ID: 906302818

View in Genome Browser
Species Human (GRCh38)
Location 1:44696011-44696033
Sequence CAGCCTAGCCTGAAGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906302812_906302818 20 Left 906302812 1:44695968-44695990 CCCAGGACAGAGGAAACAGAAGG 0: 1
1: 0
2: 7
3: 53
4: 652
Right 906302818 1:44696011-44696033 CAGCCTAGCCTGAAGAAAAAGGG 0: 1
1: 0
2: 2
3: 8
4: 163
906302814_906302818 19 Left 906302814 1:44695969-44695991 CCAGGACAGAGGAAACAGAAGGT 0: 1
1: 0
2: 1
3: 30
4: 312
Right 906302818 1:44696011-44696033 CAGCCTAGCCTGAAGAAAAAGGG 0: 1
1: 0
2: 2
3: 8
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906302818 Original CRISPR CAGCCTAGCCTGAAGAAAAA GGG Intronic
900695065 1:4004671-4004693 CAGCAAAGCCTGAAGAACAAGGG + Intergenic
902469254 1:16637168-16637190 CTGCCTAGACTCCAGAAAAAAGG + Intergenic
904269711 1:29341941-29341963 CAGCCAAGCCGTAAGAAGAAGGG - Intergenic
905662698 1:39739471-39739493 CAGACTAGCCAGAAAAAAAGTGG + Intronic
906031263 1:42722000-42722022 CACTCTAGCCTGAGCAAAAAAGG + Intergenic
906302818 1:44696011-44696033 CAGCCTAGCCTGAAGAAAAAGGG + Intronic
907468420 1:54655052-54655074 CAGCCCAGGCTGGAGAACAATGG + Intronic
907537154 1:55174104-55174126 CAGGCTAGCCTGAAGGTAAAAGG + Intronic
907675383 1:56513168-56513190 AAGAGTAACCTGAAGAAAAATGG + Intronic
912928358 1:113932924-113932946 CAGCAAAGGCTGAAGGAAAACGG - Intronic
913003452 1:114605099-114605121 CAGCCTTGTCTCAGGAAAAAAGG + Intronic
913451705 1:118997317-118997339 CAGACTAGCCTTAGGAAAAGCGG + Intergenic
917971960 1:180214230-180214252 CAGTCCAGACTCAAGAAAAAAGG + Intergenic
919263473 1:195230220-195230242 CTGACTAGCTTGAAGAGAAAAGG + Intergenic
924221998 1:241887168-241887190 CAGCCTAGGCAACAGAAAAAAGG - Intronic
1065241439 10:23708984-23709006 ATGCCTAGGCTGGAGAAAAAGGG + Intronic
1067370801 10:45679898-45679920 CAGCCGGGGCTGCAGAAAAATGG + Intergenic
1067388975 10:45846245-45846267 CAGCCGGGGCTGCAGAAAAATGG - Intronic
1067417088 10:46110702-46110724 CAGCCGGGGCTGCAGAAAAATGG + Intergenic
1067445286 10:46338304-46338326 CAGCCGGGGCTGCAGAAAAATGG + Intergenic
1067502503 10:46817595-46817617 CAGCCGGGGCTGCAGAAAAATGG + Intergenic
1067592086 10:47522424-47522446 CAGCCGGGGCTGCAGAAAAATGG - Intronic
1067639204 10:48030496-48030518 CAGCCAGGGCTGCAGAAAAATGG - Intergenic
1067874283 10:49989796-49989818 CAGCCGGGGCTGCAGAAAAATGG + Intronic
1068930410 10:62583444-62583466 CAGCCTAGTCTGAAGTGAAGTGG - Intronic
1070136195 10:73696656-73696678 CAGCCGGGGCTGCAGAAAAATGG - Intronic
1073195042 10:101683620-101683642 AAACCTAGTCTGAAGAAAACTGG + Intronic
1073393423 10:103198187-103198209 AACCCAAGCCTAAAGAAAAAGGG + Intergenic
1074872018 10:117584411-117584433 CAGCTAAGCCTGAAGTCAAAAGG - Intergenic
1076318583 10:129562016-129562038 CAGCTTAGCATGCAGATAAAAGG + Intronic
1077674034 11:4181850-4181872 CATCCTAGCCTTAAGAAACTAGG + Intergenic
1078466044 11:11551322-11551344 CACCCTCCCCTGAAGGAAAACGG + Intronic
1079581041 11:22065302-22065324 CAGCCTGGCTTGAATAAAACAGG + Intergenic
1080578538 11:33622532-33622554 CAGCCTAGGCAGCAGAAAGATGG + Intronic
1081004650 11:37720136-37720158 CAGCCTAGACTCAAGAAGAGAGG - Intergenic
1082948330 11:58784823-58784845 CATCATTGACTGAAGAAAAATGG + Intergenic
1090700199 11:129287638-129287660 CAGGCTACTCTGAATAAAAATGG - Intergenic
1090952836 11:131488543-131488565 CAGCCCAGATTCAAGAAAAAGGG + Intronic
1091386014 12:95062-95084 CTTCCTGGCCTGAAGAAAAGGGG - Intronic
1092391591 12:8084752-8084774 CAGTCTAGCCTGGAGAAAAAAGG - Intronic
1097238504 12:57556511-57556533 CAGCCTAGACTGATGTAAAGGGG + Intronic
1099047542 12:77740732-77740754 CAGCCTATCCTCAATAGAAATGG - Intergenic
1100037706 12:90273971-90273993 CACCCTAGCCTGAAGCCCAATGG + Intergenic
1100315751 12:93442578-93442600 CAGGGTAGGCTGAAGGAAAAGGG + Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1103271329 12:119676194-119676216 CAGCCCAGCCTGAAGGGAGAAGG + Intronic
1108480897 13:50870343-50870365 CAGACTAGCTTGAGGAAAGAGGG + Intergenic
1109627256 13:64992074-64992096 TAGCCTAGGCTGAAGAGCAATGG - Intergenic
1115168025 14:30471467-30471489 CAGCAAAGCAGGAAGAAAAATGG + Intergenic
1115961673 14:38840926-38840948 CAGTCCAGCCTGAAAAAAAGTGG + Intergenic
1117025595 14:51616684-51616706 CAGCCTAGAATGCATAAAAATGG - Intronic
1117194630 14:53327424-53327446 CAGACAAGCCTGAAAACAAATGG - Intergenic
1120235819 14:81889753-81889775 GAATATAGCCTGAAGAAAAAGGG - Intergenic
1121016824 14:90554015-90554037 CAGCCTGGCCAGAAGCCAAAGGG + Intronic
1123917486 15:25047392-25047414 CTGGCAAGCCTGAAGAAAAAGGG - Intergenic
1123944404 15:25232037-25232059 CAGCATACCCTGAAAAAACAAGG - Intergenic
1126013360 15:44325519-44325541 CAGCATAGCCTGAATCAGAAGGG + Intronic
1126348800 15:47723308-47723330 AAGCCTAACATGGAGAAAAATGG - Intronic
1131342776 15:91618275-91618297 CAGCCTGGGCTGATGAAGAAAGG + Intergenic
1132019204 15:98346007-98346029 CAGCCTAGCAGGTAGAACAAGGG + Intergenic
1132274395 15:100554274-100554296 CAGCACAGCCTGATGAGAAACGG + Intergenic
1133442181 16:5830069-5830091 AATCCTAGCCTGAAGAAAAGTGG - Intergenic
1135905142 16:26505144-26505166 GAGCCTAGAGTGGAGAAAAAGGG + Intergenic
1137633704 16:49967215-49967237 CAGCCTGGCGTGTAGACAAATGG - Intergenic
1137851654 16:51751877-51751899 CAGCCTATTTTGAAGAAAGAAGG + Intergenic
1138988475 16:62361422-62361444 CAGCCTGGGCAGAAGAAAGAAGG + Intergenic
1141530193 16:84640996-84641018 CAGCCTGGGCAAAAGAAAAATGG - Intergenic
1141883369 16:86874563-86874585 AAGCCCAGCCTGAAGAACACTGG + Intergenic
1143192912 17:5053539-5053561 CAGACCAGCCTGACCAAAAATGG - Intergenic
1147644248 17:42024300-42024322 CAGCCTGGACTCCAGAAAAAGGG + Exonic
1149299348 17:55289901-55289923 CAGCCTAGTTAGAAAAAAAAAGG + Intronic
1155736316 18:29226727-29226749 CAGCCTAGCCTGAATTTCAAAGG - Intergenic
1156184219 18:34642461-34642483 CAACCCAGCCTGAAGTAAAGTGG - Intronic
1157884492 18:51353307-51353329 CAGCCCAGATTCAAGAAAAAGGG + Intergenic
1167517009 19:49929349-49929371 CGGCCTCGGCTGAAGAAAGAAGG - Exonic
926209303 2:10857339-10857361 CACCCTAGGCTGGAGTAAAATGG - Intergenic
929476097 2:42250718-42250740 CACCCCAGTCTGAAGAACAATGG - Intronic
931687449 2:64806661-64806683 CAGCCCAGTCTCAAGGAAAAGGG - Intergenic
933560932 2:83885270-83885292 CAGACTATCCTTAAGAAAAATGG + Intergenic
934592926 2:95574013-95574035 GAGCTCAGACTGAAGAAAAAGGG - Intergenic
935363068 2:102264049-102264071 CAGCCTGGCATTAAGAAAAGGGG - Intergenic
940047523 2:149425062-149425084 CAGCTTATCTGGAAGAAAAAAGG - Intronic
940362136 2:152807097-152807119 CTGGCAAGCCTGAAGAGAAAAGG - Intergenic
943485605 2:188475719-188475741 GAGCATATCCTGAAGAAATAAGG - Intronic
943638941 2:190338356-190338378 CAGCTAGGCCTGAAGAAATAAGG + Intronic
946196286 2:218034547-218034569 CAGCCGAGCCTGGAGAAACGAGG + Intergenic
946200557 2:218068604-218068626 CAGCCCAGCCTGGAGAAACGAGG + Intronic
946589206 2:221224883-221224905 TAGCCCAGCCTGAAGATAGAAGG + Intergenic
947061149 2:226167549-226167571 CAGCCTCACCTGAAAAAAACAGG + Intergenic
947861215 2:233359538-233359560 CAGCCTGAGCTGGAGAAAAATGG - Intronic
948819857 2:240536402-240536424 AAGACTAGCCAGAGGAAAAACGG + Intronic
1169961060 20:11160663-11160685 CAGAGTAGCCTCATGAAAAAGGG - Intergenic
1169972167 20:11279777-11279799 CAGCCCAGATTGAAGAAAAGAGG + Intergenic
1175296843 20:57914339-57914361 CAGCATAGCCTGTAGACAACGGG + Intergenic
1176996150 21:15557724-15557746 CATCTTAGACTAAAGAAAAAGGG - Intergenic
1182071196 22:27464977-27464999 CAGCACAGTCTGAAGATAAAGGG - Intergenic
951825422 3:26863290-26863312 AGACCTAGCCTGAAGAATAAAGG + Intergenic
953700026 3:45188220-45188242 CAGCTTATCCTGAAGAACATGGG + Intergenic
954300175 3:49697026-49697048 CTGCCTAGACTCCAGAAAAAGGG - Intronic
956043078 3:65167192-65167214 CAGCCAAACTTCAAGAAAAAAGG - Intergenic
956047631 3:65213409-65213431 CAGGCTAGCCTGGTGAAAGAGGG + Intergenic
957007104 3:74962443-74962465 CAGCCTAGTCATAAGAATAATGG + Intergenic
957150165 3:76476258-76476280 CAGTCTAGACTTAAGAAAAAAGG - Intronic
958597484 3:96246216-96246238 CATCATAAACTGAAGAAAAATGG - Intergenic
961495377 3:127287654-127287676 CAGCTTTGCCTGAAGAAACTGGG - Intergenic
963165828 3:142202353-142202375 AAGGCTAGTCTGAAGCAAAATGG - Intronic
963196469 3:142536460-142536482 CAGCCCAGCTTGAAGAGGAAGGG - Intronic
964921640 3:161903804-161903826 GAGCCTAGCATAAAGAAAAGAGG - Intergenic
966459843 3:180164914-180164936 CAGCCTACCCAGATGAGAAAGGG - Intergenic
966746189 3:183279666-183279688 CATTTTATCCTGAAGAAAAAGGG + Intronic
966931670 3:184679340-184679362 CAGCCAAGCCTCCAGAACAAAGG + Intronic
967888146 3:194346994-194347016 CAGCCTGGCCTCAAGAAAGCAGG + Intronic
969405664 4:6989803-6989825 CAGCTAAGGTTGAAGAAAAAAGG - Intronic
971480450 4:27109857-27109879 CAGCCCAGCTTGATGAAAACTGG - Intergenic
974148839 4:57979664-57979686 CAGTGTAGCCTGAAAAAAACTGG - Intergenic
974191872 4:58515436-58515458 CTGCCTATGCTGAAGACAAAAGG + Intergenic
974509908 4:62825625-62825647 CTGCCTACCATGAAGAAAAGAGG - Intergenic
974745196 4:66063766-66063788 AAGCCTATTCTAAAGAAAAAAGG + Intergenic
975643414 4:76523608-76523630 CGACATAGCCTGAAGAACAAAGG - Intronic
976698497 4:87943768-87943790 AAGAGTAACCTGAAGAAAAAAGG + Intergenic
980350217 4:131674695-131674717 CAGCCTACCCTAAAAAATAATGG + Intergenic
984523682 4:180830760-180830782 CAGCACAGCATGAAGGAAAAAGG + Intergenic
984823218 4:183902684-183902706 CAGTCCAATCTGAAGAAAAATGG - Intronic
992474356 5:77087708-77087730 CAGCCTGGAGTGAAGAAAACTGG - Intergenic
994924428 5:106096198-106096220 AAGCTAAACCTGAAGAAAAATGG - Intergenic
995847322 5:116508335-116508357 CAGCCAAGCATGAAGCAAAAGGG + Intronic
997582350 5:135025922-135025944 CAGCTTTGCCTGAAGAAGACGGG - Intergenic
999007291 5:147996812-147996834 TAGGGAAGCCTGAAGAAAAATGG + Intergenic
999412662 5:151365966-151365988 CAGCCTGGTTTGGAGAAAAAGGG + Intergenic
999953622 5:156676649-156676671 CAGCCTAGGAAGAAGGAAAAGGG + Intronic
1000181071 5:158811937-158811959 CAGCCAAGTCTGAAGAATCAGGG - Intronic
1001550400 5:172598425-172598447 CAGCCCAGCCAGAAGACAGAGGG + Intergenic
1002613520 5:180436425-180436447 CAGCCTGCCCTGAAGAGAGACGG + Intergenic
1003350497 6:5313214-5313236 CATCCCAGCCTGATGAAAAGGGG - Intronic
1005186660 6:23170261-23170283 AAGCCTATTGTGAAGAAAAAAGG + Intergenic
1008678916 6:53851443-53851465 CAGGCAAGCATGAAGCAAAAAGG + Intronic
1010656773 6:78520813-78520835 CAGCCTCTCCTGAAGACAAGAGG + Intergenic
1011041584 6:83035218-83035240 CAGCCTAGATTGAAGCAAATGGG - Intronic
1012942983 6:105436110-105436132 CAGCCTAATCATAAGAAAAATGG - Intergenic
1015564002 6:134547062-134547084 TAGAATATCCTGAAGAAAAAGGG + Intergenic
1015714850 6:136181981-136182003 AAACCCAGCCTGAAGAAACAAGG - Intronic
1018785941 6:167108186-167108208 CATCCTAGTTTTAAGAAAAAAGG - Intergenic
1019410208 7:903573-903595 CAGCCTGGCCCAAAGACAAAAGG + Intronic
1023085679 7:36568094-36568116 CATCTTAGGCTAAAGAAAAAGGG + Intronic
1024761924 7:52609233-52609255 CAGCCTTGCCTGGAGAGAGAGGG - Intergenic
1024877129 7:54038139-54038161 CAGCCTAGCCACATGACAAAGGG - Intergenic
1026166405 7:67913835-67913857 CAGGCTACCCTGATGAAGAATGG - Intergenic
1027435257 7:78157862-78157884 CAGCTTTTCATGAAGAAAAAGGG + Intronic
1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG + Intronic
1032476834 7:132217327-132217349 CAGCCTAGCTGGGAGAGAAAAGG + Intronic
1033895130 7:146059164-146059186 AAGCAGAGCCTGAATAAAAATGG + Intergenic
1033925199 7:146450651-146450673 CAGCCTAGGTTTAAGAGAAAAGG + Intronic
1040673538 8:49721406-49721428 CAACCAAGCCTGAAGCAGAATGG + Intergenic
1043410746 8:79991794-79991816 CAGCCTATACTCAAGAGAAAGGG - Intronic
1045274794 8:100693714-100693736 ATGCATACCCTGAAGAAAAATGG + Intronic
1049191634 8:141291297-141291319 CAGCCCAGTCTGGAGAAAGAGGG + Intronic
1049445432 8:142628441-142628463 CAGCCAAACCTGAAGAAAGGAGG - Intergenic
1051634484 9:19169378-19169400 CAGCCTAGCCTGGGCAAAATAGG + Intergenic
1056650852 9:88460677-88460699 CAGGCCAGCAGGAAGAAAAAGGG + Intronic
1058748002 9:108010470-108010492 CAACCTATCCTGAAGGAAAGTGG - Intergenic
1059239352 9:112789940-112789962 AAGCCTTGCCTTATGAAAAATGG + Intronic
1059723411 9:116983668-116983690 ATGCCAAGCCTGAAGACAAAGGG - Intronic
1061935450 9:133855041-133855063 CAGCCCAGATGGAAGAAAAAGGG + Intronic
1186543500 X:10425182-10425204 CAGCCCACACTGAAGAAGAAAGG - Intergenic
1187257952 X:17658221-17658243 AAGTCCAGCTTGAAGAAAAAAGG + Intronic
1187525844 X:20054335-20054357 CATCAGAGCCTGAAGCAAAAGGG - Intronic
1189291614 X:39889971-39889993 CAGACTAGCTTAAAGGAAAATGG - Intergenic
1189684140 X:43546217-43546239 CAGCATTAACTGAAGAAAAATGG + Intergenic
1189862682 X:45289798-45289820 CATGCTAAGCTGAAGAAAAAGGG - Intergenic
1196464659 X:115959684-115959706 CATCGTAGCCTGAAGACAAGAGG - Intergenic
1196539495 X:116889318-116889340 CAGCCTAACCTGAAGACACTGGG - Intergenic
1196813732 X:119648429-119648451 CAGCCTAGTCTGCAGAAAAACGG - Intronic
1197011354 X:121568403-121568425 CAACTTAGCTTGAAGAAAAAGGG - Intergenic
1197208204 X:123808146-123808168 CAACATAGCCTGAACAAAATTGG + Intergenic