682550 16:1149123-1149145 AGAAGCATTCTGGCCAGGCAGGG + Intergenic
1133949530 16:10379324-10379346 AGAATCAATCTGGCCAGGCATGG + Intronic
1134753474 16:16646003-16646025 ATACTCTTTCTGGCCAGGTGCGG + Intergenic
1134992584 16:18713075-18713097 ATACTCTTTCTGGCCAGGTGCGG - Intergenic
1135209865 16:20516044-20516066 ACAAGCTCTGTGGCCAAGTATGG - Intergenic
1135253481 16:20921379-20921401 AAAAGATTTCTGGCCAGGCACGG - Intronic
1135376182 16:21949393-21949415 ATAAGCTATCAGGCCTGGTGCGG + Intergenic
1135406844 16:22204760-22204782 ATATGCTAATTGGCCAGGTCTGG + Intergenic
1136180626 16:28549241-28549263 ATAATTTTTCTGGCCAGGTGCGG - Intergenic
1136847127 16:33585600-33585622 ATTATCTAACTGGCCAGGCACGG - Intergenic
1139147530 16:64342000-64342022 ATGAGAAATCTGGCCAAGTAGGG - Intergenic
1139463926 16:67143796-67143818 ATAAGGTATGGGGCCAGGCACGG + Intronic
1139814688 16:69659149-69659171 AAAAGGTCTCTGGCCAGGTATGG + Intronic
1139817985 16:69692438-69692460 ATAAATTATCTGGTCTGGTATGG - Exonic
1141400496 16:83742915-83742937 ATAAGCAAACTGGCCAGGTGCGG + Intronic
1141583799 16:85019424-85019446 AGTAGTCATCTGGCCAGGTACGG + Intergenic
1141605134 16:85148548-85148570 ATAAGGAAACTGGCCAGGTGCGG + Intergenic
1203108835 16_KI270728v1_random:1434255-1434277 ATTATCTAACTGGCCAGGCACGG - Intergenic
1143313825 17:6016163-6016185 AAATGCTATGTGGCCAGGTGCGG + Intronic
1143441438 17:6977635-6977657 ATAAAATATCTGGCCAGGTGCGG + Intronic
1143674211 17:8419138-8419160 ATAAGGGATCAGGCCAGGTGTGG - Intronic
1143760715 17:9101835-9101857 ATAAGAAATGTAGCCAGGTATGG + Intronic
1143797059 17:9345438-9345460 ATGAGATATGTGGCCAGGCATGG - Intronic
1143819378 17:9547351-9547373 AAAATATATCTGGCCAGGTGTGG + Intronic
1143965957 17:10756655-10756677 AGGAGATATCTGGCCAGGTTTGG - Intergenic
1144367538 17:14558916-14558938 ATATGATTTTTGGCCAGGTATGG - Intergenic
1144471780 17:15549438-15549460 ATAAGATGCCTGGCCAGGCATGG + Intronic
1144924699 17:18795263-18795285 ATAAGTTGCCTGGCCAGGCATGG - Intronic
1146302735 17:31702805-31702827 TTAAGGTATGTGGCCAGGCACGG - Intergenic
1146431153 17:32796251-32796273 ATAAGCTAACTCCCCAGTTAAGG - Intronic
1146666157 17:34705321-34705343 TTAAGATATCTGGCCAGGTGTGG + Intergenic
1147116927 17:38307633-38307655 AAAAGCTGGGTGGCCAGGTATGG - Intronic
1148334163 17:46830534-46830556 ATATGATTTCTGGCCAGGTGTGG - Intronic
1148388935 17:47256173-47256195 TTAAGATATCTGGTCAGGCACGG + Intronic
1148412746 17:47481964-47481986 AAAAGCTGGGTGGCCAGGTATGG + Intergenic
1148528919 17:48370585-48370607 ATAACCATTCTGGCCAGGTGTGG - Intronic
1148878356 17:50706608-50706630 ATAAGAAAACTGGCCAGGAACGG + Intronic
1148926733 17:51093410-51093432 ATAATAGATCTGGCCAGGCATGG + Intronic
1149401777 17:56303984-56304006 ACATGGAATCTGGCCAGGTATGG - Intronic
1149656706 17:58313320-58313342 ATAAGAAAACTGGCCAGGCATGG + Intronic
1150829372 17:68505520-68505542 ATAATGTATCAGGCCAGGTGAGG + Intergenic
1154227618 18:12521624-12521646 ACACGATATCTGGCCAGGCATGG - Intronic
1155221083 18:23686473-23686495 ATAAGAAATGTGGCCAGGTGTGG - Intergenic
1155326125 18:24666530-24666552 TTTAGCAATTTGGCCAGGTATGG + Intergenic
1155807101 18:30185094-30185116 ATAAAATATCTGGCCAGAGATGG + Intergenic
1155819405 18:30355438-30355460 ATACCATATATGGCCAGGTACGG + Intergenic
1156398901 18:36723279-36723301 ATAAAATTTCTTGCCAGGTAAGG - Intronic
1156780094 18:40840364-40840386 ATAAAGTATCTGGCCAGGCACGG + Intergenic
1157633454 18:49124967-49124989 ATAAGTTATTAGGCCAGGCACGG + Intronic
1157759782 18:50252729-50252751 ATAGGATATCTGGCCAGGCATGG + Intronic
1157830021 18:50848932-50848954 AAAAGACTTCTGGCCAGGTACGG - Intergenic
1158402073 18:57130143-57130165 AGAAGCTAGATGGCCAGGTGTGG + Intergenic
1158464709 18:57679983-57680005 ATAAACTACCTGGCCAGGCATGG + Intronic
1158714369 18:59864617-59864639 ATAATATGTCTGGCCAGGCACGG + Intergenic
1158820325 18:61151564-61151586 ATAAAAAATCTGGCCAGGTGTGG + Intergenic
1159183107 18:64935432-64935454 ATAGGGTATTTTGCCAGGTATGG + Intergenic
1159560642 18:69989296-69989318 AAAAGCTTTCAGGCCAGGTGCGG - Intergenic
1159669053 18:71200395-71200417 ATATGTCATCTGGCCAGGCATGG + Intergenic
1162274109 19:9639525-9639547 ATAAGGGAACTGGGCAGGTAGGG + Intronic
1163076722 19:14899194-14899216 ATCAGCAACCTGGCCCGGTACGG - Intergenic
1163141592 19:15352857-15352879 ATAAAATATCAGGCCAGGTGTGG - Intergenic
1163445699 19:17345160-17345182 AGAAGCCATCAGGCCAGGCACGG - Intergenic
1163473531 19:17511861-17511883 CTAAGCTAGCTGGCCCGGCAGGG - Exonic
1164316654 19:24094547-24094569 AAAAGGCATTTGGCCAGGTAAGG - Intronic
1164318731 19:24118819-24118841 AGAAGTTATCTGGCCTGGAATGG + Intronic
1165033438 19:33015132-33015154 ATTATCTAACTGGCCAGGCACGG + Intronic
1165557943 19:36652199-36652221 ATAAAATTTCTGGCCAGGCACGG + Intronic
1165602858 19:37072487-37072509 AGAATCTATCTGGCTAGGGAAGG - Intronic
1166516791 19:43453217-43453239 ATAAATTTTCTGGCCAGGCACGG + Intergenic
1168518946 19:57033237-57033259 CTAAGATTTCTGGCCAGGCATGG + Intergenic
1168690194 19:58372009-58372031 AAGGGATATCTGGCCAGGTACGG - Intronic
926028324 2:9564021-9564043 ATAAGATAAATGGCCAGGTGCGG - Intergenic
926513844 2:13816198-13816220 ATAAGGTGTCGGGCCAGGCACGG + Intergenic
927752045 2:25677891-25677913 ATAAGTGTTCTGGCCAGGCACGG - Intergenic
927808200 2:26166752-26166774 AAAAGCTGTCTAGCCAGGCATGG - Intergenic
928067184 2:28176277-28176299 AGAAGCTCACTGGCCAGGCACGG + Intronic
928524728 2:32128283-32128305 GTAAGCTATGAGGCCAGGTGTGG - Intronic
928849300 2:35723856-35723878 ATAAGAAATCTGGCCAGATGAGG - Intergenic
930131582 2:47857409-47857431 ATAAAATTTCTGGCCAGGTGTGG - Intronic
930616934 2:53603393-53603415 AAATGCTCTCTGGCCAGGCATGG + Intronic
930749530 2:54919762-54919784 ATAAGCCACCTTGTCAGGTAGGG - Intronic
930769459 2:55117162-55117184 AACAGCTATCTGGCCGGGTGCGG - Intergenic
930798145 2:55414773-55414795 ATAAGGTTCCTGGCCAGGTGTGG + Intronic
932314561 2:70771058-70771080 TTAAACTATCTGGCCATGGAGGG - Intergenic
934141341 2:89050655-89050677 ATAAGGAAACTGGGCAGGTAAGG - Intergenic
934227900 2:90149889-90149911 ATAAGGAAACTGGGCAGGTAAGG + Intergenic
934695045 2:96393688-96393710 AAAAGGGATCTGGCCAGGTGCGG - Intergenic
935664699 2:105500195-105500217 ATACATTATCTGGCCAGGTGCGG - Intergenic
935813958 2:106829124-106829146 ATAAGCTATGTGAACAGGCATGG + Intronic
935960868 2:108424314-108424336 AAAATCTATCTGGCCAGGCATGG + Intergenic
938907728 2:135854580-135854602 AAAGGCTTTTTGGCCAGGTATGG + Intronic
939198719 2:139006685-139006707 ACAAGTTATCTGGCCGGGTGTGG - Intergenic
939410529 2:141818948-141818970 AAAAACTTTCTGGCCAGGTGCGG + Intronic
940799683 2:158119718-158119740 AAAAACTATCTGGCCAGGCATGG + Intronic
941152933 2:161937980-161938002 TTAAAGTATCAGGCCAGGTACGG + Intronic
941204688 2:162557362-162557384 ATAAGCTATTGGGCCAATTAAGG + Intronic
942134894 2:172915408-172915430 ATATGATATCTGACCAGGCATGG + Intronic
942800797 2:179873165-179873187 TTAAGAAATCTGGCCAGGCATGG + Intergenic
943495745 2:188618923-188618945 AAAAGAAATCTGGCCAGGCATGG - Intergenic
944093154 2:195936081-195936103 TTAAGAAATCTGGCCAGGCACGG + Intronic
946769585 2:223075105-223075127 AAAAACTTTCTGGCCAGGAACGG - Intronic
947144672 2:227053834-227053856 AAAAGTTTTCTGGCCAGGTGTGG - Intronic
947423530 2:229961888-229961910 ATTAGGTTTTTGGCCAGGTATGG + Intronic
947429719 2:230016413-230016435 CTAAAATATCTGGCCAGGTGCGG + Intergenic
948045914 2:234945009-234945031 AAAAGATAAATGGCCAGGTATGG - Intergenic
1168943195 20:1730717-1730739 ATAAGGGAGCTGGGCAGGTAGGG + Intergenic
1169716797 20:8628642-8628664 ATAAGCCATTTGGCCGGGCACGG + Intronic
1170529329 20:17274472-17274494 AGAAGCTACCAGGTCAGGTAGGG - Intronic
1170552725 20:17491119-17491141 ACAACCAATCTGCCCAGGTATGG + Intergenic
1170657529 20:18303335-18303357 TTAAGTTTTCTGGCCAGGTGCGG - Intronic
1170826620 20:19801728-19801750 ATTAGGTATCTGCTCAGGTAAGG - Intergenic
1172101934 20:32489836-32489858 ATAAGTTTTCTGGCCTGGCATGG + Intronic
1172220144 20:33268299-33268321 CTAAGAAATCTGGCCAGGCACGG + Intergenic
1172661008 20:36568748-36568770 AAAAACTATCTGGCTAGGTCTGG - Intergenic
1172723401 20:37016634-37016656 AGAAGCAACCTGGCCAGGCATGG + Intronic
1173209392 20:41020372-41020394 AGAAGCTACCTGGCCAGGCACGG + Intergenic
1175318265 20:58067299-58067321 TAAAGCTATCAGGCCAGGGACGG - Intergenic
1175393903 20:58645511-58645533 ATTAGCTATGTGGCCATGCATGG - Intergenic
1176972404 21:15281859-15281881 AGAAGCTAACTGGCCAGTTGTGG - Intergenic
1177229460 21:18300633-18300655 TTAATGTATCTGGCCAGGTGTGG - Intronic
1178401279 21:32286910-32286932 AAAAGCTATGTGGCCGGGTGCGG - Intergenic
1181185151 22:21097997-21098019 GTAAGTTAACAGGCCAGGTATGG + Intergenic
1181538311 22:23558741-23558763 AAAAGGTATCTGGCCAGGTGTGG + Intergenic
1181625253 22:24118652-24118674 GAAAGCTATCTGGCCCGGGAGGG - Intronic
1181946874 22:26524916-26524938 ACAAACTATCTGGCCTGGTATGG - Intergenic
1182028407 22:27138204-27138226 AGGAGCCATCTGGCCAGGCAGGG + Intergenic
1182136643 22:27910384-27910406 ATAATGTTTCTGGCCAGGTGTGG - Intronic
1182733854 22:32516654-32516676 AAAAGGTATCAGGCCAGGTGTGG - Intronic
1183413612 22:37670224-37670246 AGAAAATATCTGGCCAGGCATGG - Intergenic
949966088 3:9357530-9357552 ATAAATTATCAAGCCAGGTATGG - Intronic
951316235 3:21192171-21192193 ATAAGGGAACTGGCCAGGTGGGG + Intergenic
953557851 3:43960946-43960968 ACCAGCTCTCTGGCCAAGTAAGG - Intergenic
954021353 3:47744975-47744997 AACTGCTATCTGGCCAGGCACGG + Intronic
954315768 3:49800765-49800787 TTAAGTTTTCTGGCCAGGCACGG + Intergenic
954485322 3:50844930-50844952 ATTAACTTTCTGGCCAGGCACGG + Intronic
955457531 3:59140191-59140213 ATAAGCTATTTTGCCAGGATAGG + Intergenic
955788174 3:62561558-62561580 AAGAGATATCTGGCCAGGTGTGG - Intronic
959121681 3:102240447-102240469 ATAAGGGATCTTGCCAGGAATGG - Intronic
959329100 3:104979438-104979460 AAAAGATTTCTGGCCAGGCACGG - Intergenic
959700179 3:109291181-109291203 AAAAAATATCTGGCCAGGCACGG - Intergenic
959732474 3:109619648-109619670 ATAAGCTATATTGCCAAGCAAGG - Intergenic
962523825 3:136220542-136220564 ATAAGGGAGCTGGGCAGGTAGGG + Intergenic
962628145 3:137248191-137248213 ACTAGCTATTTGGCCAGGTGTGG + Intergenic
963172459 3:142264745-142264767 TTAAGATATATGGCCAGGCACGG - Intergenic
963178843 3:142332061-142332083 ATAATATAACTGGCCAGGTGTGG - Intronic
963431975 3:145218419-145218441 AAAAACTTTCTGGCCAGGCATGG - Intergenic
965414283 3:168373115-168373137 ATAAGCTGTCTGGCCGGGTGTGG + Intergenic
966845370 3:184124939-184124961 AATAGCTAACTGGCCAGGTACGG - Intergenic
967431512 3:189391417-189391439 AAAAGATATCTGGCCAGGTGTGG - Intergenic
968114347 3:196078366-196078388 AAAAGCTTTCTGGCCAGGCACGG + Intronic
968183651 3:196615920-196615942 ATAACCCATGTGGCCAGGTGCGG - Intergenic
968827907 4:2913136-2913158 ATCAACTATCAGGCCAGGCATGG - Intronic
969753625 4:9132532-9132554 AAAGTCCATCTGGCCAGGTACGG + Intergenic
970042168 4:11809014-11809036 ATAAGGGAACTGGGCAGGTAGGG - Intergenic
971210490 4:24611443-24611465 ATAACCTCACTGGCCAGGTGCGG + Intergenic
972284938 4:37639067-37639089 TTAAGATATCTGGCCAGTCAAGG - Intronic
972495450 4:39629915-39629937 AACTGCTTTCTGGCCAGGTATGG - Intronic
973164855 4:47064342-47064364 AGAAGTTATCAGGCCAGGTGCGG + Intronic
973539170 4:51918625-51918647 TCAAGCTTTCTGGCCCGGTAAGG + Intergenic
975463816 4:74686899-74686921 ATATCCTAGCTGGCCAGGTGCGG - Intergenic
975572081 4:75828051-75828073 AGAAATTATCTGGCCAGGTGCGG + Intergenic
977092486 4:92695254-92695276 TTAAAATATCTGGCCAGGCACGG - Intronic
977314909 4:95433996-95434018 ATAATCTATATGGGCAGGCAGGG - Intronic
977600832 4:98931777-98931799 ATAGGACATCTGGCCAGGAATGG - Intergenic
977925400 4:102694834-102694856 ATAAGCCTTCAGGCCAGGGAGGG - Intronic
980327874 4:131371746-131371768 ATAAGTGTTCTGGCCAGGCACGG - Intergenic
980995941 4:139779743-139779765 AAAAGCAATCTGGCCAGCTGTGG - Intronic
982148368 4:152424155-152424177 AGCAGCTTCCTGGCCAGGTACGG - Intronic
982361178 4:154520701-154520723 ATTAGGTATTTGGCCAGGTGCGG - Intergenic
982497026 4:156106455-156106477 ATAAGGGAACTGGGCAGGTAGGG + Intergenic
982578620 4:157149359-157149381 TTAAGCTATTTCGCCAAGTATGG + Intronic
983183780 4:164678369-164678391 ATAAGCAAACAGGCCAGGCAAGG + Intergenic
983207142 4:164922320-164922342 TTAAGATAACTGGCCAGGTGTGG - Intergenic
983896901 4:173090875-173090897 ATAAGTTATTAGGCCAGGCACGG + Intergenic
984298806 4:177889134-177889156 ATAAGTCATTTGGCCAGGTGTGG + Intronic
984369737 4:178847399-178847421 ATAAGATATCAGGCCGGGTGTGG - Intergenic
984848401 4:184128469-184128491 ATAGGCTAACTGCCCAGGCATGG - Intronic
985521966 5:377947-377969 ACCAGCACTCTGGCCAGGTAGGG - Intronic
986646104 5:9917407-9917429 ATCAGTTATCTGGGCAGGCAAGG + Intergenic
987124663 5:14800879-14800901 ATAAAATAACTAGCCAGGTATGG - Intronic
988002134 5:25362411-25362433 AAAATATATTTGGCCAGGTAAGG - Intergenic
992053524 5:72963839-72963861 ACAGCCTATCTGGCCAGGTGTGG - Intronic
992664004 5:78988048-78988070 ATAAGCGTTCTGGCCAGGCGTGG - Intergenic
992819731 5:80484357-80484379 AAAATCCATCTGGCCAGGCATGG - Intergenic
994742934 5:103643884-103643906 AGAACCTTTCTGGCCAGGCATGG + Intergenic
994981883 5:106885874-106885896 AAAAGATAGCTGGCCAGGTGAGG + Intergenic
996308347 5:122076887-122076909 GAAAACTGTCTGGCCAGGTACGG - Exonic
997146544 5:131440445-131440467 ATAAAGTAAGTGGCCAGGTATGG + Intronic
997393180 5:133533534-133533556 ATAAACTTACTGGCCAGGCATGG - Intronic
997438447 5:133891779-133891801 CTAAGCTACCTGGGCATGTAGGG - Intergenic
997516977 5:134496867-134496889 ATAGGCTTTCTGGCCAGGTAAGG + Intergenic
1000594200 5:163195125-163195147 TTAAGCTTCCTGGCCAGGTATGG + Intergenic
1002030085 5:176421754-176421776 ATGAAAAATCTGGCCAGGTATGG - Intergenic
1004504026 6:16233064-16233086 GTAAGCTGGCTGGCCAGGTGCGG + Intergenic
1004722762 6:18282361-18282383 TTAAGATATCTGGCCAGGCGTGG + Intergenic
1007989587 6:46241183-46241205 ATAAGCTATTTTGCCAGGCTGGG + Intronic
1008759067 6:54832258-54832280 ATAAGATTGCTGGCCAGGCACGG - Intergenic
1011135426 6:84094845-84094867 AAAAATTATCTGGCCAGGTGCGG - Intergenic
1012952609 6:105534752-105534774 AAAAGCTAGTTGGCCAGGCATGG - Intergenic
1014041609 6:116833611-116833633 ATAAGCCAGCTGGGCAAGTACGG - Intergenic
1014797211 6:125739850-125739872 ATCAGCTATATCGCCAGGCATGG + Intergenic
1015410101 6:132884792-132884814 AAAAGCAAACAGGCCAGGTATGG + Intergenic
1016830430 6:148428336-148428358 ATAAACTATCAGGCCGGGTGCGG + Intronic
1016954314 6:149611707-149611729 ATAAGGAATATGGCCAGGCATGG + Intronic
1017435659 6:154413518-154413540 AAAACCTATGTGGCCAGGTATGG - Intronic
1017747466 6:157459782-157459804 AAAAGTCATCTGGCCAGGCATGG + Intronic
1017779258 6:157703630-157703652 ATAAGGTAACTGGGCAGGTGGGG + Intronic
1018454890 6:163943170-163943192 AAAAAATATCTGGCCAGGTACGG + Intergenic
1019729120 7:2620719-2620741 AAAAGATATCTGGCCAGGCATGG + Intergenic
1019842702 7:3464231-3464253 ATAAGGTATTGGGCCAGGCATGG + Intronic
1019967378 7:4510828-4510850 AAAAGCAATCTGGCCGGGCATGG - Intergenic
1020545328 7:9521963-9521985 AGAGGCTATTTGGCCAGGCATGG + Intergenic
1021685950 7:23186028-23186050 ATAAGATATGTGGCTGGGTATGG - Intronic
1022060417 7:26787615-26787637 AAAAGCTTCCTGGCCAGGTGTGG - Intronic
1023973300 7:45007975-45007997 ATGAGCTCTCTGGTCAGGTGTGG + Intronic
1026403368 7:70039047-70039069 ATAAGAAACCTGGCCAGGTGTGG - Intronic
1027176742 7:75908768-75908790 ATATGTTTTCTGGCCAGGTAAGG - Intronic
1027213328 7:76167249-76167271 ATAAGCGATCGGGCCGGGCACGG + Intergenic
1028075878 7:86514737-86514759 ACCAGCTATCAGGCCAGGTATGG + Intergenic
1028420576 7:90628245-90628267 ATCACCTTTCTGGCCAGGCACGG - Intronic
1028490028 7:91400853-91400875 ATCAGCCATCTGGCCAGGCGTGG + Intergenic
1028546325 7:92005957-92005979 TTAAGCAATTTGGCCAGGCATGG - Intronic
1028616263 7:92770944-92770966 TTAAAATATCTGGCCAGGCATGG + Intronic
1029253969 7:99256481-99256503 ATAAAATAACTGGCCAGGCATGG + Intergenic
1029271390 7:99379065-99379087 ATTAGCATTCTGGCCAGGTGTGG - Intronic
1029582275 7:101445129-101445151 ATAAAGTACCTGGCCAGGCATGG - Intronic
1032249960 7:130247507-130247529 CTAAGAAATCTGGCCAGGCAGGG - Intergenic
1033088641 7:138365281-138365303 ATAAGGGAGCTGGGCAGGTAGGG - Intergenic
1033625666 7:143107548-143107570 ATAAGGGAGCTGGGCAGGTAGGG - Intergenic
1036097228 8:5737621-5737643 ATAAATTATTTGGCCAGGCACGG - Intergenic
1036948853 8:13121842-13121864 AAAAGCTCCCTGGCCAGGCACGG - Intronic
1037593862 8:20337421-20337443 AGAAACTATCTGGCCAGGTGTGG + Intergenic
1038161373 8:25042257-25042279 ATTAGCTTCCTGGCCAGGAACGG + Intergenic
1039710401 8:40050355-40050377 AGAAGCTTTATGGCCAGGTGCGG - Intergenic
1039872327 8:41556957-41556979 AAAAGCTATAGGGCCAGGCATGG - Intergenic
1041022611 8:53653554-53653576 AAGAGATATGTGGCCAGGTACGG + Intergenic
1041516572 8:58705937-58705959 ATAGGCAATCTGGCCAGGCGCGG - Intergenic
1043377776 8:79669388-79669410 AAAAATTAGCTGGCCAGGTATGG + Intergenic
1043445891 8:80318857-80318879 ATAATTTATCTGGCCAGGTACGG - Intergenic
1045228399 8:100274673-100274695 TAAAGGTATCTGTCCAGGTATGG - Intronic
1045278497 8:100728209-100728231 ATAAAGTATTTGGCCAGGCACGG + Intergenic
1045321302 8:101083667-101083689 AGAAGCCTTCTGGCCAGGTGAGG - Intergenic
1046654526 8:116878503-116878525 ATAAGATATCAAGCAAGGTATGG + Intergenic
1046960042 8:120101932-120101954 ATAACCAAACTGGCCAGGCACGG - Intronic
1047389890 8:124441742-124441764 ATAAGGGAGCTGGCCAGGCATGG + Intergenic
1051866338 9:21687410-21687432 ATGAGCTATGTGGCTATGTAGGG + Intergenic
1053169204 9:35866789-35866811 ATAAGATTCCTGGCCAGGCATGG + Intergenic
1053186945 9:36024347-36024369 TTAGGCTTTCTGGCCAGGCATGG + Intergenic
1053545063 9:39014252-39014274 ATCTGCTATCTGGCCAGGCACGG - Intergenic
1053577717 9:39369863-39369885 ATTAGAAATCTGGCCAGGCACGG + Intergenic
1053842223 9:42197808-42197830 ATTAGAAATCTGGCCAGGCACGG + Intergenic
1054099293 9:60928580-60928602 ATTAGAAATCTGGCCAGGCACGG + Intergenic
1054120690 9:61204204-61204226 ATTAGAAATCTGGCCAGGCACGG + Intergenic
1054587057 9:66978348-66978370 ATTAGAAATCTGGCCAGGCACGG - Intergenic
1055019195 9:71650708-71650730 TTAAGATTTGTGGCCAGGTATGG + Intergenic
1056019235 9:82424134-82424156 ATAAAGTATCTGTCAAGGTATGG - Intergenic
1057810105 9:98250994-98251016 ATAATTGATCTGGCCAGGCATGG + Intronic
1058546037 9:106060807-106060829 ATAGGATATTTGGCCAGGTGTGG - Intergenic
1058688176 9:107496463-107496485 ATAAGCAACCTGGCCGGGTGTGG - Intergenic
1058852168 9:109023542-109023564 ATAAGCAATGTGGCCAGGCGCGG + Intronic
1059742941 9:117170862-117170884 ATACGATACCTGGCAAGGTATGG - Intronic
1060111314 9:120908848-120908870 AAAAACCATCTGGCCAGGCATGG - Intronic
1060490562 9:124081119-124081141 ATAAGATATGAGGCCAGGTGCGG + Intergenic
1061392278 9:130323990-130324012 AAAAGCTTTCAGGCCAGGCACGG - Intronic
1185578004 X:1189253-1189275 ATAAGGTTGCTGGCCAGGCACGG + Intronic
1185981018 X:4778296-4778318 ACAAGCTTTCTGACCAGGCACGG - Intergenic
1186822484 X:13304606-13304628 ATAAAGAATTTGGCCAGGTATGG - Intergenic
1187457828 X:19458386-19458408 ATCAGCTAGCTGGCCAGGCACGG + Intronic
1187556857 X:20359853-20359875 ATAACCTAAATGGCCAGGAATGG - Intergenic
1187673886 X:21696736-21696758 ATAAACTGCCTGGCCAGTTAAGG + Intergenic
1188546177 X:31309939-31309961 ATAAGCTATCTAGCCAGGCCAGG + Intronic
1189809079 X:44764274-44764296 GTAAGCTTTCTGGCCAGGCATGG + Intergenic
1190113041 X:47607585-47607607 AACACCTATCTGGCCAGGTACGG + Intronic
1190396022 X:49984905-49984927 ATAAGCAATATTGCCAGGCACGG - Intronic
1190474087 X:50811019-50811041 ATTAGCTATTTGGCCAGGAGTGG + Intronic
1191857544 X:65639433-65639455 ATGAGCTTTCAGGCCAGGCACGG - Intronic
1191867508 X:65716885-65716907 AGCAGCTATTTGACCAGGTAAGG + Exonic
1192423802 X:71057825-71057847 ATTAAAAATCTGGCCAGGTATGG - Intronic
1193639620 X:83995948-83995970 GTAAAGTATCTGGCCAGGAATGG - Intergenic
1193967412 X:88005810-88005832 ATCAGATATCGGGCCAGGCATGG + Intergenic
1194757751 X:97757938-97757960 ATTGGGTATCTGGCCAGGTGCGG + Intergenic
1195272363 X:103244288-103244310 ATAATGCATCTGGCCAGGCATGG - Intergenic
1195427675 X:104753043-104753065 ATAAGGACTCTGGCCAGGAAGGG - Intronic
1196699887 X:118656671-118656693 ATTAGAAATCTGGCCAGGCATGG + Intronic
1197935948 X:131740558-131740580 ACAAGTTATTTGGCCAGGCACGG - Intergenic
1198370212 X:135982762-135982784 AGAAGCTAATTGGCCAGGCATGG - Intergenic
1198782025 X:140248091-140248113 AAAAGCTCTCTGGCCGGGCATGG + Intergenic
1199813795 X:151378230-151378252 ATAAAATATTTAGCCAGGTACGG + Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1200802522 Y:7399505-7399527 ATAAGCTAACCAGCCAGCTATGG + Intergenic