ID: 906301812

View in Genome Browser
Species Human (GRCh38)
Location 1:44687955-44687977
Sequence GGTCCATTTAAGGCAGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906301812 Original CRISPR GGTCCATTTAAGGCAGGGCA AGG Intronic
900930735 1:5735376-5735398 GGGCCAGTGAAGGCAGGGAAGGG - Intergenic
901288991 1:8107367-8107389 GGGACATTTAAAGCTGGGCATGG + Intergenic
902731030 1:18368987-18369009 GCTCCAGTTAAGGGAGGGCCTGG - Intronic
902779309 1:18694044-18694066 GCTCCCTCTAGGGCAGGGCAGGG + Intronic
904144680 1:28380344-28380366 GTTACATTTAAGGCCGGGCGCGG - Intronic
904438601 1:30515332-30515354 GGTGCATTTGAGGAAGAGCAAGG - Intergenic
905472518 1:38204285-38204307 GTTCCAGTTAAGGCAGGAGATGG + Intergenic
905905593 1:41616158-41616180 AGTCCATTTCAGACAGGTCATGG + Intronic
905986446 1:42287668-42287690 ATTCCATTTAGGGCCGGGCATGG + Intronic
906301812 1:44687955-44687977 GGTCCATTTAAGGCAGGGCAAGG + Intronic
907409694 1:54275246-54275268 GGTGAAGTGAAGGCAGGGCAAGG - Intronic
907948509 1:59157528-59157550 AGTGTATTTAAGGCTGGGCATGG + Intergenic
909289636 1:73866273-73866295 AGTCTCTTTTAGGCAGGGCATGG + Intergenic
913239462 1:116817234-116817256 TGTCAATTTGAGGCCGGGCACGG - Intergenic
919838534 1:201593041-201593063 GGGCAATCTAAGGCAGGGCTTGG - Intergenic
919942218 1:202296117-202296139 TGTCCATCCAAGCCAGGGCAGGG - Intronic
920739440 1:208566519-208566541 AGTCCATTCTAGGCAAGGCAAGG - Intergenic
921099640 1:211917294-211917316 GGTACATTTTAGGAAGGGCACGG + Intergenic
922470576 1:225874700-225874722 GGGCCACTGAAGGCAGAGCAGGG - Intronic
923340976 1:233006779-233006801 GTTCCATTTATGGCAGTGCGTGG - Intronic
923892714 1:238234036-238234058 GGGAAATGTAAGGCAGGGCAGGG - Intergenic
924058946 1:240152059-240152081 AGTCCATTGGAGGCCGGGCATGG - Intronic
924110070 1:240690321-240690343 AATACATTTGAGGCAGGGCACGG + Intergenic
1063014427 10:2061647-2061669 AGTCCATTAAAGTCAGGGCAAGG + Intergenic
1065537191 10:26726769-26726791 AATCCATTTTAGGCCGGGCACGG + Intronic
1065977305 10:30853704-30853726 GCTCCATTTATGGCCAGGCATGG + Intronic
1066072585 10:31834908-31834930 AAAACATTTAAGGCAGGGCACGG + Intronic
1067412789 10:46079451-46079473 TGTCCACTTCAGGCCGGGCACGG + Intergenic
1068380348 10:56246222-56246244 GATCCATTTCTGGCTGGGCACGG - Intergenic
1069927305 10:71859722-71859744 AATCCATTTAAGGCCAGGCACGG + Intergenic
1070373877 10:75810374-75810396 TGTCCAGTTGAGGGAGGGCAGGG + Intronic
1070611364 10:77935144-77935166 CACCCATTTAAGGCTGGGCACGG - Intergenic
1075072352 10:119327485-119327507 AGTCCACTGAAGGCTGGGCACGG + Intronic
1076425000 10:130361470-130361492 TGTCCATGTAAGGGAGGGGAAGG + Intergenic
1077473390 11:2775330-2775352 GGGCCATGTGAGGCAGGGCAGGG - Intronic
1080279338 11:30538799-30538821 GATCGATTCAAGGCAGGGGATGG + Intronic
1080862031 11:36158297-36158319 GGTGCATTTGAGGAAGAGCAAGG - Intronic
1082892689 11:58157128-58157150 GGAGCCTTTAAGCCAGGGCAGGG - Intronic
1083178694 11:60970723-60970745 GGACCAATTGAGGCAGGGCCAGG + Intergenic
1084153523 11:67302101-67302123 GGGCCCTTCCAGGCAGGGCAGGG - Exonic
1085024665 11:73229513-73229535 TGTCCCTCTAAGGCAGGGCTAGG + Intronic
1085527044 11:77170357-77170379 GGTGCACCTCAGGCAGGGCAAGG + Intronic
1088978508 11:114838857-114838879 GGTCCAGTGAATGCAGAGCAAGG + Intergenic
1090392614 11:126398838-126398860 GGCCCATTTAAGCCATGGCTGGG + Intronic
1093379795 12:18478685-18478707 GTTATATTTAAGGCTGGGCATGG + Intronic
1094826571 12:34273863-34273885 TCATCATTTAAGGCAGGGCAGGG - Intergenic
1097171480 12:57116572-57116594 GATTCATTTCAGGCTGGGCACGG - Intronic
1098009975 12:66040570-66040592 AGAGCATTTCAGGCAGGGCAGGG + Intergenic
1101117538 12:101546910-101546932 TGTACAGTTAAGGCTGGGCATGG - Intergenic
1102931109 12:116863026-116863048 TGTCCTTTTAAGTCTGGGCACGG - Intronic
1103512691 12:121486065-121486087 TTACCATTTCAGGCAGGGCATGG - Intronic
1103806532 12:123577954-123577976 TATACATTTAAGGCTGGGCATGG + Intergenic
1104453453 12:128890062-128890084 GGCCCATTTCAGGCTGGGCACGG - Intronic
1104846362 12:131849191-131849213 AGTGTATTTAACGCAGGGCACGG + Intronic
1105314651 13:19246097-19246119 GGTCAATTTTAGGCATGGCAAGG - Intergenic
1108985714 13:56584626-56584648 AGTACATTTTAGGCCGGGCACGG - Intergenic
1111666339 13:91273402-91273424 AATGCATTTAAGGCCGGGCACGG + Intergenic
1113282798 13:108808601-108808623 CTTCCATTTCTGGCAGGGCATGG - Intronic
1115696844 14:35908780-35908802 TTTCCATTTGAGGCCGGGCACGG + Intronic
1116015715 14:39404614-39404636 GATCCATTTAAAGCCGGGCACGG - Intronic
1117109347 14:52433886-52433908 AGTCCAGTTTAGGCTGGGCATGG + Intronic
1119568134 14:75646220-75646242 GGTGCATTTATGGCAGGGGCTGG + Intronic
1120134018 14:80843218-80843240 GGTCCATTTAAAGCAGACAAAGG - Intronic
1124247900 15:28086170-28086192 GGTCCCTTTTCTGCAGGGCAGGG - Intronic
1127616788 15:60694212-60694234 GGTCCCTGTAAGGCAGAGCTGGG + Intronic
1129439159 15:75567306-75567328 GGGCTATTTAAGGCTGGGCGCGG - Intronic
1132461117 16:55343-55365 GCTCCATTTTACGAAGGGCAAGG - Intronic
1132734127 16:1377309-1377331 GTTGCATTTGAGGCTGGGCATGG - Intronic
1134307380 16:13045339-13045361 GGTCAGTTTATGGCAGAGCAAGG + Intronic
1134752476 16:16637055-16637077 GGTTTTTTTAAGGCTGGGCAAGG + Intergenic
1134862820 16:17575670-17575692 GATCCATGTCAGGCTGGGCAGGG - Intergenic
1136694181 16:32062196-32062218 TCTCCATTTCAGGGAGGGCAGGG - Intergenic
1136794678 16:33005460-33005482 TCTCCATTTCAGGGAGGGCAGGG - Intergenic
1136875232 16:33848932-33848954 TCTCCATTTCAGGGAGGGCAGGG + Intergenic
1137974191 16:53017068-53017090 GATCCAGTGAAGGCTGGGCATGG + Intergenic
1138589872 16:57993876-57993898 TGTCCTTTTAACTCAGGGCAAGG + Intergenic
1139543412 16:67635914-67635936 AATCAATTTAAGGCTGGGCACGG - Intronic
1140148523 16:72337071-72337093 AGTCCATTTTAGGCTGGGCGCGG + Intergenic
1140680627 16:77381417-77381439 GGTCCTTTTGAAGCAGGGAAAGG - Intronic
1140839076 16:78822164-78822186 AGTTTATTTAAGGCTGGGCATGG - Intronic
1203096941 16_KI270728v1_random:1267110-1267132 TCTCCATTTCAGGGAGGGCAGGG - Intergenic
1143124352 17:4632050-4632072 AGTCCAGCTAAGGAAGGGCAGGG + Exonic
1144038061 17:11385108-11385130 GGAGCAATTAAGGCAGGGAATGG + Intronic
1146456121 17:33011150-33011172 GGTTCTTTAAAGGCTGGGCATGG + Intergenic
1148956233 17:51355848-51355870 GGTCAGTTACAGGCAGGGCAGGG - Intergenic
1150781362 17:68125264-68125286 GGTCCAGTTAAAGCACTGCAGGG - Intergenic
1151385426 17:73752546-73752568 GTTCCATCTTAGGGAGGGCAGGG - Intergenic
1152095928 17:78271599-78271621 GGTCCAGATAAGGCATGACAAGG + Intergenic
1153927808 18:9849816-9849838 GGTGCTTTTAAGGAAGAGCAAGG + Intronic
1155105135 18:22656602-22656624 GTTTCATTTCAGGCTGGGCACGG + Intergenic
1155833336 18:30545785-30545807 AGTCCATTGAAGGCAGGTTATGG - Intergenic
1157252354 18:46106178-46106200 AGTGCATTCAAGGCCGGGCACGG + Intronic
1157657429 18:49404727-49404749 TGTCCATTCACGGCTGGGCATGG + Intronic
1157860727 18:51138092-51138114 GTTCCATTCAAGGCAGGGATGGG + Intergenic
1159919284 18:74213139-74213161 GGTAAATTTTAGGCTGGGCATGG - Intergenic
1162465027 19:10834769-10834791 AGTTCATTTCAGGCCGGGCACGG - Intronic
1163523292 19:17805061-17805083 GGGACATTTCAGTCAGGGCAGGG - Intronic
1164304999 19:23998303-23998325 GGTCGACCTAAGACAGGGCAGGG + Intergenic
1164386267 19:27773237-27773259 GGTCTACTTAAGGCATGGCAAGG - Intergenic
1164386292 19:27773413-27773435 GGTCTAGTTTAGGCATGGCAAGG - Intergenic
1164632449 19:29770373-29770395 GGTTAAAATAAGGCAGGGCATGG - Intergenic
1165320674 19:35083483-35083505 AGTCAATTTCAGGCTGGGCACGG - Intergenic
1165988807 19:39793864-39793886 TATCTATTGAAGGCAGGGCACGG + Intergenic
1166017723 19:39995649-39995671 TGTCAATATAAGGCTGGGCACGG - Intronic
1167837110 19:52082788-52082810 TGTACATTTCAGGCTGGGCACGG + Intronic
1167976017 19:53226431-53226453 GATCCATTAAAGGCAGAGTAGGG + Intergenic
1168076077 19:53981629-53981651 GGACCATTCAGGGCAGGGCCTGG + Intronic
926015991 2:9452004-9452026 GTTTCATTTATGGCCGGGCATGG - Intronic
927129063 2:20041824-20041846 GGTAGATTTAAGGCCGGGCGTGG - Intronic
929153627 2:38770398-38770420 GGTTTATTTTAGGCCGGGCATGG + Intronic
931320473 2:61170848-61170870 GGTAAATTTAAGGCCGGGCACGG + Intergenic
931528978 2:63191100-63191122 GGGACATTTAGGGCTGGGCATGG + Intronic
933346216 2:81088919-81088941 GTTCCATTCAGGGCCGGGCATGG + Intergenic
936089319 2:109490756-109490778 TGTCCATCCACGGCAGGGCAGGG + Exonic
939370843 2:141298313-141298335 TGTCTATTTAAGGCAGGGGCTGG + Intronic
941485740 2:166079326-166079348 GGGCCATTTAAGGAAGTACAGGG - Intronic
942119336 2:172761430-172761452 GTTCCACTTCAGGCCGGGCACGG - Intronic
944387947 2:199185336-199185358 TCACCAGTTAAGGCAGGGCAGGG - Intergenic
944881986 2:204022644-204022666 TGTCCCTTTAAGTCTGGGCAAGG - Intergenic
945526468 2:210894121-210894143 GCTCCATTTATGTCAGTGCAAGG - Intergenic
947586297 2:231358961-231358983 GGTCCATTTCAGACAGGGCTGGG - Intronic
1169601200 20:7262788-7262810 AGTCCATATATGGCAGGGCATGG - Intergenic
1172565111 20:35924044-35924066 GGTAACTTTTAGGCAGGGCAGGG - Intronic
1173108469 20:40161585-40161607 AGTCCATTTAAAGTAGGACAGGG + Intergenic
1173128567 20:40364537-40364559 GGTCCTTTGAAGGCATGGCTTGG - Intergenic
1175383791 20:58581298-58581320 GATCCAATTAAGGCCAGGCATGG - Intergenic
1175573955 20:60046541-60046563 GATAGATTTGAGGCAGGGCATGG + Intergenic
1175919534 20:62444189-62444211 GGTCAACTCAAGGCAGGGCTGGG + Intergenic
1181181468 22:21071415-21071437 GGTCCATTTAGGGAAGGGTAAGG + Intergenic
1181319293 22:21992113-21992135 CTTCCATTTAAGCCAGGGCTGGG + Intergenic
1181588014 22:23864678-23864700 GGTCCATCCCAGGCCGGGCAGGG + Intronic
1181629104 22:24141195-24141217 GCTCCATTCAAGCCAGGGCAGGG - Intronic
1181961666 22:26626109-26626131 GGTGTATTTTAGGCTGGGCATGG + Intronic
1182495917 22:30707385-30707407 GCTTCACTTAAGGCCGGGCACGG - Intronic
1182828458 22:33285333-33285355 TGTCCATTGAAGGCCAGGCATGG + Intronic
1182921632 22:34085386-34085408 TGTGCATTCAAGGAAGGGCAAGG - Intergenic
1183360221 22:37379462-37379484 GGTCCAGTCAGGCCAGGGCACGG - Intronic
1184230651 22:43156679-43156701 GGTTAATTTTAGGCTGGGCACGG + Intronic
1184945628 22:47801922-47801944 GGTGCAGACAAGGCAGGGCAGGG - Intergenic
1185130206 22:49034736-49034758 GGTCCCTCTCAGGCAGGCCATGG + Intergenic
950376579 3:12577227-12577249 GGAACATTTGAGGCCGGGCACGG - Intronic
952050465 3:29378180-29378202 TGTCTATTTCAGGCCGGGCACGG + Intronic
953288113 3:41633025-41633047 GGTCCATTAAAGGCAGTGAAAGG + Intronic
953442465 3:42930131-42930153 GTTCCATTTATGGCCAGGCATGG + Intronic
954137019 3:48586581-48586603 GGTCCATGTAGGGCATGTCACGG + Exonic
954276877 3:49547987-49548009 ATTCCTTTTAAGGCTGGGCAAGG - Intergenic
956615328 3:71165619-71165641 GGCAAATTTAAGGCAAGGCAAGG - Intronic
961750993 3:129094805-129094827 GTTACATTCAAGGCCGGGCACGG - Intronic
965577518 3:170232829-170232851 GGTCCAGTTTTGGCTGGGCAAGG - Intronic
968627612 4:1634245-1634267 GGTCCAGTGGAGACAGGGCAGGG + Intronic
969105562 4:4804787-4804809 CCTCCATTGGAGGCAGGGCAGGG + Intergenic
969695376 4:8731312-8731334 GGTCCACTTCTGGCTGGGCATGG - Intergenic
970065514 4:12089432-12089454 GGTCCATCTAAGCCTTGGCATGG - Intergenic
970598390 4:17620621-17620643 GGCACATATAAGGCCGGGCACGG - Intronic
971395281 4:26221378-26221400 GATCTATTTAAGGCCGGGCACGG - Intronic
975148505 4:70995294-70995316 AGTAAATTTGAGGCAGGGCATGG + Intronic
978575484 4:110185899-110185921 GATTTATTTAAGGCTGGGCACGG + Intronic
979539027 4:121858094-121858116 GGTTCATTTTAGGCCAGGCATGG - Intronic
979620050 4:122788555-122788577 AGTGCCTTTAAGGCTGGGCATGG + Intergenic
981074440 4:140577338-140577360 GGACCATAAAAGGCAAGGCAGGG + Intergenic
982496549 4:156101266-156101288 TGTCCTTTTAATGCAGAGCAAGG - Intergenic
985773873 5:1830303-1830325 TGTCCATTTAAACCAGGGAAGGG + Intergenic
986848189 5:11780126-11780148 AGTACATTGAAGGCAGGGCCAGG + Intronic
989829537 5:45898021-45898043 AGTCTATTAAAGGCTGGGCATGG + Intergenic
990569173 5:57060585-57060607 GGTCATTTTGAGGCAGGGCATGG - Intergenic
991906668 5:71520896-71520918 GGTGCATTGAAGGCCGGGCATGG + Intronic
992110607 5:73488996-73489018 GGTTCATATCAGGCAGGGCTAGG + Intergenic
992400815 5:76409535-76409557 AGCCCATGTAAGGCTGGGCATGG - Intronic
992856211 5:80864031-80864053 GGGCAATTTAAGGCGTGGCAAGG + Intronic
993951593 5:94182548-94182570 GGGACATTTACGGCTGGGCATGG - Intronic
995883401 5:116867350-116867372 GGTTTATTTGAGGCAGGGAATGG - Intergenic
996078243 5:119223345-119223367 AGACAACTTAAGGCAGGGCACGG - Intronic
996285579 5:121787401-121787423 GTTCCATTCCAGGCAGAGCATGG + Intergenic
997328030 5:133038155-133038177 GTTCCATGTATGGCTGGGCATGG + Intergenic
997535069 5:134614014-134614036 TTTCCATTTCAGGCTGGGCATGG + Intronic
998022965 5:138786916-138786938 GGACCACTGAAGCCAGGGCAGGG - Intronic
999021827 5:148174288-148174310 GGTTGATATAAGCCAGGGCAGGG - Exonic
1000011330 5:157236081-157236103 GTTCCTTTTAAGGCCAGGCACGG + Intronic
1001135069 5:169095689-169095711 GGCCCATTGAAGGCAGGAGAAGG - Intronic
1002443719 5:179277129-179277151 GGTCCATCTGAAGCAGGGCCTGG + Intronic
1003546273 6:7061612-7061634 GTTCCATTTTAGGCCGGGCACGG - Intergenic
1003569226 6:7245561-7245583 AGTCCTTTTAAGGGATGGCACGG - Intronic
1004001622 6:11601805-11601827 TGTGCCTTTAAGGCCGGGCACGG - Intergenic
1006698748 6:35954652-35954674 GGTTCATTTTAGGCTGGGCATGG + Intronic
1009401707 6:63263926-63263948 AGTCCATTTAAATCAGGGGATGG + Intergenic
1010525603 6:76896752-76896774 GATCCATTTAGGTCAGGGGAAGG - Intergenic
1012756436 6:103237922-103237944 GGTGCATATAAAGCTGGGCAAGG - Intergenic
1015239342 6:131006369-131006391 AGTTCACTTAAGGCTGGGCACGG + Intronic
1015763562 6:136691318-136691340 GGACCACTCAAGGCTGGGCACGG + Intronic
1016050824 6:139528282-139528304 GGTGACTTTAAGGCAGAGCAAGG - Intergenic
1016932712 6:149426122-149426144 AGTCCATTTCAGGGTGGGCATGG - Intergenic
1017093443 6:150782066-150782088 GGATCTTTTAAGGCCGGGCATGG - Intronic
1017520306 6:155195961-155195983 GGTCCATTTATTGGAGGGAAGGG + Intronic
1018489117 6:164273485-164273507 GGTCCATTTCAGGCAGCCAAAGG + Intergenic
1019348844 7:543651-543673 GGTCCATATCGGGCAGGGCTGGG + Intergenic
1022550980 7:31238397-31238419 GATCCATTTGAGCCAGGCCATGG - Intergenic
1023934371 7:44728962-44728984 ATTCCATTTTTGGCAGGGCATGG + Intergenic
1026582711 7:71631600-71631622 GGTCCAGTTGAGGAAGAGCAAGG + Intronic
1026839472 7:73661581-73661603 GGCTCATTTGGGGCAGGGCACGG - Intergenic
1027249860 7:76392256-76392278 GGTCAAAGTAAGGCCGGGCATGG + Intronic
1028168670 7:87569040-87569062 TCTCCATTTTCGGCAGGGCATGG + Intronic
1032234208 7:130105857-130105879 TGTACATTTAAGGCCGGGCGCGG + Intronic
1034159406 7:148982029-148982051 AATCAATTTAAGGCCGGGCATGG + Intergenic
1034351602 7:150418795-150418817 GTTCAATTTAAGGCCAGGCATGG + Intergenic
1035541161 8:439306-439328 GGTCCATGCAGGGCAGTGCACGG + Intronic
1038131078 8:24732301-24732323 AGCCCATTTAAGGTAGGACAAGG + Intergenic
1038556500 8:28523058-28523080 GTTCCCTTTGAGGCTGGGCACGG - Intronic
1038779325 8:30557024-30557046 AGCTCATTTAAGGCAGGGCTGGG - Intronic
1040100683 8:43500485-43500507 GAAACATTTAAGGCTGGGCACGG + Intergenic
1040901725 8:52424082-52424104 GGTACACTTTAGCCAGGGCAAGG + Intronic
1041269974 8:56102108-56102130 GGTCAGTTTAAGGCTGGGCGCGG - Intergenic
1043970541 8:86523876-86523898 GATCCACTTCAGGCCGGGCACGG - Intronic
1044389819 8:91636701-91636723 GATCCATTTACGTCAGGGAAAGG - Intergenic
1046136400 8:110032975-110032997 GGTCCCTTTGAGGAAGAGCAAGG - Intergenic
1046247226 8:111580544-111580566 GATGTATTTAAGGCTGGGCACGG + Intergenic
1046500289 8:115067716-115067738 GCTACATTTGAGGCTGGGCAGGG - Intergenic
1047410323 8:124619371-124619393 GGTCCCTTGGAGGCAGAGCATGG - Intronic
1051991662 9:23160194-23160216 GGTCCTTTTAAGGCAGGACATGG - Intergenic
1052079089 9:24180683-24180705 GGTCCATTTTAGTCATGGCTAGG + Intergenic
1053584067 9:39437776-39437798 GCTCCATTTCATGCATGGCAGGG + Intergenic
1054105648 9:60996520-60996542 GCTCCATTTCATGCATGGCAGGG + Intergenic
1054909169 9:70438227-70438249 AGTGCATTCTAGGCAGGGCACGG - Intergenic
1056446027 9:86666919-86666941 GGACCTTATAATGCAGGGCACGG + Intergenic
1060440948 9:123638749-123638771 GGTGCATGTGAGGCTGGGCATGG - Intronic
1060603763 9:124896121-124896143 GCTCCATCTCAGGCAGGGCATGG + Intronic
1060733211 9:126050711-126050733 GGTCCACAGAAGGCAGGGGAGGG - Intergenic
1062416513 9:136453855-136453877 TGGCCATTTGGGGCAGGGCATGG - Intronic
1185810795 X:3108724-3108746 GATCCTTTTTAGGCATGGCACGG + Intronic
1186193775 X:7091629-7091651 AGTCCATTTAAGGCCGGGCGCGG - Intronic
1187438276 X:19292625-19292647 GGTCCAATTTATGCAGAGCAAGG - Intergenic
1187643425 X:21319439-21319461 GGCCCATTTTAGCCAGGGCTGGG + Intergenic
1189738119 X:44092018-44092040 GCTACATTTATGGCTGGGCATGG - Intergenic
1194450694 X:94041644-94041666 GGCCCCTTTTAGGCATGGCAGGG - Intergenic
1200055365 X:153457259-153457281 GCTCCATCTAAGCCAGGCCAAGG + Intronic
1200699615 Y:6390935-6390957 AGGCCATTTATGGCATGGCAAGG + Intergenic
1201034496 Y:9773763-9773785 AGGCCATTTATGGCATGGCAAGG - Intergenic
1201401771 Y:13611317-13611339 GGTCCTTTTTGGGCATGGCATGG + Intergenic